Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... Taken together our results indicate that the C2 domain of plant phospholipase Da can act as a cardosin A- binding domain and suggest that plant C2 domains may have an additional role as RGD ⁄ KGE-recognition ... 38190–38196. Cardosin A associates with phospholipase Da I. Simo˜es et al.5798 FEBS Journal 272 (2005) 5786–5798 ª 2005 FEBS Molecular analysis of the interaction between cardosin A and phospholipase Da Identification ... -trans-ferase-fused phospholipase Da constructs were performed. Results revealedthat the C2 domain of phospholipase Da contains the cardosin A- binding activity. Further assays with mutated recombinant...
- 13
- 455
- 0
Báo cáo khoa học: Structural basis for the interaction between dynein light chain 1 and the glutamate channel homolog GRINL1A docx
... 112, gal4D,gal80D, cyhr2, LYS2::GAL1UAS-HIS3TATA-HIS3,MEL1;URA3::GAL1UAS-GAL1TATA-lacz) was used for all yeasttwo-hybrid assays. The pre-transformed MATCHMAKERlibrary is a high-complexity ... plasma mem-brane of excitatory synapses, co-localizing with the NMDA receptors and close to proteins such as PSD-95, nNOS, shank and GKAP. The fact that GRINL 1A may associate with the NMDA ... (5-bromo-4-chloro-3-indolyl-b-d-galactopyranoside) and gluthatione were purchased fromSigma-Aldrich (Barcelona, Spain). 3-aminotriazole wasobtained from FLUKA (Sigma-Aldrich). The pre-trans-formed MATCHMAKER library, the yeast nitrogen basewithout...
- 11
- 474
- 0
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot
... massspectrometry along with the availability of comprehensiveprotein and DNA databases that made easy and quickprotein identification feasible. The analytical tools that areavailable nowadays allow the identification ... biochemistry-oriented laboratories for dec-ades. The efficiency of the subcellular fractionation wasassessed based on the determination of marker enzymeactivities, and a major analytical goal was the identification of ... ICAT reagent. As theseICAT pair peptides behave chemically the same duringchromatography and mass spectrometric analysis, the ratio of their intensities in the mass spectra is a semiquantitativemeasure...
- 11
- 493
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... observed; the chemical exchange for lactose and b-Me-Gal was in the slow exchange regime, whereas that for melibiose and a- Me-Gal, as anomers of lactose and b-Me-Gal,was in the intermediate exchange ... showing the chemical exchange for Asp18 or Trp33sc with increasing amounts of some sug-ars. Peak movements of main chain amide and amide proton of Asp18, and side chain amide and amide proton (marked ... insubdomains a and c [24,25]. Therefore, determination of the sugar -binding ability and specificity for each of the two sugar -binding sites in EW29Ch is expected toelucidate the molecular basis of...
- 11
- 458
- 0
Báo cáo khoa học: UXT interacts with the transcriptional repressor protein EVI1 and suppresses cell transformation ppt
... Clones A1 to A3 7 NDGrowth on SM -Trp ⁄ -Leu ⁄ -His ⁄ -Ala A1 , A6 , A7 , A1 0, A1 1, A1 4, A1 5, A1 7 A1 , A6 , A7 , A1 0, A1 4, A3 7 A2 0, A2 4, A2 5, A2 6, A2 9, A3 2, A3 3 A3 6, A3 7b-galactosidase activity ND A1 , A6 , ... celltransformation.UXT has also been isolated as STAP1 and classified as a member of the a class prefoldin family [33]. UXT(STAP1) is a component of a large protein complexthat can regulate transcription ... min at 72 °C, and a final 10 min at 72 °C extensiontime using the following human ⁄ mouse-specific primers:HME1 CCAGATGTCACATGACAGTGGAAAGCACTA;HME2 CCGGGTTGGCATGACTCATATTAACCATGG;UXT 5¢-GACAAGGTATATGAGCAGCTG;...
- 12
- 329
- 0
Báo cáo khoa học: An unusual plant triterpene synthase with predominant a-amyrin-producing activity identified by characterizing oxidosqualene cyclases from Malus · domestica ppt
... 5¢-TGAAGTTCTTCTCCCTTAAGAACTGCATTC-3¢; MdOSC3 forward,5¢-GCAATCGTGATCAAAGAAGATGTGGAGG-3¢; and MdOSC3 reverse, 5¢-TTCTCTTAAAATCTGAAAACGCCATAGG-3¢. Amplification conditions included an initialdenaturation ... vector as a negative control and a mixture of a- amyrin and b-amyrin as standards. Arrows indicate peaks with the sameretention time as a- amyrin and b-amyrin standards.C. Brendolise et al. Oxidosqualene ... control and a mixture of a- amyrin and b-amyrin as standard. MSfragmentations of peaks A and B (lowerpanel) were identical to those of authentic a- amyrin and b-amyrin (data not shown).Oxidosqualene...
- 15
- 467
- 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf
... (INT) and whole body(WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larvalinstar, and in the adult male WB (#), femaleWB ($), testis TES and ovary (OVA), ... 4th instardevelopment of L. decemlineata was constant until day6 except for a small peak at day 4, and rapidlyincreased to the major peak between day 8 and day 9[63]. Thus, EcR -A transcripts ... Corp.) and used as a probe. In com-petition experiments, 100-fold excess of unlabelled Pal1 wasincluded in the reaction mixture.Ligand binding assayLigand binding assay was performed as described...
- 15
- 564
- 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... 5¢-CGGGATCCCAATCTGTTGCTAATTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GAAGATCTACCACACCTCCTCATCTCC-3¢) for ampli-fication of the region from )180 to )36 and (5¢-GAAGATCTAACTAGATTTTACCATTGG-3¢) for amplification of the ... sequence analysis of the 35-bp regionidentified a DNA motif identical to the consensus DNA binding site (GGAAAA [37]), for a family of calciumregulated nuclear factors (nuclear factor of activated ... three copies of double stranded oligonucleotidesspanning the region from )70 to )36 of t he xMGPpromoter (5¢-GATCCAGGGGAGGGAAAACAAGGAGATGAGGAGGTGTGGT-3¢ ,and5 ¢-GATCTACCACACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3¢)as...
- 10
- 475
- 0
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot
... chloroform and once with chloroform, and RNA wasprecipitated with 2-propanol and dissolved in RNase-freewater. Single-stranded RNAs were allowed to anneal bymixing equal amounts of each strand, ... been identified and can be divided intoCHH -A and CHH-B groups [19]. In the crabs Can-cer pagurus, Carcinus maenas and Libinia emarginata and in the crayfishes Procambarus clarkii and Orconec-tes ... polymerase(Heber Biotec S .A. , Havana, Cuba). The amplification of CHH cDNA was carried out in 30 cycles as follows: denatur-ation 30 s at 95 °C, 1 min annealing at 65 °C and 1 min of extension at...
- 9
- 486
- 0
Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt
... RT-PCR analysis revealed the BmIVD bandamplified from whole-body RNA of standardstrains p50T and c108T as well as the skumutant. Migrations of the molecular massmarker and control gene rp49 are ... Koike Y, Nohata J,Kawasaki H, Kadono-Okuda K, Yamamoto K,Suzuki MG, Shimada T et al. (2003) The construction of an EST database for Bombyx mori and its application. Proc Natl Acad Sci USA 100, 14121–14126.27 ... isovaleryl-CoAdehydrogenase (BmIVD) gene as a candidate for the sku mutant A search of the silkworm expressed sequence tag(EST) database revealed the existence of several puta-tive acyl-CoA dehydrogenase genes...
- 12
- 631
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP