Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata Takehiko Ogura 1 , Chieka Minakuchi 1, *, Yoshiaki Nakagawa 1 , Guy Smagghe 2 and Hisashi Miyagawa 1 1 Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Japan 2 Laboratory of Agrozoology, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Belgium The growth of insects progresses via unique physiologi- cal events such as molting and metamorphosis. Those processes are strictly regulated by two peripheral hor- mones, molting hormone (20-hydroxyecdysone; 20E) and juvenile hormone (JH). 20E controls transcription of target genes by interacting with molting hormone receptor proteins, which bind to ecdysone response ele- ments (EcREs) located upstream of the target genes. The transcriptional activation by 20E triggers signal cascades, and the development is accomplished via complex regulatory mechanisms [1]. The heterodimer of two nuclear receptors, ecdysone receptor (EcR) and ultraspiracle (USP), functions as a molting hormone receptor, and 20E is known to be a ligand for EcR. USP is the homologue of vertebrate RXR [2,3]. Amino-acid sequences of EcR and USP were first determined in the dipteran fruit fly Drosophila melano- gaster [4–6], and subsequently determined in other insects [7–25], as well as a crustacean [26] and a tick [27,28]. These receptor proteins consist of regions Keywords ecdysone receptor (EcR); Leptinotarsa decemlineata; ponasterone A; ultraspiracle (USP); 20-Hydroxyecdysone Correspondence Y. Nakagawa, Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kyoto 606–8502, Japan Fax: +81 75 7536123 Tel: +81 75 7536117 E-mail: naka@kais.kyoto-u.ac.jp Present address *Department of Biology, University of Washington, Seattle WA 98195–1800, USA (Received 27 April 2005, revised 13 June 2005, accepted 16 June 2005) doi:10.1111/j.1742-4658.2005.04823.x cDNA cloning of ecdysone receptor (EcR) and ultraspiracle (USP) of the coleopteran Colorado potato beetle Leptinotarsa decemlineata (LdEcR and LdUSP) was conducted. Amino-acid sequences of the proteins deduced from cDNA sequences showed striking homology to those of other insects, especially the coleopteran yellow mealworm Tenebrio molitor. Northern hybridization analysis showed a 12.4-kb message for the LdEcR A-isoform, a 10.5-kb message for the LdEcR B1-isoform and a 5.7-kb message for the LdUSP, in fat body, gut, integument, testis and ovaries. In developmental profile studies, expression of both the LdEcR and LdUSP transcript in integument changed dramatically. In gel mobility shift assays, in vitro translated LdEcR alone bound weakly to the pal1 ecdysone response ele- ment, although LdUSP alone did not, and this binding was dramatically enhanced by the addition of LdUSP. LdEcR ⁄ LdUSP complex also showed significant binding to an ecdysone agonist, ponasterone A (K D ¼ 2.8 nm), while LdEcR alone showed only weak binding (K D ¼ 73.4 nm), and LdUSP alone did not show any binding. The receptor-binding affinity of various ecdysone agonists to LdEcR ⁄LdUSP was not correlated to their larvicidal activity to L. decemlineata. From these results, it was suggested that multiple factors including the receptor binding affinity are related to the determination of the larvicidal activity of nonsteroidal ecdysone agon- ists in L. decemlineata. Abbreviations ANS-118, chromafenozide; DBH, dibenzoylhydrazine; EcR, ecdysone receptor; EcRE, ecdysone response element; 20E, 20-hydroxyecdysone; pIC 50 , reciprocal logarithmic value of IC 50 ; PonA, ponasterone A; RH-0345, halofenozide; RH-2485, methoxyfenozide; RH-5849, N-tert-butyl- N,N¢-dibenzoylhydrazine; RH-5992, tebufenozide; RXR, retinoid X receptor; THR, thyroid hormone receptor; USP, ultraspiracle. 4114 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS referred to as A⁄ B, C (DNA binding), D, E (ligand binding) and F, which is consistent to other members of the nuclear receptor superfamily. Molecular regula- tory mechanisms of transcriptional activation by 20E were studied intensively in D. melanogaster [29–33], and were also reported for a dipteran, the yellow fever mosquitoe Aedes aegypti [34], and lepidopterans, the tobacco hornworm Manduca sexta [35–37] and the silkworm Bombyx mori [38,39]. On the other hand, the natural ligand of USP is unknown, although recent in vitro experiments indicated that JH binds to USP and regulates transcriptional events [40–42]. Although 20E is a steroidal compound, some syn- thetic ecdysone agonists which have no steroid struc- ture are known. Interestingly, it has been noted that, while the binding affinity of ecdysteroids such as 20E and its agonist, ponasterone A (PonA), is comparable among insect species, that of nonsteroidal ecdysone agonists, dibenzoylhydrazines (DBHs), are different among insect orders [43]. Recently, the X-ray crystal structure of the ligand binding domain of EcR was solved for the lepidopteran tobacco budworm Helio- this virescens [44]. Superimposition of PonA and a DBH type compound, BYI06830, as bound to EcR ligand binding domain, suggested that an aromatic ring moiety of BYI06830 occupies a binding pocket which is not fully shared with PonA. Thus, there is a possibility that the difference of binding affinity of DBHs to receptors among insect species is due to the difference of structures of the ligand binding pocket. In the other study, we demonstrated that the molting hormone activities of ecdysone agonists measured in cultured integument system of the lepidopteran rice stem borer Chilo suppressalis are correlated to and ruled by their respective receptor binding affinity to in vitro translated EcR and USP proteins of C. suppres- salis [45]. These recent results indicate that the import- ance to investigate ligand–receptor interactions and compare structures of molting hormone receptors among insects is increasing for a better understanding of the function of molting hormone in insect growth and development. Previously, we performed structure–activity relation- ship (SAR) studies of ecdysone agonists using C. sup- pressalis, the lepidopteran Spodoptera exigua and a coleopteran field pest, the Colorado potato beetle Leptinotarsa decemlineata [46–57]. In those studies, the larvicidal activity of DBHs against C. suppressalis was correlated with those against S. exigua but not correla- ted with those against L. decemlineata, suggesting that the receptor-binding of DBHs in L. decemlineata is dif- ferent to those in C. suppressalis and S. exigua. The aim of this study is to examine the SAR of ecdysone agonists for the molecular interaction with the molting hormone receptor. Here, we report (a) the determin- ation of primary amino acid structures of EcR and USP from L. decemlineata (b) the analysis of mRNA expression profile of L. decemlineata, EcR and USP, and (c) the measurement of the binding affinity of steroidal and nonsteroidal ecdysone agonists to the in vitro translated receptor proteins. Comparison of the receptor-binding affinity between various insects is expected to lead molecular bases for the divergence of the toxicity of ecdysone agonists. Results cDNA cloning of LdEcR and LdUSP A 379-bp fragment was amplified by RT-PCR using degenerate primers, and its sequence was determined. A deduced amino acid sequence of the PCR product was homologous to a corresponding part of EcRs of other insects. Then we subsequently conducted 5¢-RACE and 3¢-RACE, and sequences of 1337-bp and 998-bp frag- ments were determined, respectively. Combining these sequences of PCR fragments, we deduced the whole cDNA sequence of LdEcR to be 2714-bp long. The lon- gest open reading frame (ORF), which is followed by an in-frame termination codon, encodes a 565 amino acid peptide (Fig. 1A). The deduced amino acid sequence has a structure typical for the nuclear receptor super- family. We also amplified an 833-bp fragment by 5¢-RACE to determine a 2165-bp sequence. A 488 amino acid sequence was deduced from this 2165-bp cDNA sequence, which was different to the 565 amino acid sequence only in a part of A ⁄ B region (Fig. 1B). A database search was conducted using the blast program (http://www.ncbi.nlm.nih.gov/BLAST/) and the longer sequence (565 amino acids) was found to be highly homologous to previously reported EcR A-isoform of other insects. Thus we concluded that the longer cDNA encodes L. decemlineata EcR A-isoform (LdEcR-A). On the other hand, the shorter sequence (488 amino acids) was determined to be an EcR B1-isoform of L. decemlineata (LdEcR-B1). In the same way, we determined a 1699-bp sequence by combining sequences of 157-bp, 690-bp and 994-bp of RT-PCR, 5¢-RACE and 3¢-RACE fragments. A 384 amino acid sequence (Fig. 1C) encoded by the longest ORF of the cDNA sequence has a structure typical for the nuclear receptor superfamily. A database search with the blast program showed that this deduced sequence is highly homologous to other USPs. Thus we determined this sequence as L. decemlineata USP (LdUSP). T. Ogura et al. Molting hormone receptors of L. decemlineata FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4115 LdEcR-A and LdUSP amino acid sequences were compared with EcR and USP sequences of other insects, respectively (Table 1). The C region of LdEcR shares a very high amino acid identity with that of other EcR sequences (91–94%). The E region of LdEcR is also highly homologous to those of other EcRs (> 60%), especially to EcR-A from coleopteran Tenebrio molitor (TmEcR-A, 91%) and orthopteran Locusta migratoria (LmEcR, 89%). The D region is homologous to those of T. molitor and L. migratoria (78% and 70%, respectively), but less homologous to those of others (< 38%). The A ⁄ B regions are rather diverse among all sequences (< 52%). Similarly, the amino acid identity of the C region of LdUSP is also very high among all sequences (89–95%). Both D and E ⁄ F regions are also highly homologous to those of T. molitor and L. migratoria (96% and 75%, 88% and 69%, respec- tively), although they are less homologous to other USPs. A ⁄ B regions of USPs are highly diverse (6– 45%), as observed for EcRs. mRNA expression profiles The spatial expression pattern of EcR mRNA was analyzed using total RNA prepared from the fat body, gut, integument and whole body of L. decemlineata larvae at day 4 of the last (4th) instar. A 12.4-kb mes- sage was detected by the LdEcR common probe in the integument and whole body, and slightly in the gut. The mRNA of EcR was not detectable in the fat body (Fig. 2A). We also demonstrated the temporal expres- sion pattern of LdEcR in the integument of 4th instar larvae. As shown in Fig. 2A, the EcR message steeply increased at day 4, then remained at the high expres- sion level until day 8. Total RNAs from the whole body of male and female adult, testis and ovaries as well as from L. decemlineata cells were subjected to northern hybridization analysis. Although the EcR message was detected in all tissues, the message was weak in adult males. Expression of mRNA of LdEcR seems to be much higher in adult female than in adult male. The EcR transcript abounds in L. decemlineata Fig. 1. The deduced amino acid sequence of L. decemlineata molting hormone receptor. (A) The deduced amino acid sequence of LdEcR-A. The DNA binding domain (DBD, C-region) is underlined. The ligand binding domain (LBD, E-region) is underlined with dashes. The junction of LdEcR-A and LdEcR-B1 is shown by an arrow head. Gly164 and the downstream sequences are common between LdEcR-A and LdEcR-B1. The five amino acids encoded a 15-bp sequence that is absent in some cDNAs is boxed. (B) The deduced amino acid sequence of the iso- form-specific region of LdEcR-B1. This sequence connects to Gly164 in (A). (C) The deduced amino acid sequence of LdUSP. The DNA bind- ing domain (DBD, C-region) is underlined. The ligand binding domain (LBD, E ⁄ F-region) is underlined with dashes. The sequence data of LdEcR-A, LdEcR-B1 and LdUSP have been submitted to the DDBJ ⁄ EMBL ⁄ GenBank nucleotide sequence database under the accession number AB211191, AB211192 and AB211193, respectively. Molting hormone receptors of L. decemlineata T. Ogura et al . 4116 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS cells. A 10.5-kb transcript was also detected in all tis- sues and developmental stages, although the signals were very weak (Fig. 2A). Northern hybridization ana- lysis using LdEcR-A and LdEcR-B1 probes indicated that the 12.4-kbp signal is mRNA of LdEcR-A, and the 10.5-kbp transcript is LdEcR-B1 mRNA (Fig. 2B). We used LdEcR-A in the following experiments of our study because the expression of LdEcR-A is much higher than LdEcR-B1. Northern hybridization analysis was also conducted with the probe for USP using the same series of total RNA. The expression pattern of LdUSP, as 5.7-kb message, was similar to that of LdEcR-A over the dif- ferent tissues and developmental stages. The very high expression was observed in the whole body of female adults (Fig. 2A). SDS/PAGE and gel mobility shift assay of in vitro translated proteins LdEcR-A and LdUSP proteins were prepared by in vitro transcription ⁄ translation with [ 35 S]methionine and subjected to SDS ⁄ PAGE analysis (Fig. 3). Molecular mass for LdEcR-A and LdUSP was A B Fig. 2. mRNA expression profiles of LdEcR and LdUSP. (A) LdEcR mRNA and LdUSP mRNA expression in the fat body (FB), gut (GUT), integument (INT) and whole body (WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larval instar, and in the adult male WB (#), female WB ($), testis TES and ovary (OVA), and L. decemlineata cells BCIRL-Lepd-SL1 (CELL). For detecting LdEcR transcripts, LdEcR common probe was used. Ethidium bromide staining of rRNA is shown as a control for equal loading. (B) The expression of LdEcR-A and LdEcR-B1 mRNA in integument of last instar larvae. Temporal expression profiles were studied using isoform-specific probes. Table 1. Comparison of sequences. Sequence comparison between (A) L. decemlineata EcR A-isoform (LdEcR-A) and other EcR-A’s (B) LdUSP and other USPs. Amino-acid identity against LdEcR-A and LdUSP is expressed as percentage in each region. We could not com- pare F regions because their sequences are too short. TmEcR-A: Tenebrio molitor EcR-A (GenBank accession number Y11533 [22]), LmEcR: Locusta migratoria EcR (AF049136), DmEcR-A: Drosophila melanogaster EcR-A (M74078, S63761), CsEcR-A: Chilo suppressalis EcR-A (AB067811), AamEcR-A2: Amblyomma americanum (AF020188), UpEcR: Uca pugilator EcR-A2 (AF034086), TmUSP: T. molitor USP (AJ251542), LmUSP: L. migratoria USP (AF136372), DmUSP: D. melanogaster USP (X53417), CsUSP: C. suppressalis USP (AB081840), UpUSP: U. pugilator USP (AF032983). AA⁄ B C D E F Total TmEcR-A 52 94 78 91 – 80 LmEcR 34 94 70 86 – 68 DmEcR-A 23 91 25 67 – 34 CsEcR-A 38 92 26 61 – 51 AamEcR-A2 20 92 31 66 – 48 UpEcR 19 92 38 70 – 53 BA⁄ BC D E⁄ F Total TmUSP 45 95 96 75 74 LmUSP 41 94 88 69 68 DmUSP 16 89 21 39 38 CsUSP 39 91 59 47 53 UpUSP 22 91 64 54 52 T. Ogura et al. Molting hormone receptors of L. decemlineata FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4117 estimated to be 64 kDa and 49 kDa, respectively, from the mobility in the gel. The 64 kDa LdEcR-A protein was consistent with the predicted size from the deduced amino acid sequence (63.4 kDa). In the lane of translation products of LdEcR-A, extra bands with lower molecular weight were observed. They were probably degradation products of the full length 64 kDa protein. Similar results were obtained for the in vitro translation of USP of C. suppressalis [13]. Otherwise, they might be products of internal initiation or premature termination of translation. The 49 kDa LdUSP protein was slightly larger than the size predic- ted from deduced amino acid sequence (43.1 kDa). This might be the result of post-translational modifica- tions. A gel mobility shift assay was conducted using in vitro translated LdEcR-A and LdUSP proteins (Fig. 4). The mixture of LdEcR-A and LdUSP clearly bound to the pal1 EcRE probe [58]. Interestingly, a weak signal was also detected for LdEcR-A alone. When a 100-fold excess of unlabeled competitor was added, the band shift observed for the mixture of LdEcR-A and LdUSP disappeared. Drosophila hsp27 EcRE [59] probe gave the same results as pal1 (data not shown). These results indicate that LdEcR-A and LdUSP form the complex (LdEcR-A ⁄ LdUSP) and bind to the EcRE. Addition of 20E to the reaction mixture enhanced the probe-binding (data not shown) as observed in D. melanogaster [3], B. mori [60], Choris- toneura fumiferana [15] and Chironomus tentans [17], although EcR alone did not show binding to EcRE in those studies. Ligand binding assay The specific binding of in vitro translated proteins to PonA was calculated by the difference between total binding and nonspecific binding as we previously reported [45]. The dissociation equilibrium constant, K D , of PonA was calculated from the saturation curve of the specific binding and the Scatchard plot (Fig. 5). The K D values of LdEcR-A and LdEcR-A ⁄ LdUSP cal- culated from saturation curves were 72.6 and 2.8 nm, respectively. Receptor-binding affinity of ecdysone agonists to LdEcR-A ⁄ LdUSP is shown in Table 2. The binding affinity of DBHs tested in this study was relatively low (< 6.00 in terms of pIC 50 ) compared to that against C. suppressalis. The SARs for binding affinities of Fig. 3. SDS ⁄ PAGE of in vitro translated LdEcR-A and LdUSP pro- teins pET-23a (+) vector (lane 1), in vitro translated LdEcR-A (lane 2), LdUSP (lane 3) and LdEcR-A ⁄ LdUSP translated simultaneously in the same tube (lane 4) with [ 35 S]methionine were separated on 10% SDS ⁄ PAGE gel. Fig. 4. Binding of LdEcR-A ⁄ LdUSP complex to the ecdysone response element (EcRE). In vitro translated LdEcR-A and ⁄ or LdUSP protein were incubated with 32 P-labeled pal1 EcRE and then applied for nondenaturing polyacrylamide gel electrophoresis. Water (lane 1), a reaction mixture using pET-23a(+) vector substitute to LdEcR-A or LdUSP construct (negative control, lane 2), LdEcR-A (lane 3), LdUSP (lane 4) and LdEcR-A and LdUSP translated simulta- neously in the same tube (lane 5 and 6) were mixed with probes and loaded. In the lane 6, 100-fold excess of the same EcRE oligo- nucleotide was added for competition experiment. Molting hormone receptors of L. decemlineata T. Ogura et al . 4118 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS ecdysteroids were linearly correlated between L. decem- lineata and C. suppressalis, whereas those of DBHs were not (Fig. 6A). No positive correlation was observed between receptor-binding and larvicidal activity against L. decemlineata with respect to DBHs (Fig. 6B) [52,55]. Discussion The comparison of EcRs and USPs Three cDNAs encoding LdEcR-A, LdEcR-B1 and LdUSP were obtained, and they had high amino acid identity with EcR-A, EcR-B1 and USP of other insects, respectively. It is known that many insect spe- cies have two or three EcR isoforms (EcR-A, EcR-B1 and EcR-B2), and their functions are different depend- ing on tissues, developmental stages and species [5,12,14,22,61,62]. In D. melanogaster, it was reported that EcR-B1 is predominantly expressed in larval tissues, and expression of EcR-A is predominant in imaginal discs [5]. In B. mori, C. fumiferana, C. sup- pressalis and M. sexta, EcR-B1 was observed as the major isoform in larval stage, although expression pat- terns of EcR isoforms appeared to be diverse among these lepidopteran insects [12,14,61,62]. Thus, functions of EcR isoforms in larval stage might be different between lepidopteran and dipteran insects. In this study, we showed that L. decemlineata also possesses two isoforms, and the expression of LdEcR-A was much stronger than LdEcR-B1 (Fig. 2A). Expression of EcR-A was also predominant in larval tissue of coleopteran T. molitor [22]. These facts also indicate that the dominant isoform of EcR in larval develop- ment is different depending on tissues and insect orders. Furthermore, LdEcR-A transcripts in the integument increased steeply at day 4 of 4th instar lar- vae (Fig. 2A). We previously reported that the molting hormone titer in the hemolymph during 4th instar development of L. decemlineata was constant until day 6 except for a small peak at day 4, and rapidly increased to the major peak between day 8 and day 9 [63]. Thus, EcR-A transcripts in integument are pro- bably induced by the small peak of ecdysteroid on day 4, prior to the major hemolymph ecdysteroid peak. The strong expression of EcR transcripts prior to the peak of ecdysteroid titer in hemolymph was also repor- ted in various insects such as D. melanogaster and M. sexta [5,10,12,14,22,61]. Therefore, expression of EcR mRNA could be up-regulated by the rising of ecdysteroid titer in hemolymph to secure sufficient responsibility to the peak of ecdysteroid titer. Further studies for the mechanism of their transcriptional regu- lation would support the elucidation of different roles of EcR isoforms in Coleoptera. Although we have obtained only one isoform from L. decemlineata, two USP isoforms, MsUSP-1 and MsUSP-2, were cloned from lepidopteran M. sexta , and their different role on MHR3 promoter activation was shown [21,64]. Dipteran Aedes aegypti and C. ten- tans also possess two USP isoforms (USP-A and USP- B) [17,65]. Therefore, other USP isoforms might exist and contribute to the development of L. decemlineata. LdUSP showed higher conservation with two USP isoforms of the tick Amblyomma americanum (AamUSP-1 and AamUSP-2 [28]) than USPs of A. aegypti, C. tentans and D. melanogaster, but no significant difference was observed between homologies to two USP isoforms. LdUSP as well as T. molitor Fig. 5. The binding affinity of ponasterone A (PonA) to in vitro translated proteins. In vitro translated LdEcR-A or LdEcR-A ⁄ LdUSP were incubated with various concentration of [ 3 H]-labeled PonA, in the presence or absence of excess PonA. Saturation radioligand- binding curves and Scatchard plots are shown. T. Ogura et al. Molting hormone receptors of L. decemlineata FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4119 and L. migratoria USP showed higher homology to RXR of human and mouse than USP isoforms of dip- teran and lepidopteran insects. Thus, the functions of USP of L. decemlineata, T. molitor and L. migratoria might have the similar function to RXR, being differ- ent from those of Diptera and Lepidoptera. The LdUSP transcript showed similar developmental and spatial expression profiles as LdEcR-A. USP tran- scripts also changed with the hemolymph ecdysteroid titer in T. molitor, C. fumiferana and M. sexta, although their expression profiles were different from the case of L. decemlineata [15,21,23]. On the contrary, USP mRNA expression in the epidermis of C. suppres- salis and B. mori was ubiquitous throughout the last larval instar [13,66]. Such a difference suggests that hormonal regulatory mechanisms of USP transcription are different among insect species. Previously, it was pointed out that there is a con- served motif (motif-1) between T. molitor EcR-A (amino acids 29–39) and D. melanogaster EcR-A (143–153). The presence of conserved motif-2 between M. sexta EcR-A (60–79) and D. melanogaster EcR-A (177–196) was also pointed out in A ⁄ B region of EcRs [22]. The sequence of amino acids 108–118 of LdEcR-A is homo- logous to the motif-1, and this was also the case for EcR-A of coleopteran T. molitor. Interestingly, the sequence of amino acids 143–162 of LdEcR-A also has a striking homology with the motif-2. It is different from T. molitor EcR-A, but consistent to EcR-A of lepidop- teran M. sexta and C. suppressalis. EcR-A sequences of lepidopteran insects showed relatively lower homology to LdEcR-A in comparison with EcR-A homologies between insects of other orders and coleopteran L. de- cemlineata. Thus, each of these two conserved motifs in Table 2. Binding affinity of ecdysone agonists. Binding affinity (pIC 50 : M) of steroidal and nonsteroidal ecdysone agonists to the receptor of L. decemlineata (LdEcR-A ⁄ LdUSP) is shown. Com- pound 9: RH-5849, 10: halofenozide (RH-0345), 11: tebufenozide (RH-5992), 12: methoxyfenozide (RH-2485), 13: chromafenozide (ANS-118). No. N N H O O Xn Yn Binding affinity L. decemlineata X n Y n pIC 50 (M) 1 2-Cl 3-Cl 5.33 2 2-Cl 4-NO 2 4.33 3 2-Cl 2,4-Cl 2 4.58 4 2-OCH 3 H 5.42 5 2-O sec C 3 H 7 H 3.88 6 4-CF 3 H 3.27 7 2,5-Cl 2 3-CF 3 5.51 8 3,5-(CH 3 ) 2 H 4.35 9 H H 4.97 10 H 4-Cl 5.23 11 3,5-(CH 3 ) 2 4-C 2 H 5 5.18 12 3,5-(CH 3 ) 2 2-CH 3 -3-OCH 3 5.94 13 3,5-(CH 3 ) 2 2-CH 3 -3,4-(CH 2 ) 3 O- 5.77 14 PonA 8.13 15 20E 6.36 16 Ecdysone 4.98 17 Makisterone A 5.76 18 Cyasterone 6.29 A B Fig. 6. Relationships among biological activities. (A) Receptor-bind- ing affinity (pIC 50 : M) of ecdysone agonists against the receptor of L. decemlineata is compared to that of C. suppressalis. Triangles: ecdysteroids. Circles: DBHs. (B) Receptor-binding affinity (pIC 50 :M) and larvicidal activity (pLD 50 :mM ⁄ insect) of DBHs against L. decemlineata [52,55] were compared. Molting hormone receptors of L. decemlineata T. Ogura et al . 4120 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS A ⁄ B region might play different roles and be important for determining the function of the EcR-A, which is dif- ferent among insect species. The functional analysis of LdEcR-A and LdUSP The gel mobility shift assay showed that the complex of in vitro translated LdEcR-A and LdUSP proteins bound to EcREs, indicating that cDNAs cloned in this study encode functional EcR and USP. LdEcR-A alone also bound to EcREs, although the binding was much weaker than that of LdEcR-A ⁄ LdUSP. The binding experiment of EcR and USP proteins to EcREs was also conducted in dipteran D. melanogaster [2], A. aegypti [65] and C. tentans [17], and lepidopteran B. mori [60], C. suppressalis [13] and C. fumiferana [15]. In those experiments, EcR alone did not bind to EcRE, which is different from the result of this study. The degree of mobility shift of a band which is caused by monomeric binding of LdEcR-A alone should be much smaller than that by LdEcR-A ⁄ LdUSP. How- ever, the degree of band retardation by addition of LdEcR-A alone was a little larger than that of LdEcR- A ⁄ LdUSP. Therefore LdEcR-A alone appeared to bind to EcREs as a homodimer. Homodimeric binding to DNA sequences is reported for vertebrate THR, which shows similar characteristics to EcR [67,68]. Furthermore, it is concerned that the determinant of the binding type of nuclear receptors to its response element, namely monomer, homodimer and heterodi- mer, is the nucleic acid sequence of the hormone response element [69]. Thus, perhaps pal1 and hsp27 probes, which are not intrinsic EcREs of L. decemlin- eata, enable LdEcR-A to form a homodimer. From the ligand binding assays using [ 3 H]PonA, the K D value of ponA for LdEcR-A ⁄ LdUSP is 2.8 nm. The K D value was close to that for CsEcR-B1 ⁄ CsUSP (C. suppressalis) and DmEcR ⁄ DmUSP (D. melanogas- ter), which have been reported to be about 1.0 nm [3,45]. Thus, it was shown that in vitro translated LdEcR-A ⁄ LdUSP heterodimers are capable of inter- acting with ligands with high affinity, and possess a required ability for a receptor. The ligand binding affinity of LdEcR-A/LdUSP As shown in Fig. 6A, receptor-binding affinities of ecdysteroids were well correlated between LdEcR- A ⁄ LdUSP and CsEcR ⁄ CsUSP, whereas this is not the case for DBHs. As shown in Table 1, sequence homology of ligand binding domains between LdEcR-A and lepidopteran CsEcR-A is considerably lower than those between LdEcR-A and coleopteran TmEcR-A. Therefore, the difference between struc- tures of ligand binding domain is most likely respon- sible for the difference in receptor-binding affinities of DBHs among different insect orders. On the other hand, the ligand binding domain should have a sub- stantial conservation in the structure which is neces- sary for ecdysteroid binding regardless of insect orders, because 20E is believed to be the most active form of molting hormone in all insects. The crystal structure analysis of EcR of lepidopteran H. virescens indicated the amino acid residues which are import- ant for the binding with PonA and a DBH analog BYI06830 [44]. We examined the conservation of these amino acid residues among several insects by comparing the sequences of the ligand binding domain of EcRs (Fig. 7). As expected, amino acids which have been shown to be important for ecdyster- oids-binding are highly conserved among all insects. Thus, probably the structure of EcR ligand binding domain is also conserved among insects for arran- ging these amino acid residues in proper location to accommodate an ecdysteroid molecule. However, amino acids which have been shown to be important for binding with BYI06830 are also well conserved among EcRs. The difference in receptor-binding affinity of DBHs among insect orders might rather be attributed to the amino acid residues which are considered to be involved in binding to both types of ligands. Amino acids which are corresponding to Met429 and Thr451 of LdEcR-A represent the pos- sibility, as they are different between EcR-As of lepi- dopteran and other insects. Further studies such as point mutation and X-ray crystal structure analysis of various EcRs will elucidate the factors responsible for difference of the binding of DBHs to EcRs among insects. We previously reported that larvicidal activity and receptor-binding of DBHs are correlated very well in C. suppressalis, suggesting that receptor-binding affinity of DBHs is concerned to rule the strength of their larvicid- al activity [45]. Among DBHs, it was reported that halo- fenozide (RH-0345) has a high insecticidal activity against coleopteran field pests such as Popillia japonica and L. decemlineata, but tebufenozide (RH-5992), meth- oxyfenozide (RH-2485) and chromafenozide (ANS-118) were not so potent against these insects [43]. Thus, based on the case of DBHs in C. suppressalis, the receptor- binding affinity of RH-0345 was expected to be high in L. decemlineata. However, the receptor-binding affinity of RH-0345 and the other three DBHs to LdEcR- A ⁄ LdUSP was low (Table 2). Furthermore, the binding affinity of RH-2485 and ANS-118 was higher than that of RH-0345. This means that the receptor-binding T. Ogura et al. Molting hormone receptors of L. decemlineata FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4121 affinity of DBHs is not a major factor to determine the larvicidal activity in L. decemlineata. To make this point clear, we tested the receptor-binding affinity of other DBHs against LdEcR-A ⁄ LdUSP (Table 2). The measured binding affinity of 12 DBHs (1–12; Table 2) did not show any correlation to the larvicidal activity (Fig. 6B). Furthermore, our previous SAR study demonstrated that hydrophobicity of compounds is important to larvicidal activity of DBHs against C. sup- pressalis; thus the hydrophobicity is important for receptor-binding affinity. However, the hydrophobicity of DBHs was not correlated to their receptor-binding activity to LdEcR-A ⁄ LdUSP, although existence of optimal hydrophobicity for larvicidal activity of DBHs against L. decemlineata was shown in our previous study [52,55]. Therefore, other factors such as absorp- tion through the membrane and metabolism in the insect body might play a very important role. Otherwise, although DBHs are considered to show potency as agonists of 20E in C. suppressalis by binding to EcR ⁄ USP, there is a possibility that different mecha- nisms, such as neurotoxicity and the existence of other receptors, give influence on the larvicidal activity of DBHs in L. decemlineata. Further study such as X-ray crystal structure analyses of EcR ⁄ USP and metabolic analyses of DBHs in various insects would confer new knowledge of the mode of action of DBHs. A recent study of phylogenic analysis suggests that EcR and USP have coevolved during diversification of insects [70], which is supported by the result of this study (Table 1). It was also suggested that EcRs and USPs of lepidopteran and dipteran insects are under a strong acceleration of evolutionary rate in comparison with those of insects in other orders. This raises a possibility that the results of studies for EcRs and USPs of lepidopteran and dipteran insects are not necessary applicable for those of insects in other orders. Therefore, although a number of stud- ies has been conducted in lepidopteran and dipteran insects, more detailed studies on EcR and USP of insects in other orders and other ecdysozoan are necessary for precise understanding of their physiology. In conclusion, we successfully performed cDNA cloning of EcR and USP of L. decemlineata, and in vitro translation of corresponding receptor proteins. The translated proteins could bind to EcREs and ecdysone agonists as heterodimers, indicating that they are functional molting hormone receptors of L. decemlineata.AsL. decemlineata is a major pest in agriculture world-wide, the receptor proteins isolated in this study can be very helpful to develop effective compounds in high throughput assays and SAR stud- ies. Furthermore, although EcR and USP proteins have been isolated from various insects, the down- stream of the ecdysone signaling pathway which is triggered by their activation function of transcription still remains to be elucidated. The isolated genes and Fig. 7. Comparison of the ligand binding domain sequence of EcRs. Amino-acid sequences are compared for ligand binding domain of EcRs. LdEcR: L. decemlineata EcR, TmEcR: T. molitor EcR, LmEcR: L. migratoria EcR, D. melanogaster EcR, CcEcR: Ceratitis capitata EcR (Gen- Bank accession number AJ224341), AaeEcR: A. aegypti EcR (P49880), CtEcR: Chironomus tentans EcR (P49882), CsEcR: C. suppressalis EcR, CfEcR: C. fumiferana EcR (U29531), HvEcR: H. virescens EcR (O18473), BmEcR: B. mori EcR (P49881). Sequences are separated in three groups according to insect orders. The upper three sequences are EcRs of insects belonging to orders other than Diptera and Lepidop- tera. The middle four (shaded with light gray) are EcRs of dipteran insects, and the lower four are that of lepidopteran insects. Amino-acid residues which are important for the binding with PonA are shaded with dark gray, and that of BYI06830 are boxed [47]. The position of LdEcR-A Met429 and Thr451 are shown by arrow heads. Activation function 2 (AF-2) is indicated with dots. Amino acids which correspond to a-helical structures are also indicated. Molting hormone receptors of L. decemlineata T. Ogura et al . 4122 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS proteins will also be available to study protein–pro- tein interactions in such hormonal regulatory path- ways, and be helpful to understand the complicated physiology of insects. Experimental procedures Chemicals Ecdysone and 20E were purchased from Sigma Chemical Co. (St Louis, MO, USA) and PonA was from Invitrogen Corp. (Carlsbad, CA, USA). Tritiated ponasterone A ([ 3 H]PonA, 150 CiÆmm )1 ) was purchased from American Radiolabeled Chemicals Inc. (St. Louis, MO, USA). Ecdy- steroids (cyasterone and makisterone A) and all DBHs were from our stock samples [52,55]. Isolation of RNA from L. decemlineata Larvae and adults of L. decemlineata were reared as des- cribed previously [63]. A L. decemlineata cell line (BCIRL- Lepd-SL1), which was established from female pupae, was routinely maintained as described previously [71]. Total RNA was isolated from the whole bodies and tissues of last instar (4th) larvae and adults using TRIzolÒ (Gibco BRL, Grand Island, NY, USA) as described previously [13]. BCIRL-Lepd-SL1 was also used for isolation of total RNA. Poly (A)-rich RNA was purified from the total RNA using mRNA Purification Kit (Amersham Bioscience Corp., Piscataway, NJ, USA). RT-PCR Reverse-transcription was conducted using ReadyÆToÆ Go TM T-Primed First-Strand Kit (Amersham Bioscience Corp.) for total RNA isolated from the fat body and integument of last instar larvae. Three forward and reverse degenerate primers were designed for EcR based on amino acid sequences conserved in C-E regions of other EcRs (Table 3). In the same way, two forward and one reverse degenerate primers were designed for USP using the homology in C region of other USPs (Table 3). The first PCR for EcR was conducted using LdEcR-F1 and LdEcR-R1 primers (annealing temperature: 48 °C). Subsequently, the second and the third nested PCR were performed with LdEcR-F2 and LdEcR-R2 primers (52 °C) and with LdEcR-F3 and LdEcR-R3 primers (46 °C), respectively. The first PCR with LdUSP-F1 and LdUSP-R1 primers and the second nested PCR with LdUSP-F2 and LdUSP-R1 primers were conducted for USP. Annealing was performed at 48 °C and 46 °C, respectively. Rapid amplification of cDNA ends Poly (A)-rich RNA extracted from L. decemlineata cells was subjected to the 5¢- and 3¢- rapid amplification of cDNA ends (RACE) with SMART TM RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA). For both of EcR and USP, two reverse primers for 5¢-RACE and two forward primers for 3¢-RACE were designed (Table 3). 5¢-RACE for EcR was executed by PCR with primer LdEcR-RR1, and 3¢-RACE for EcR was per- formed with LdEcR-RF1, respectively, according to manu- facturer’s instructions. 5¢-RACE and 3¢-RACE were followed by nested PCR using LdEcR-RR2 (annealing temperature: 66 °C), LdEcR-RF2 (66 °C), respectively. In the same way, 5¢-RACE for USP was executed with LdUSP-RR1, and 3¢-RACE for USP with LdUSP-RF1. Each RACE reactions were followed by nested PCR Table 3. Primers used in this study. Degenerate primers and 5¢-and3¢-RACE primers are shown. The term N means a mixture of A, T, G and C. In the same way, D (A, G, T), H (A, C, T), K (G, T), M (A, C), R (A, G), S (C, G), W (A, T) and Y (C, T) means a mixture of deoxynucleo- side. L. decemlineata EcR L. decemlineata USP Degenerate primers LdEcR-F1 WSNGGNTAYCAYTAYAAYGC LdUSP-F1 ATHTGYGGNGAYMGNGC LdEcR-F2 GARGGNTGYAARGGNTTYTT LdUSP-F2 GGNAARCAYTAYGGNGTNTA LdEcR-F3 TGMGNMGNAARTGYCARGARTG LdUSP-R1 TCYTCYTGNACNGCYTC LdEcR-R1 TCNSWRAADATNRCNAYNGC LdEcR-R2 CATCATNACYTCNSWNSWNSWNGC LdEcR-R3 AAYTCNACDATNARYTGNACNGT 5¢-RACE LdEcR-RR1 GGTGATATAGGCTTGACTCCGTTGA LdUSP-RR1 GGCATCTGTTTCTTTGTCGCTTGTC LdEcR-RR2 ACACACTCTGCCCTCATTCCTACGG LdUSP-RR2 CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG LdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCC T. Ogura et al. Molting hormone receptors of L. decemlineata FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS 4123 [...]... Kiuchi M, Tomita S & Kamimura M (2002) Molecular cloning, expression analysis and functional confirmation of two ecdysone receptor isoforms from the rice stem borer Chilo suppressalis Insect Biochem Mol Biol 32, 999–1008 13 Minakuchi C, Nakagawa Y, Kiuchi M, Seino A, Tomita S & Kamimura M (2003) Molecular cloning and expression analysis of ultraspiracle (USP) from the rice stem borer Chilo suppressalis... homolog of NGFI-B, inhibits formation of the functional ecdysteroid receptor in the mosquito Aedes aegypti EMBO J 19, 253–262 35 Lan Q, Wu Z & Riddiford LM (1997) Regulation of the ecdysone receptor, USP, E75 and MHR3 mRNAs by 20-hydroxyecdysone in the GV1 cell line of the tobacco hornworm, Manduca sexta Insect Mol Biol 6, 3–10 36 Riddiford LM, Hiruma K, Zhou X & Nelson CA (2003) Insights into the molecular. .. Tissue-specific and stage-specific expression of two silkworm ecdysone receptor isoforms Ecdysteroiddependent transcription in cultured anterior silk glands Eur J Biochem 248, 786–793 62 Jindra M, Malone F, Hiruma K & Riddiford LM (1996) Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta Dev... Dhadialla TS & Raikhel AS (1996) The mosquito ultraspiracle homologue, a partner of ecdysteroid receptor heterodimer: cloning and characterization of isoforms expressed during vitellogenesis Mol Cell Endocrinol 121, 119–132 9 Swevers L, Drevet JR, Lunke MD & Iatrou K (1995) The silkmoth homolog of the Drosophila ecdysone receptor (B1 isoform): cloning and analysis of expression during follicular cell... (1997) Cloning of two putative ecdysteroid receptor isoforms from Tenebrio molitor and their developmental expression in the epidermis during metamorphosis Eur J Biochem 248, 856–863 23 Nicolai M, Bouhin H, Quennedey B & Delachambre J (2000) Molecular cloning and expression of Tenebrio molitor ultraspiracle during metamorphosis and in vivo induction of its phosphorylation by 20-hydroxyecdysone Insect... (1990) Relationship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor Nature 347, 298–301 7 Cho WL, Kapitskaya MZ & Raikhel AS (1995) Mosquito ecdysteroid receptor: analysis of the cDNA and expression during vitellogenesis Insect Biochem Mol Biol 25, 19–27 FEBS Journal 272 (2005) 4114–4128 ª 2005 FEBS Molting hormone receptors of L decemlineata 8 Kapitskaya... Kiuchi M (1999) Expression of ecdysone receptor isoforms and trehalase in the anterior silk gland of Bombyx mori during an extra larval molt and precocious pupation induced by 20-hydroxyecdysone administration Arch Insect Biochem Physiol 41, 79–88 39 Eystathioy T, Swevers L & Iatrou K (2001) The orphan nuclear receptor BmHR3A of Bombyx mori: hormonal control, ovarian expression and functional properties... Palli SR, Hiruma K & Riddiford LM (1995) Cloning of an ecdysone receptor homolog from Manduca sexta and the developmental profile of its mRNA in wings Insect Biochem Mol Biol 25, 845–856 21 Jindra M, Huang JY, Malone F, Asahina M & Riddiford LM (1997) Identification and mRNA developmental profiles of two ultraspiracle isoforms in the epidermis and wings of Manduca sexta Insect Mol Biol 6, 41–53 22 Mouillet... (1999) Studies on two ecdysone receptor isoforms of the spruce budworm, Choristoneura fumiferana Mol Cell Endocrinol 152, 73–84 15 Perera SC, Palli SR, Ladd TR, Krell PJ & Retnakaran A (1998) The ultraspiracle gene of the spruce budworm, Choristoneura fumiferana: cloning of cDNA and developmental expression of mRNA Dev Genet 22, 169–179 16 Imhof MO, Rusconi S & Lezzi M (1993) Cloning of a Chironomus tentans... Ministry of Education, Culture, Sports, Science and Technology of Japan Dr Guy Smagghe acknowledges the support of Research Grant 1.5.161.05 of the Fund for Scientific Research-Flanders (FWO, Brussels, Belgium) Dr Chieka Minakuchi is a recipient of a Research Fellowship from the Japan Society for the Promotion of Science for Young Scientists References 1 Riddiford LM, Cherbas P & Truman JW (2001) Ecdysone receptor . Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata Takehiko. structures of EcR and USP from L. decemlineata (b) the analysis of mRNA expression profile of L. decemlineata, EcR and USP, and (c) the measurement of the binding