Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme Masato Katsuyama*, Muhammer Ozgur Cevik*, Noriaki Arakawa, ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy-agishi M, Taira K & Yabe-Nishimura C (2005) Essen-tial role of ATF-1 in induction of NOX1, a catalyticsubunit of NADPH oxidase: involvement of mitochon-drial ... mitochon-drial respiratory chain. Biochem J 386, 255–261.9 Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C(2005) Transactivation of the EGF receptor and a PI3kinase-ATF-1 pathway is involved in...

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

... Recent advances in understanding the mechanisms of TCDD immunotoxicity. Int Immuno-pharmacol 2, 277–291.2 Kamath AB, Camacho I, Nagarkatti PS & NagarkattiM (1999) Role of Fas–Fas ligand interactions ... CO2.Apoptosis assay by determination of acetyl-Asp-Glu-Val-Asp ⁄ 7-amino-4-methylcoumarin(AcDEVD-AMC) cleavageThroughout the study we used the detection of caspase-3activation to evaluate apoptosis in ... examined the functionalparticipation of the PKC pathway, and in particularattempted to explore the possible role of PKCh in the TCDD-induced AhR-independent signal transductionmechanism involved...

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

... cellsthroughout the brain lobes and at the midline in the subesophageal ganglion (SG) (Fig. 1A) . The axonsemanating from the somata of the two pairs of lateralcells extend towards the pars intercerebral ... MADS box attheir N-termini and within an adjacent 29-amino-acidregion referred to as the MEF2 domain. The MADSbox is essential for DNA binding and dimerization,and the MEF2 domain plays an ... mori: amino acid sequence anddimeric structure. Agric Biol Chem 55, 73–86.6 Kawakami A, Kataoka H, Oka T, Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, NagasawaH, Suzuki A & Ishizaki...

Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx

... grammar, in which the subtrees are speciﬁed in advance, in an adaptor grammar the subtrees, aswell as their probabilities, are learnt from the train-ing data. In order to make parsing and inferencetractable ... repeatedly drawing a ball at random from the urn and then returning itplus an additional ball of the same color to the urn. In an adaptor grammar there is one DP for eachadapted nonterminal A ... application of adaptorgrammars, since the grammar can learn the possibleonset and coda clusters, rather than requiring themto be stipulated in the grammar. In the unigram syllable adaptor grammar shownin...

Báo cáo khoa học: "Some Comments on Algorithm and Grammar in the Automatic Parsing of Natural Languages" ppt

... of the frequently repeated contention that the tripartite approach, consisting in the separation of algorithm and grammar, is particularly desirable in automatic-parsing programs. This examination ... at the outset that in this author’s opinion the aim of the automatic-parsing component of a machine-translation program is the adequate recognition of the boundaries and functions of syntac- ... approaches can be singled out in the automatic parsing of natural languages. These are here called bipartite and tripartite, respectively. In the bipartite approach, the parsing program consists of...

Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx

... conditions. The N-terminal amino acidsequence of the 30 kDa product was Val-Val-Gly-Gly-His. Therefore, this 30 kDa band was in fact the bchain of mature MSP, and HGFA cleaved pro-MSP at the normal ... dose-dependent manner. Immunoblot analysisusing an anti-MSP IgG revealed a band of approxi-mately 60 kDa, presumably the a chain of matureMSP (Fig. 1A) . Generation of a band of approxi-mately 30 kDa, ... is a disulﬁde-linked heterodimer with a relative molecular mass of 80–95 kDa, consisting of an a chain of approximately 60 kDa and a b chain of approximately 30 kDa, that autophosphorylates itsspeciﬁc...

Tài liệu Báo cáo khoa học: Oxidized elaﬁn and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf

... breathing,where inhalation of micro-organisms and air pollutantsalways takes place. These proteins include a 1-protein-ase inhibitor (also called a 1-antitrypsin; a 53-kDa pro-tein that inhibits the above ... Pr3-mediated proteolysis of insol-uble extracellular matrix proteins, such as elastin, col-lagen, fibronectin and laminin? We have shown that the main effect of inhibitor oxidation is an increase in the ... 5¢-CGACTCGAGAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGACTCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ wereused for amplification of the elafin and the trappin cDNA5¢ end, respectively, and reverse primer 5¢CGAGCGGCCGCCCCTCTCACTGGGGAAC-3¢...

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... (CAGGACAGCCTGCGCAACGAG), RVR (CAGGACAGGGTGCGCAACGAG), SVR (CAGGACAGCGTGCGCAACGAG) and SLC (AGGGTATCCCTCTGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... assess the stability of the CYP 6A2 wt and mutantenzymes, we measured the apoenzyme and the holoenzymeamount for each one of them. The CYP 6A2 apoenzymeamount in each sample was determined by ... CYP 6A2 speciﬁcsignal, the star indicates unspeciﬁc signal observed in all lanes loadedwith bacterial protein. The CYP 6A2 variants have the same apparentmolecularmassasCYP 6A2 fromD. melanogaster...

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... Committee.Acetylcholine, atropine, concanavalin A, CCK-8 andCCK-8-NS were obtained from Sigma-Aldrich. Alamar bluewas obtained from Astral Scientiﬁc (Caringbar, New SouthWales, Australia).Guinea pigs weighing approximately ... pro-cessing intermediates. Am J Physiol 252, G315–G319.39 Anastasi A, Erspamer V & Endean R (1968) Isolationand amino acid sequence of caerulein, the active peptide in the skin of Hyla caerulea. ... Department of Environmental Biology, The University of Adelaide, South Australia2 Department of Chemistry, The University of Adelaide, South Australia3 Department of Clinical and Experimental Pharmacology,...

Tài liệu Báo cáo khoa học: FGF-2, IL-1b and TGF-b regulate ﬁbroblast expression of S100A8 doc

... pathological changes, including apoptosisand accumulation of ECM, in some forms of cataract[60]. The pattern of S10 0A8 gene regulation indicatesthat this protein may be involved in ﬁbroblast-to-myo-ﬁbroblast ... the S100 family of Ca2+-binding proteins and are now accepted as markers of in ammation. They areexpressed by keratinocytes and in ammatory cells in human ⁄ murine woundsand by appropriately ... dif-ferentiation, in ammation and wound healing [20,21].They are proposed to be involved in reorganization of the keratin cytoskeleton and differentiation of kera-tinocytes and in antibacterial or antioxidant...

Xem thêm

Từ khóa: báo cáo khoa học báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản báo cáo khoa học về cá tra báo cáo khoa học nghiên cứu chôm chôm trạng thái hiện sinh báo cáo khoa học biểu tượng văn học báo cáo khoa học tài liệu báo cáo khoa học cách trình bày báo cáo khoa học báo cáo khoa học toán học cách làm báo cáo khoa học Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ