Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism Marcel Amichot, Sophie Tare ` s, Alexandra Brun-Barale, Laury Arthaud, Jean-Marc Bride and Jean-Baptiste Berge ´ Unite ´ Mixte de Recherche 1112, Institut National de la Recherche Agronomique, Sophia Antipolis, France Three point mutations R335S, L336V and V476L, distin- guish the sequence of a cytochrome P450 CYP6A2 variant assumed to be responsible for 1,1,1-trichloro-2,2-bis-(4¢- chlorophenyl)ethane (DDT) resistance in the RDDT R strain of Drosophila melanogaster. To determine the impact of each mutation on the function of CYP6A2, the wild-type enzyme (CYP6A2wt) of Cyp6a2 was expressed in Escheri- chia coli as well as three variants carrying a single mutation, the double mutant CYP6A2vSV and the triple mutant CYP6A2vSVL. All CYP6A2 variants were less stable than the CYP6A2wt protein. Two activities enhanced in the RDDT R strain were measured with all recombinant pro- teins, namely testosterone hydroxylation and DDT meta- bolism. Testosterone was hydroxylated at the 2b position with little quantitative variation among the variants. In contrast, metabolism of DDT was strongly affected by the mutations. The CYP6A2vSVL enzyme had an enhanced metabolism of DDT, producing dicofol, dichlorodiphenyl- dichloroethane and dichlorodiphenyl acetic acid. The appar- ent affinity of the enzymes CYP6A2wt and CYP6A2vSVL for DDT and testosterone was not significantly different as revealed by the type I difference spectra. Sequence align- ments with CYP102A1 provided clues to the positions of the amino acids mutated in CYP6A2. These mutations were found spatially clustered in the vicinity of the distal end of helix I relative to the substrate recognition valley. Thus this area, including helix J, is important for the structure and activity of CYP6A2. Furthermore, we show here that point mutations in a cytochrome P450 can have a prominent role in insecticide resistance. Keywords: cytochrome P450; mutation; insecticide; resist- ance; structure. Many cytochrome P450 enzymes are known to be essential for the protection of organisms against xenobiotics. In insects, the involvement of cytochrome P450 enzymes in plant toxin or insecticide resistance has already been suggested or demonstrated [1–7], although high resistance levels to insecticides still remain unexplained. To date, only three of the cytochrome P450 enzymes linked to resistance have been shown to be able to metabolize insecticides. Two were cloned from the house fly: CYP6A1 metabolizes aldrin, heptachlor [8], terpenoids [9] and diazinon [10] and CYP12A1 metabolizes aldrin, heptachlor, diazinon and azinphosmethyl [11]. The third is CYP6A2 from Drosophila melanogaster. Baculovirus-directed production of wild-type CYP6A2 showed metabolism of cyclodiene and organo- phosphorous insecticides, but 1,1,1-trichloro-2,2-bis-(4¢- chlorophenyl)ethane (DDT) metabolism could not be detected [12]. In addition, sequence polymorphism of CYP6A1 and CYP6D1 has been documented in the house fly, but there is no link between these instances of polymorphism and insecticide resistance [7,13,14]. These results are in contrast with known instances of cytochrome P450 polymorphisms in humans, which are well known to affect the metabolism of drugs [15,16] and even pesticides [17]. In fact, only two examples of pesticide resistance linked to mutations in a cytochrome P450 have been described. Single substitutions in CYP51 of Candida albicans (T315A) [18] and of Uncinula necator (F136Y) [19] confer resistance to the fungicides fluconazole and to triadimenol, respect- ively. Nevertheless, the situation is qualitatively very differ- ent from enhanced degradation of insecticides, as CYP51 is itself the target of the fungicides. Significant information is now available on the structure of cytochrome P450. The majority of the structures des- cribed were those of cytochrome P450 from bacteria (for the first descriptions see [20,21]) but two microsomal P450 structures have also been obtained [22,23] that are currently the only two structures publicly available for eukaryotes. Although these structures were obtained from bacteria, rabbit or man, their overall similarity is striking. Based on these structures and on quantitative structure/activity relationships (QSAR) studies, several cytochrome P450 or pharmacophore models from mammals were built either in Correspondence to M. Amichot, Unite ´ Mixte de Recherche 1112, Institut National de la Recherche Agronomique, 400 route des Chappes, BP 167, 06903 Sophia Antipolis, France. Fax: + 33 492386 401, Tel.: + 33 492386 409, E-mail: amichot@antibes.inra.fr Abbreviations: DDA, dichlorodiphenyl acetic acid; DDD, dichlorodiphenyldichloroethane; DDT, 1,1,1-trichloro-2,2-bis- (4¢-chlorophenyl)ethane. Database: The sequence of the CYP6A2vSVL allele has been submitted to the GenBank database under the reference AY397730. Enzyme: Monooxygenases including cytochromes P450 (EC 1.14.14.1) (Received 10 December 2003, revised 3 February 2004, accepted 6 February 2004) Eur. J. Biochem. 271, 1250–1257 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04025.x relation with xenobiotic metabolism or with metabolism of endogenous compounds [24,25]. Models for CYP51 were also built in Saccharomyces cerevisiae [26] and C. albicans [27]. Cytochrome P450 structure modeling was found useful to explore the functional consequences of sequence poly- morphisms [28–30]. Many of these theoretical models were validated by site-directed mutagenesis. The majority of the mutagenesis studies focused in the vicinity or inside the substrate recognition sites (SRS [31]). These areas were proposed to interact with the substrates of cyto- chrome P450 and thus to be responsible for the specificity of the reactions catalyzed. In insects, little information is available about the structure of cytochrome P450. A recent report established some structure-activity relationships in CYP6B1v1, an insect cytochrome P450 involved in furano- coumarin metabolism [32]. Some years ago, we selected a D. melanogaster strain for its resistance to DDT we called RDDT R .Its resistance level (ratio of LD 50 of the strains) is extremely high (> 10 000) [33]). We have shown that the expression of Cyp6a2 was increased [34,35] and that several cyto- chrome P450 associated enzyme activities were modified (DDT, testosterone, lauric acid, ecdysone, ethoxycoumarin and ethoxyresorufin metabolism) [33,36]. Three point mutations (R335S, L336V and V476L) have been found in the variant of CYP6A2 from this dithiothreitol-resistant strain and preliminary studies suggested an effect of these mutations on DDT metabolism [6]. We have expressed several CYP6A2 variants in bacteria to study the effect of these mutations on CYP6A2 function. The structure of CYP102A1 that is the closest known P450 structure to CYP6A2 was used to infer positional information on the mutations. Experimental procedures CYP6A2 site-directed mutagenesis and bacterial expression Site-directed mutagenesis followed the protocol previously described [37]. The first step of the mutagenesis on the CYP6A2 cDNA (GenBank U78088) was the insertion of an NdeI restriction site at the first ATG codon (oligonucleotide CA1 5¢-AGCTACGCCATATGTTTGTT-3¢, the substi- tuted nucleotides are in bold) to subclone the cDNA in the pCW plasmid vector [38]. We then introduced the mutation F2A (oligonucleotide CA3 5¢-CGCCATATGGCTGTTC TAATA-3¢) to increase expression of CYP6A2 in E. coli [39]. This sequence is hereafter called the wild-type enzyme (CYP6A2wt) and was used for further mutagenesis. We obtained four new variants: CYP6A2vS, CYP6A2vV, CYP6A2vSV and CYP6A2vL using the oligonucleotides SLR (CAGGACAGCCTGCGCAACGAG), RVR (CAG GACAGGGTGCGCAACGAG), SVR (CAGGACAG CGTGCGCAACGAG) and SLC (AGGGTATCCCTC TGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI restrictions sites. The CYP6A2vSVL enzyme was built by the replacement of the CYP6A2vSV HindIII-HindIII fragment by its homologue from the CYP6A2vL allele which contained the mutation. The CYP6A2wt and all the mutants obtained were verified by sequencing. These constructions were transfected by electroporation (Easyject, Eurogentec) in the E. coli strain DH5a. Cytochrome P450 extraction The procedure was the same as described in [39]. At the end of the production, the cultures were chilled on ice (15 min) then centrifuged (4000 g,15min,4°C). Bacteria were resuspended by 10 mL of TSE buffer [100 m M Tris pH 7.6, 1m M EDTA, 1 m M phenylmethanesulfonyl fluoride, 30% (v/v) glycerol] including 250 lg of lysozyme. Cells were lysed at 4 °C for 1 h. The spheroplasts were pelleted (4000 g, 15 min, 4 °C) and kept overnight at )80 °C. The pellet was then resuspended in 10 mL of spheroplast buffer [100 m M potassium phosphate pH 7.6, 6 m M magnesium acetate, 20% (v/v) glycerol, 0.1 m M dithiothreitol] and lysed by sonication (six series of 20 s at 50 W, 4 °C). Unlysed spheroplasts were pelleted by centrifugation (4000 g,15min,4°C). The sonication and centrifugation steps were repeated once more. The supernatant was finally centrifuged at 100 000 g for 1 h (4 °C) and the pelleted membranes were resuspended in 1.25 mL of TSE buffer. The preparations were aliquoted in 125 lL fractions and kept at )70 °C until used. Protein concentration was measured as described in [40]. This process was also applied to bacteria transformed with the pCW vector. CYP6A2 concentrations In order to assess the stability of the CYP6A2wt and mutant enzymes, we measured the apoenzyme and the holoenzyme amount for each one of them. The CYP6A2 apoenzyme amount in each sample was determined by Western blotting using anti-CYP6A2 Igs [12] and the ECL system (Amer- sham Pharmacia Biotech). The photographic film was scanned and submitted to densitometry analysis using the IMAGEJ 1.29 software (http://rsb.info.nih.gov/ij/). The results were expressed as arbitrary units per litre. The holoenzyme concentrations were measured spectrophoto- metrically [41]. Data from densitometry and spectrophoto- metry measurements for each construction were divided by the relevant data obtained with the wild-type enzyme. These operations, for each construction, gave normalized values for the apo- and holoenzymes which were then used to calculate the holoenzyme/apoenzyme ratio. This ratio indicates the proportion of functional cytochrome P450 produced and is thus an index of its stability. Enzyme activities Each incubation initially contained house fly cytochrome b 5 (1 nmol) [42], house fly cytochrome P450-reductase (1 nmol) [8], CHAPS (0.15%), dilauroylphosphatidyl cho- line (1 mgÆmL )1 ) and 100 pmoles of cytochrome P450. In the control experiments, we used 200 lgofmembrane proteins from bacteria transformed with the pCW vector. Membrane protein (200 lg) is the mean amount necessary to get 100 pmol of CYP6A2vSVL, the least productive enzyme. The enzyme mix was preincubated on ice for 15 min. The reaction was then started by the addition of an NADPH regenerating system (80 m M glucose-6-phosphate; 200 m M NADP; 1 U glucose-6-phosphate dehydrogenase), Ó FEBS 2004 DDT metabolism by a mutant CYP6A2 (Eur. J. Biochem. 271) 1251 the substrate, i.e. either 0.5 lCi of [ 14 C]4-4¢-DDT-Ring-UL (82 mCiÆmmol )1 , dissolved in ethanol; Amersham Bio- sciences) or 0.25 lCi of [ 14 C]testosterone (57 mCiÆmmol )1 ; Sigma-Aldrich) and phosphate buffer (100 m M ,pH7.4)up to 200 lL. After 30 min incubation at 30 °C, the reactions were stopped by addition of 500 lL of methanol followed by precipitation of the proteins and incubation at 4 °Cfor 15 min. The mix was then centrifuged at 13 000 g for 15 min at 4 °C. For DDT metabolism, 150 lLofthe supernatant were analyzed by HPLC [Column Altima C18, 5 lm Alltech (250 · 4.6 mm) reverse phase]. The mobile phase consisted of a linear gradient from 50 to 85% (v/v) methanol in water, 0.2% (v/v) acetic acid (1.2 mL min )1 ). DDT and its metabolites were detected with an in-line Flow-one beta radioactivity detector (Radiomatic, Tampa, FL, USA). We were not able to determine the K m and V max values because of the very high hydrophobicity of DDT that did not allow an accurate determination of its effective concentration. The testosterone metabolites were resolved as described earlier [36] using thin layer chromatography [silica gel 60F 254 , Merck, first migration in dichlorometh- ane/acetone (4 : 1; v/v), second migration in chloroform/ ethyl acetate/ethanol (40 : 10 : 7; v/v/v)]. Cold markers migrated alongside the testosterone metabolites. After autoradiography of the thin layer chromatography plates, the metabolites were quantified by scraping the radioactive areas and counting with a Wallac 1410 counter. Substrate-induced binding spectra Spectral titrations were conducted using a double-beam spectrophotometer (Kontron Uvikon 860) with two CYP6A2 enzymes: the wild-type and CYP6A2vSVL – the one found in the RDDT R strain. Microlitre amounts (never more than 1% of the final volume) of a dimethylsulfoxide solution of DDT or of testosterone were added to the experimental cuvette and an equal volume of dimethylsulf- oxide to the reference cuvette so the final concentrations for each ligand ranged from 10 to 1000 m M .Eachcuvette contained 100 pmol of cytochrome P450 prepared as des- cribed above (Cytochrome P450 extraction). After the addition of the substrate, the difference spectrum was scanned from 375 to 500 nm. We checked that dimethyl- sulfoxide had no effect on the spectra. The type of substrate- induced binding spectra was determined by the positions of the peak and the valley on the spectrum [43]. Sequence alignment The alignments between CYP6A2, CYP2C5, CYP2C9 and CYP102A1 were obtained with the CLUSTALX software. To obtain information about the spatial positions of the mutations, their similar positions were determined on the structure of CYP102A1, this protein is the most similar to CYP6A2 among those with a known structure. The soft- ware used for this purpose was DEEPVIEW / SWISS - PDBVIEWER V3.7 (available at http://www.expasy.org/spdbv). Results Cytochrome P450 production in E. coli The CYP6A2 apoenzyme was produced by the bacterial cells in lower amounts for all the enzymes than for CYP6A2wt but the differences had not statistical significant (Table 1). Most of the peptide was present in the membrane fraction but  20% of the total was soluble (data not shown). In addition, to address concerns over the produc- tion efficiency, the Western blots showed that no apo- enzyme degradation occurred during the preparation process (Fig. 1). Furthermore, the apoenzymes have the same apparent molecular mass as the apoenzyme from Drosophila microsomes. As the antibodies are polyclonal [12], we assume that they recognize equally the CYP6A2 enzymes tested here. Spectral analysis of the preparations showed that there was a significant decrease in the specific contents of holoenzyme for the CYP6A2vSV and the CYP6A2vSVL enzymes (Table 1). The holoenzyme/apo- enzyme ratios of the variants, considered as a figure of the stability of the holoenzyme, are given in Table 1. Among the variants, those with a single substitution were the most stable (ratios ranging from 0.74 to 0.92). On the other hand, the CYP6A2vSV and the CYP6A2vSVL enzymes have a lower proportion of functional cytochrome P450 (ratio values of 0.44 and 0.37, respectively). The membrane preparations from bacteria transformed with pCW did not reveal any cytochrome P450 after a spectral analysis. Metabolism studies The low stability of the CYP6A2 mutants prevented us from purifying active CYP6A2 proteins to homogeneity and we used membrane preparations for metabolism studies Table 1. Cytochrome P450 production in bacteria. The apoenzyme and holoenzyme specific production of each mutant (mean ± SD, number of experiments in parentheses) was calculated. For each mutant, the production of apoenzyme and holoenzyme was normalized relative to the wild- type enzyme. The ratio of holoenzyme to apoenzyme normalized productions is an indication of the stability of the mutant. Cytochrome P450 mutant Apoenzyme production (arbitrary units) Holoenzyme production (nmolÆL )1 ) Normalized apoenzyme (production) Normalized holoenzyme (production) Holoenzyme/apoenzyme (normalized values) CYP6A2wt 15.2 ± 3.6 (3) 960 ± 800 (16) 1.00 1.00 1.00 CYP6A2vS 8.3 ± 5.5 (3) 390 ± 255 (5) 0.55 0.40 0.74 CYP6A2vV 12.9 ± 4.6 (3) 650 ± 250 (6) 0.85 0.67 0.79 CYP6A2vL 12.8 ± 3.8 (3) 750 ± 105 (3) 0.84 0.78 0.92 CYP6A2vSV 8.7 ± 4.2 (3) 245 ± 100 (11)* 0.57 0.25 0.44 CYP6A2vSVL 8.1 ± 6.7 (3) 190 ± 130 (8)* 0.53 0.20 0.37 * Statistically different from the reference (CYP6A2wt) (Dunnett test, P £ 0.01). 1252 M. Amichot et al. (Eur. J. Biochem. 271) Ó FEBS 2004 instead. First, we used testosterone to probe the activity of the CYP6A2 enzymes. All the variants were able to hydroxylate testosterone to give a metabolite with no significant differences in the specific activity for mutant enzymes relative to CYP6A2wt (Table 2). We tentatively identified this metabolite as 2b-hydroxy testosterone. No metabolism of testosterone was measured in control experiments (bacteria with no plasmid or empty pCW). The CYP6A2wt enzyme and four mutants metabolized DDT to dicofol, DDD and DDA. The CYP6A2vL variant did not produce DDD in detectable amounts (Table 3). The CYP6A2vV and CYP6A2vSV enzymes had the same specific activity on DDT as the CYP6A2wt enzyme. Statistical analysis showed that only two enzymes were significantly more efficient than CYP6A2wt in the metabo- lism of DDT: CYP6A2vS and CYP6A2vSVL. The former had a 4.79-fold higher specific activity than CYP6A2wt but only for dicofol production. In contrast, the CYP6A2vSVL mutant had 8.59-, 5.81- and 21.00-fold higher specific activities than did CYP6A2wt for the production of dico- fol, dichlorodiphenyldichloroethane (DDD) and dichloro- diphenyl acetic acid (DDA), respectively. Thus, only the CYP6A2vSVL enzyme, present in the insecticide resistant strain, was able to metabolize DDT efficiently. As observed previously with testosterone, no metabolism of DDT was observed in control experiments. For each enzyme, dicofol is the major metabolite produced. Nevertheless, a more careful analysis of the results demonstrated that the relative production of each metabolite varied among the enzymes. Focusing on the enzymes with significant differences in the metabolism of DDT, i.e. CYP6A2wt, CYP6A2vS and CYP6A2vSVL, the ratio dicofol : DDA (specific activities) is 70.00, 251.50 and 28.62, respectively, and the ratio DDD/DDA (specific activities) is 43.00, 62.25 and 11.90, respectively. These variations of the ratios of the metabolites suggest modifi- cations in the catalytic mechanism responsible for the metabolism of DDT. Substrate binding The substrate induced binding spectra associated to DDT and to testosterone are type I spectra (data not shown) and Fig. 1. Production of the CYP6A2 variants in bacteria. The lanes were loaded with 5 mg of bacterial protein prepared as described in Cyto- chrome P450 extraction. The arrow points to the CYP6A2 specific signal, the star indicates unspecific signal observed in all lanes loaded with bacterial protein. The CYP6A2 variants have the same apparent molecularmassasCYP6A2fromD. melanogaster microsomes. The apoenzyme production varied among the variants. No degradation was observed for any of the apoenzymes. Table 2. Specific production of 2b-hydroxy-testosterone by each of the CYP6A2 variants. The mean ± SD and number of experiments (in parentheses) are presented for each variant. No significant variation was observed relative to the specific activity of CYP6A2wt (Dunnett test, P >0.05). Cytochrome P450 mutant Hydroxy-testosterone production (pmol per pmol P450 per 30 min) CYP6A2wt 5.39 ± 0.50 (3) CYP6A2vS 5.40 ± 0.15 (3) CYP6A2vV 5.14 ± 0.12 (3) CYP6A2vL 5.44 ± 0.40 (3) CYP6A2vSV 3.86 ± 0.21 (3) CYP6A2vSVL 3.79 ± 0.95 (3) Table 3. Specific production of the DDT metabolites by each of the CYP6A2 variants. The mean ± SD and the number of experiments (in parentheses) are presented for each metabolite and variant. Four specific activities are significantly different from the control, namely dicofol production by CYP6A2vS and DDA, and DDD and dicofol production by CYP6A2vSVL. ND, not detected; NC, not calculated. Membrane preparation DDT metabolite DDA DDD Dicofol pmol per pmol P450 per 30 min Ratio to CYP6A2wt pmol per pmol P450 per 30 min Ratio to CYP6A2wt pmol per pmol P450 per 30 min Ratio to CYP6A2wt CYP6A2wt 0.03 ± 0.02 (8) 1.00 1.29 ± 0.19 (8) 1.00 2.10 ± 1.19 (8) 1.00 CYP6A2vS 0.04 ± 0.03 (9) 1.33 2.49 ± 1.28 (9) 1.93 10.06 ± 5.80 (9)* 4.79 CYP6A2vV 0.05 ± 0.04 (8) 1.66 0.97 ± 0.46 (8) 0.75 3.27 ± 2.39 (8) 1.56 CYP6A2vL 0.01 ± 0.01 (3) 0.33 ND NC 2.82 ± 2.95 (3) 1.34 CYP6A2vSV 0.04 ± 0.03 (9) 1.33 2.19 ± 1.54 (9) 1.69 4.61 ± 2.46 (9) 2.19 CYP6A2vSVL 0.63 ± 0.42 (6)** 21.00 7.50 ± 5.17 (6)** 5.81 18.03 ± 11.66 (6)** 8.59 * Significantly different from CYP6A2wt P £ 0.05); ** significantly different from CYP6A2wt (P £ 0.001; Dunnett test). Ó FEBS 2004 DDT metabolism by a mutant CYP6A2 (Eur. J. Biochem. 271) 1253 there was no qualitative difference between spectra obtained with CYP6A2wt and CYP6A2vSVL. For DDT, we did not observe significant differences between the apparent affinity of DDT to the CYP6A2 variants (Table 4). We found the same qualitative results for testosterone and we concluded that CYP6A2wt and CYP6A2vSVL bind DDT or testo- sterone with the same apparent affinity. Sequence alignments and 3D localization of the mutated positions The sequence alignments of CYP6A2 with CYP2C5, CYP2C9 and CYP102A1 are presented in Fig. 2. R335S is at a conserved position as a positive charge is found in the four sequences. L336V is at a position where an aliphatic amino acid preferentially occurs, whereas, V476L is at a nonconserved position. The R335S and L336V mutations are located in helix J, and the V476L site is at the limit of the b3–3 sheet. These structural elements are putative for CYP6A2 and deduced from the sequence alignment. These three positions of CYP6A2 are similar to K289, A290 and D425 of CYP102A1. Strikingly, these amino acids form a cluster distant from the active site, around the opening of the pore containing helix I when placed on a spatial model (Fig. 3). This cluster is located diametrically to the pole carrying the amino acids involved in substrate binding. As far as we know, there has been no report about structure activity relationships in this area of the cytochrome P450s. Discussion The D. melanogaster insecticide resistant strain selected in the laboratory, namely RDDT R , possesses a peculiar CYP6A2 enzyme: CYP6A2vSVL carrying three mutations. Two are contiguous (R335S and L336V) and the third one (V476L) was found distal to the C451 which binds the heme as described in preliminary work [6]. We expressed five CYP6A2 mutants and the wild-type protein in bacteria to verify whether these mutations confer to CYP6A2 the ability to metabolize DDT. First, the enzymes’ stability was addressed indirectly by spectrophotometry. As deduced from the ratio of holoenzyme/apoenzyme (Table 1), the stability of the protein was affected by each of the mutations Table 4. Apparent affinity of DDT and testosterone for CYP6A2wt and CYP6A2vSVL. For each apparent affinity calculated, the mean ± SD and the number of experiments (in parentheses) are given. Statistical analysis of the results demonstrated that there was no significant dif- ference among the values for each compound (t-test, P >0.05). DDT (l M ) Testosterone (l M ) CYP6A2wt 146 ± 31 (5) 100 ± 36 (5) CYP6A2vSVL 173 ± 26 (5) 106 ± 47 (5) Fig. 2. Sequence alignments between CYP6A2, CYP102A1, CYP2C5 and CYP2C9. Identical or conserved amino acids in the four sequences are shaded black, identical or conserved amino acids in three sequences are shaded grey. The secondary structures of CYP102A1 (labelled CYP102) are indicated below the alignment. The mutations found in CYP6A2vSVL are indicated above the alignments and boxed. 1254 M. Amichot et al. (Eur. J. Biochem. 271) Ó FEBS 2004 or their combination. The CYP6A2vSV and CYP6A2vSVL enzymes were particularly unstable. We checked that this was not the result of enhanced protein degradation. This first set of data demonstrates that these mutations alone or in combination altered the stability of CYP6A2. It is likely that this loss of stability is a consequence of structural modifications in CYP6A2. As the CYP6A2vSVL enzyme is the only one found in the insecticide-resistant Drosophila strain, this suggests that the three mutations may be important as a whole despite the instability they confer to CYP6A2. Testosterone was found to be a useful substrate for testing cytochrome P450 activities in Drosophila as in various other organisms. All of the heterologously expressed CYP6A2 enzymes were able to hydroxylate testosterone at one position identified as 2b with no significant variation in the specific activity. As a consequence, we considered testosterone hydroxylation at the 2b position as a nondis- criminating activity for the CYP6A2 enzymes. This activity was already observed with Drosophila microsomes as one of the major activities increased in the RDDT R strain [36]. As CYP6A2 was able to hydroxylate testosterone only at position 2b, it is likely that the other activities are carried by additional cytochrome P450 enzymes. CYP6A2wt was not able to metabolize DDT efficiently. In a previous work, no metabolism was detected [12]; this may be explained by differences in the expression strategy and metabolite analysis technique. In contrast to what was observed with testosterone, DDT metabolism clearly dis- criminated the mutants. The CYP6A2vSVL enzyme was the most effective in the degradation of DDT to produce dicofol, DDD and DDA. These compounds are no longer efficient insecticides and dicofol is the main metabolite produced from DDT by microsomes from the DDT- resistant strain [33]. As a first conclusion, these results strongly support that CYP6A2vSVL is a key enzyme for DDT metabolism and thus for resistance in the RDDT R strain. Furthermore, the CYP6A2vSVL enzyme is also remarkable because the ratio of the DDT metabolites it produces is different from the ratio observed for CYP6A2wt. As the proportion of the metabolites produced by an enzyme is a feature tightly associated to the catalytic mechanism, our results suggest that the active site may be modified or that the substrate may have access to the active site in different orientations according to the enzymes. The apparent affinities of DDT and of testosterone for the CYP6A2wt and CYP6A2vSVL enzymes were assessed to get more insights into the effects of the mutations on CYP6A2. We found no difference for these two substrates in their apparent affinities for the CYP6A2 enzymes. This was expected for testosterone as we did not observe any significant differences in its metabolism. By contrast, DDT bonded equally to both enzymes although it was metabo- lized differently. This suggests that the mutations induced a modification of the catalytic properties of CYP6A2 that is not caused by an alteration of substrate binding. These results, taken together, suggest that the three mutations have a subtle effect on the structure of this cytochromeP450andpromptedustoaddressthespatial positions of the mutations. According to the sequences alignment, the amino acids R335 and L336 would be in the J helix and V476 near or in the b sheet 3–3. These structural Fig. 3. Ribbon image of the structure of CYP102A1 showing the positions of the amino acids similar to R335S, V336L and L476V of CYP6A2. In addition to the positions similar to those mutated in CYP6A2vSVL (blue), this figure also presents the amino acids interacting with the substrate (black, according to [44]). The heme is presented in green to localize the active site. The I and J helices are labeled; the a helices are red and the b-sheets yellow. Ó FEBS 2004 DDT metabolism by a mutant CYP6A2 (Eur. J. Biochem. 271) 1255 elements have not been yet studied for their role in the structure or the activity of cytochromes P450. We high- lighted the similar positions in the structure of CYP102A1 as previous sequence analysis placed CYP6A2 in the same clan as CYP102A1 (http://drnelson.utmem.edu/ CytochromeP450.html). As evidenced from Fig. 3, these positions are far from the active site and from the amino acids interacting with the substrate but clustered around the distal end of the I helix. As testosterone metabolism is only slightly modulated in two variants among five, we can exclude any effect of these mutations on the electron transfer process. To elucidate the mechanism by which mutations on the J helix and in the vicinity of the b sheet 3–3 can affect the catalytic properties of CYP6A2, the building of a structural model appears necessary. The only other case in which the structure/activity relationships was questioned in relation to protein sequence in an insect cytochrome P450 is CYP6B1v1. This cyto- chrome P450 from Papilio polyxenes is involved in furano- coumarin metabolism. It has been demonstrated that three amino acids are involved in protein structure stability (F116, H117 and F484) and two in substrate specificity (F116 and F484). This was achieved after sequence alignment analyses and site-directed mutagenesis [32]. These amino acids belong to the SRS1 and SRS6 and these locations (junction between helices B¢ and C, junction between b sheets 4–1 and 4–2) are very different from the locations of the mutated positions in CYP6A2 (helix J and vicinity of the b sheet 3–3). These results are also original because this is the first description of the role of mutations in the metabolism of an insecticide by a cytochrome P450 enzyme. Indeed, a recent paper described CYP6G1 as responsible in D. melanogaster for the resistance against imidacloprid and DDT [1] but no direct metabolism of these insecticides by CYP6G1 has been documented to date. Furthermore, as the resistance ratios measured in these field-collected strains (< 30) are lower than that observed with the lab-selected RDDT R strain (> 10 000), it is likely that the resistance mechanisms are different between imidacloprid resistant strains and RDDT R , although both relies on cytochrome P450s. In conclusion, this work is the first to describe mutations in an insect cytochrome P450 that directly affect insecticide metabolism. These results demonstrate that CYP6A2vSVL should have a major role in the metabolism of DDT observed with microsomes of resistant Drosophila and thus support the hypothesis that mutations can be a resistance mechanism leading to high resistance levels. Further work is needed to clarify the relationships between mutations and overexpression affecting cytochrome P450s and their relat- ive importance in insecticide resistance. From the localiza- tion of the mutations on a spatial model of CYP102A1, we also point out a new region of cytochrome P450 that appears to be important for structure-activity relationships. The building of a homology model for CYP6A2 should be helpful to further understand the effects of the three mutations on the structure and activity of this enzyme. Acknowledgements We are very grateful to Dr Waters and Dr Ganguly for providing us with the full-length CYP6A2 cDNA, to Dr T. Friedberg for providing us with the pCW vector and to Dr Rahmani for the facilities to analyze the DDT metabolites. We also thank Dr R. Feyereisen for the house fly cytochrome P450 reductase and cytochrome b 5 cDNAsandfortheir fruitful discussions. The sequence of the CYP6A2vSVL allele is available at GenBank under the reference AY397730. References 1. Daborn, P.J., Yen, J.L., Bogwitz, M.R., Le Goff, G., Feil, E., Jeffers, S., Tijet, N., Perry, T., Heckel, D., Batterham, P., Feyer- eisen, R., Wilson, T.G. & ffrench-Constant, R.H. (2002) A single p450 allele associated with insecticide resistance in Drosophila. Science 297, 2253–2256. 2. Brandt, A., Scharf, M., Pedra, J., Holmes, G., Dean, A., Kreit- man, M. & Pittendrigh, B. (2002) Differential expression and induction of two Drosophila cytochrome P450 genes near the Rst (2) DDT locus. Insect Mol. Biol. 11, 337–341. 3. Scott, J.G. & Wen, Z. (2001) Cytochromes P450 of insects: the tip of the iceberg. Pest Manag. Sci. 57, 958–967. 4. Wilson, T.G. (2001) Resistance of Drosophila to toxins. Annu. Rev. Entomol. 46, 545–571. 5. Feyereisen, R. (1999) Insect P450 enzymes. Annu. Rev. Entomol. 44, 507–533. 6. Berge, J.B., Feyereisen, R. & Amichot, M. (1998) Cytochrome P450 monooxygenases and insecticide resistance in insects. Philos. Trans. R. Soc. Lond. B Biol. Sci. 353, 1701–1705. 7. Scott, J.G., Liu, N. & Wen, Z. (1998) Insect cytochromes P450: diversity, insecticide resistance and tolerance to plant toxins. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 121, 147–155. 8.Andersen,J.F.,Utermohlen,J.G.&Feyereisen,R.(1994) Expression of house fly CYP6A1 and NADPH-cytochrome P450 reductase in Escherichia coli and reconstitution of an insecticide- metabolizing P450 system. Biochemistry 33, 2171–2177. 9. Andersen, J.F., Walding, J.K., Evans, P.H., Bowers, W.S. & Feyereisen, R. (1997) Substrate specificity for the epoxidation of terpenoids and active site topology of house fly cytochrome P450 6A1. Chem. Res. Toxicol. 10, 156–164. 10. Sabourault, C., Guzov, V.M., Koener, J.F., Claudianos, C., Plapp, F.W. Jr & Feyereisen, R. (2001) Overproduction of a P450 that metabolizes diazinon is linked to a loss- of-function in the chromosome 2 ali-esterase (MdalphaE7) gene in resistant house flies. Insect Mol. Biol. 10, 609–618. 11. Guzov, V.M., Unnithan, G.C., Chernogolov, A.A. & Feyereisen, R. (1998) CYP12A1, a mitochondrial cytochrome P450 from the house fly. Arch. Biochem. Biophys. 359, 231–240. 12. Dunkov, B.C., Guzov, V.M., Mocelin, G., Shotkoski, F., Brun, A.,Amichot,M.,Ffrench-Constant,R.H.&Feyereisen,R.(1997) The Drosophila cytochrome P450 gene Cyp6a2: structure, locali- zation, heterologous expression, and induction by phenobarbital. DNA Cell Biol. 16, 1345–1356. 13. Cohen, M.B., Koener, J.F. & Feyereisen, R. (1994) Structure and chromosomal localization of CYP6A1, a cytochrome P450-encoding gene from the house fly. Gene 146, 267–272. 14. Tomita, T., Liu, N., Smith, F.F., Sridhar, P. & Scott, J.G. (1995) Molecular mechanisms involved in increased expression of a cytochrome P450 responsible for pyrethroid resistance in the housefly, Musca domestica. Insect Mol. Biol. 4, 135–140. 15. Ingelman-Sundberg, M. (2001) Genetic variability in susceptibility and response to toxicants. Toxicol. Lett. 120, 259–268. 16. Guengerich, F.P., Parikh, A., Turesky, R.J. & Josephy, P.D. (1999) Inter-individual differences in the metabolism of environ- mental toxicants: cytochrome P450 1A2 as a prototype. Mutat. Res. 428, 115–124. 17. Eaton, D.L. (2000) Biotransformation enzyme polymorphism and pesticide susceptibility. Neurotoxicology 21, 101–111. 1256 M. Amichot et al. (Eur. J. Biochem. 271) Ó FEBS 2004 18. Lamb, D.C., Kelly, D.E., Schunck, W.H., Shyadehi, A.Z., Akh- tar, M., Lowe, D.J., Baldwin, B.C. & Kelly, S.L. (1997) The mutation T315A in Candida albicans sterol 14 alpha-demethylase causes reduced enzyme activity and fluconazole resistance through reduced affinity. J. Biol. Chem. 272, 5682–5688. 19. Delye, C., Bousset, L. & Corio-Costet, M.F. (1998) PCR cloning and detection of point mutations in the eburicol 14alpha- demethylase (CYP51) gene from Erysiphe graminis f. Sp. Hordei, a ÔRecalcitrantÕ Fungus. Curr. Genet. 34, 399–403. 20. Ravichandran, K.G., Boddupalli, S.S., Hasermann, C.A., Peter- son, J.A. & Deisenhofer, J. (1993) Crystal structure of hemopro- tein domain of P450BM-3, a prototype for microsomal P450s. Science 261, 731–736. 21. Hasemann, C.A., Ravichandran, K.G., Peterson, J.A. & Dei- senhofer, J. (1994) Crystal structure and refinement of cytochrome P450terp at 2.3 A ˚ resolution. J. Mol. Biol. 236, 1169–1185. 22. Williams, P.A., Cosme, J., Sridhar, V., Johnson, E.F. & McRee, D.E. (2000) Mammalian microsomal cytochrome P450 mono- oxygenase: structural adaptations for membrane binding and functional diversity. Mol. Cell 5, 121–131. 23. Williams, P.A., Cosme, J., Ward, A., Angove, H.C., Matak Vinkovic, D. & Jhoti, H. (2003) Crystal structure of human cytochrome P450 2C9 with bound warfarin. Nature 424, 464–468. 24. de Groot, M.J. & Ekins, S. (2002) Pharmacophore modeling of cytochromes P450. Adv. Drug Deliv. Rev. 54, 367–383. 25. Lewis, D.F. (2002) Molecular modeling of human cytochrome P450–substrate interactions. Drug Metab. Rev. 34, 55–67. 26.Lewis,D.F.,Wiseman,A.&Tarbit,M.H.(1999)Molecular modelling of lanosterol 14 alpha-demethylase (CYP51) from Saccharomyces cerevisiae via homology with CYP102, a unique bacterial cytochrome P450 isoform: quantitative structure-activity relationships (QSARs) within two related series of antifungal azole derivatives. J. Enzyme Inhib. 14, 175–192. 27. Holtje, H.D. & Fattorusso, C. (1998) Construction of a model of the Candida albicans lanosterol 14-alpha-demethylase active site using the homology modelling technique. Pharm. Acta Helv. 72, 271–277. 28. Mathieu, A.P., Auchus, R.J. & LeHoux, J.G. (2002) Comparison of the hamster and human adrenal P450c17 (17 alpha-hydro- xylase/17,20-lyase) using site-directed mutagenesis and molecular modeling. J. Steroid Biochem. Mol. Biol. 80, 99–107. 29. Li, D.N., Seidel, A., Pritchard, M.P., Wolf, C.R. & Friedberg, T. (2000) Polymorphisms in P450 CYP1B1 affect the conversion of estradiol to the potentially carcinogenic metabolite 4-hydro- xyestradiol. Pharmacogenetics 10, 343–353. 30. Stoilov, I., Akarsu, A.N., Alozie, I., Child, A., Barsoum-Homsy, M., Turacli, M.E., Or, M., Lewis, R.A., Ozdemir, N., Brice, G., Aktan, S.G., Chevrette, L., Coca-Prados, M. & Sarfarazi, M. (1998) Sequence analysis and homology modeling suggest that primary congenital glaucoma on 2p21 results from mutations disrupting either the hinge region or the conserved core structures of cytochrome P4501B1. Am.J.Hum.Genet.62, 573–584. 31. Gotoh, O. (1992) Substrate recognition sites in cytochrome P450 family 2 (CYP2) proteins inferred from comparative analyses of amino acid and coding nucleotide sequences. J. Biol. Chem. 267, 83–90. 32. Chen, J.S., Berenbaum, M.R. & Schuler, M.A. (2002) Amino acids in SRS1 and SRS6 are critical for furanocoumarin meta- bolism by CYP6B1v1, a cytochrome P450 monooxygenase. Insect Mol. Biol. 11, 175–186. 33. Cuany, A., Pralavorio, M., Pauron, D., Berge ´ , J.B., Fournier, D., Blais, C., Lafont, R., Salau ¨ n, J.P., Weissbart, D., Larroque, C. & Lange, R. (1990) Characterization of microsomal oxydative activities in a wild-type and in a DDT resistant strain of Drosophila melanogaster. Pesticide Biochem. Physiol. 37, 293–302. 34. Amichot, M., Brun, A., Cuany, A., Helvig, C., Salau ¨ n, J.P., Durst, F. & Berge ´ , J.B. (1994) In Cytochrome P450 8th International Conference (Lechner, M.C., eds), pp. 689–692. John Libbey Eurotext, Paris, France. 35.Brun,A.,Cuany,A.,LeMouel,T.,Berge,J.&Amichot,M. (1996) Inducibility of the Drosophila melanogaster cytochrome P450 gene, CYP6A2, by phenobarbital in insecticide susceptible or resistant strains. Insect Biochem. Mol. Biol. 26, 697–703. 36. Amichot, M., Brun, A., Cuany, A., De Souza, G., Le Mouel, T., Bride, J.M., Babault, M., Salaun, J.P., Rahmani, R. & Berge, J.B. (1998) Induction of cytochrome P450 activities in Drosophila melanogaster strains susceptible or resistant to insecticides. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol. 121, 311–319. 37. Kunkel, T.A., Bebenek, K. & McClary, J. (1991) Efficient site- directed mutagenesis using uracil-containing DNA. Methods Enzymol. 204, 125–139. 38. Gillam, E.M., Baba, T., Kim, B.R., Ohmori, S. & Guengerich, F.P. (1993) Expression of modified human cytochrome P450 3A4 in Escherichia coli and purification and reconstitution of the enzyme. Arch. Biochem. Biophys. 305, 123–131. 39. Waterman, M.R., Jenkins, C.M. & Pikuleva, I. (1995) Genetically engineered bacterial cells and applications. Toxicol. Lett. 82–83, 807–813. 40. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. 41. Omura, T. & Sato, R. (1964) Tha carbon monoxyde binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. J. Biol. Chem. 239, 2379. 42. Guzov, V.M., Houston, H.L., Murataliev, M.B., Walker, F.A. & Feyereisen, R. (1996) Molecular cloning, overexpression in Escherichia coli, structural and functional characterization of house fly cytochrome b 5 . J. Biol. Chem. 271, 26637–26645. 43. Jefcoate, C.R. (1978) Measurement of substrate and inhibitor binding to microsomal cytochrome P-450 by optical-difference spectroscopy. Methods Enzymol. 52, 258–279. 44. Li, H. & Poulos, T.L. (1997) The structure of the cytochrome p450BM-3 haem domain complexed with the fatty acid substrate, palmitoleic acid. Nat. Struct. Biol. 4, 140–146. Ó FEBS 2004 DDT metabolism by a mutant CYP6A2 (Eur. J. Biochem. 271) 1257 . Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism Marcel Amichot,. show here that point mutations in a cytochrome P450 can have a prominent role in insecticide resistance. Keywords: cytochrome P450; mutation; insecticide;