Báo cáo Y học: Molecular interactions between nuclear factor kB (NF-kB) transcription factors and a PNA– DNA chimera mimicking NF-kB binding sites doc
Báo cáo Y học: Molecular interactions between nuclear factor kB (NF-kB) transcription factors and a PNA– DNA chimera mimicking NF-kB binding sites doc
... of NF -kB DNA DNA, PNA–PNA and PDP–PDP and GATA-1 and NF-IL2 DNA DNA hybrids on the interaction between crude nuclear extracts from B-lymphoid Raij cells and 32P-labelled HIV-1 NF -kB DNA DNA target ... predictionof molecular interactions between chimeras and NF -kB nuclear proteins were investigated by molecular dynamicssimulations, and interactions between PNA DNA chimeras and NF -kB proteins ... AAAAACATT-30(sense strand, NF-IL 2A) , 50-CACTTGAT AACAGAAAGTGATAACTCT-30(sensestrand, GATA-1) and 50-CATGTTATGCATATTCCTGTA-AGTG-30(sense strand, STAT-1).Stability of decoy moleculesThe stability of...
- 10
- 380
- 0
Tài liệu Báo cáo khoa học: Molecular aspects of rheumatoid arthritis: role of transcription factors ppt
... oftranscriptional factors on the pathology of rheumatoidarthritis (RA). Nuclear factor- jBThe nuclear factor- jB (NF-jB) proteins are a familyof ubiquitously expressed transcription factors thatplay an ... MINIREVIEW Molecular aspects of rheumatoid arthritis: role of transcription factors Hiroshi Okamoto1, Thomas P. Cujec2, Hisashi Yamanaka1 and Naoyuki Kamatani11 Institute of Rheumatology, Tokyo ... transcription factors Other transcription factors implicated in the patho-genesis of RA are the signal transducer and activatorof transcription (STAT) family of proteins, interferonregulatory factors...
- 8
- 520
- 0
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
... IRES-mediated translation and polyprotein processing as well as membranous web formation and RNA replication, illustrated here as separate steps for simplicity, may occur in a tightly coupled manner. ... genotype and other factors, this strategy results in a sustained virologic response in 50-80% of patients [2-5]. However, many patients do not qualify for or do not tolerate standard therapy [6]. ... replication and facilitated drug discovery. Novel systems for functional analyses of the HCV glycoproteins allowed the validation of HCV receptor candidates and the investigation of cell entry mechanisms....
- 6
- 497
- 1
Tài liệu Báo cáo khoa học: Paradoxical interactions between modifiers and elastase-2 Patricia Schenker and Antonio Baici docx
... steady-state rates in presence of Ch4S were significantly different from those in their absence(one-way analysis of variance and Tukey multiple comparison test). One-way analysis of variance also ... endopeptidase elastase-2 from human polymorphonuclear leu-kocytes is associated with physiological remodeling and pathological deg-radation of the extracellular matrix. Glycosaminoglycans bound ... evaluate any dis-turbance to inhibition by adding polysaccharides at twofixed concentrations representing their inhibitory and reactivation concentration ranges. As eglin c and a 1-PIare slow-acting...
- 10
- 588
- 0
Tài liệu Báo cáo Y học: Ligand interactions and protein conformational changes of phosphopyridoxyl-labeled Escherichia coli phosphoenol pyruvate carboxykinase determined by fluorescence spectroscopy pdf
... Chile;2Department ofMicrobiology and Immunology, University of Saskatchewan, Saskatoon, CanadaEscherichia coli phosphoenolpyruvate (PEP) carboxykinasecatalyzes the decarboxylation of oxaloacetate and ... spectroscopy.Escherichia coli phosphoenolpyruvate carboxykinase [PEPcarboxykinase; ATP:oxaloacetate carboxylase (trans-phos-phorylating) EC 4.1.1.49] catalyzes the reversible decarb-oxylation of oxaloacetic ... Ligand interactions and protein conformational changesof phosphopyridoxyl-labeledEscherichia coliphosphoenolpyruvatecarboxykinase determined by fluorescence spectroscopyMarı´ a Victoria...
- 9
- 533
- 0
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx
... long- and short-chainfatty acid substratesTo study the functional impact of the LPL C-terminaldomain on catalytic activity, wild-type and mutant proteinsR40 5A, K41 3A, K41 3A/ K41 4A, K41 4A, and ... nm was determined at an excitationwavelength of 386 nm. Oleic acid was used as a standardfor free fatty acid.Esterase activity was measured using p-nitrophenylbutyrate as a substrate. Samples ... (University of Utah, Salt LakeCity, UT, USA), or anti-(His-tag) polyclonal Ig (Medical and Biological Laboratories Co., Nagoya, Japan) was usedto detect LPL or His-tagged proteins. Bound antibody wasreacted...
- 10
- 679
- 0
Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx
... 5) showed that Rab31, Rab32 and Rab1 1A were equally enriched in the granule/mitochondrion and membrane fractions and that no R ab31 or R ab32, and only a s mall amount of Rab1 1A, was present in ... from a platelet MarathonTMcDNA library, usingas PCR primers, 5¢-TAGGATCCGCGATACGGGAGC-TCAAAG-3¢ (P31-1) and 5 ¢-ATCTCGAGGATGTGGG-Fig. 1. Nucleotide and deduced amino-acid s equences of Rab31 ... properties of Rab31 and Rab32New blood platelet Rab proteinsXiankun Bao1, Andrea E. Faris2, Elliott K. Jang1 and Richard J. Haslam1,2Departments of1Pathology and Molecular Medicine and 2Biochemistry,...
- 13
- 481
- 0
Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt
... glabra GgbAS1 b-amyrin synthase [6], was prepared byPCR using GgbAS1 as a template, Taq DNA polymerase(Takara Shuzo, Kyoto, Japan), the primers 50-GAAGCATATCCACTATGAAGATGA-30 and 50-TGAATACTCCCGTGATTTCCTGTTG-30, ... Noboru Hiraoka2, Yasumasa Ikeshiro2, Kazufumi Yazaki3,Shigeo Tanaka4, Tetsuo Kushiro5, Masaaki Shibuya5 and Yutaka Ebizuka51Gifu Pharmaceutical University, Japan;2Niigata College ... from 10-day-old-cultured Luffacells by guanidine thiocyanate/hot phenol extraction [24].Poly (A) -rich RNAwas purified by an mRNA purification kit(Pharmacia), and a Luffa cDNA library was constructedusing...
- 7
- 491
- 1
Báo cáo Y học: Molecular mechanisms underlying SHP-1 gene expression potx
... EMSA analyses, aside from the shifted band thatcontained USF1 and USF2, we observed other shiftedbands (X and Y) . As bands X and Y were only partiallyinhibited by 500-fold excess of unlabelled ... for binding factors in nuclear extracts from SKOV3 (an ovariancancer cell line) and MDA453 (a breast cancer cell line)(Fig. 5, lanes 2 and 7) for EMSA, we detected several shiftedbands. One band ... promoter(TTGAGCTCCAGGTGGAGCTCCAGGTG; E-box consensus sequences are in bold)or a Myc–Max consensus (TTAAGCAGACCAC GTGGTCTGCAACC) was usedas a probe. Nuclear extracts from SKOV3 (anovarian cancer...
- 8
- 418
- 0
Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf
... HRP-conjugated secondary Ig [anti-(mouseIgG) Ig or anti-(sheep IgG) Ig; Sigma Chemical Co.] and theECL system (Amersham-Pharmacia).Enzyme assays and trehalase activationTrehalase activity was assayed ... wascalibrated using vitamin B12(1.3 kDa), cytochrome c(12.4 kDa), carbonic anhydrase (29 kDa), ovalbumin(43 kDa), BSA (66 kDa), yeast alcohol dehydrogenase(150 kDa), b-amylase (200 kDa), apoferritin ... Southern and immunoblotanalysis with anti-Ha Ig. The triple-tagged strain C335(Ntp1p–Ha6H, Tps1p–Ha6H, Tpp1p–Ha6H) was obtainedafter mating strains C33 and C5, and Southern and immunoblot analysis...
- 9
- 428
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ