Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
... cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis Santosh Chauhan, Anil Kumar, Amit Singhal, Jaya Sivaswami ... GCTGTTATACCAGTATATGG EMSA,oligonucleotidesfor site 3P3R CCATAT ACTGGTATAACAGCP4F TGGTGTACTAATTTGATCTATG EMSA,oligonucleotidesfor site 4P4R CATAGATCAAATAGTACACCAH1 CGAGTCGACCGGAGGACCTTTGGCCCTGCGTCGACCGAEMSA,oligonucleotidesused ... footprintingP8 TGTTATACCAGTATATGGTGTACTA EMSA94RTf CTCGGCCTCAACTACAGTCGT Reverse transcription 94RTr ACAGGTAGCTGAGCAGCAGAC Reverse transcription 1994intR CAGCTAGCTGGCCGGGATAGC EMSA, DNase Ifootprinting,...
- 12
- 462
- 0
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot
... GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC1676S: GATCGCTAGCGTGTGATGAAGGCGGAAGATGTAAAAGGTGCHD3 inserts in pCMV-Tag21676ST: GATCGAATTCTGGAAGATGTAAAAGGTG2000AT: GATCGTCGACATCCAGTCAGTCGTCTATAC2000AX: GATCCTCGAGATCCAGTCAGTCGTCTATACN-terminal ... GATCGAATTCCCCCTGCAGATGCCAAAGATG304S: GATCGAATTCGAAGTGCCTAACTGC343S: GATCGAATTCGAGAGACTGGAAGGCAAAG349Rb: GATCGGATCCTCATTTGCCTTCCAGTCTCTCAGERM C-terminal deletions32 0A: GATCGGATCCTCAGCTGGAGAAATAAC29 9A: GATCGGATCCTCAGTAATCCCGAGGCTCCTG27 9A: ... GATCGAATTCACGCCCGCTTCGCCGAG,1839S: GATCGAATTCTGGCCGAGAGCCACCAGCAC,1851S: GATCGAATTCTGGCGGGGAACAAGCCG,1861S: GATCGAATTCTGCACAAGGTTCTGAACCA,1872S: GATCGAATTCTGAGCGACATGAAGGCGGAC,1877S: GATCGAATTCTAGCGGACGTGACCCGCCTG,1891S:...
- 15
- 323
- 0
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt
... GGATCCATGGTCATGGAAACATATCCATAAATCGG and CCATCCATGGTCAGTTGATAGGAGCTGTGAAGAAAAC, respectively (all incorporating NcoIsite, underlined). The resulting fragments were cloned intopEG202 using EcoRI and NcoI.The ... leads to prematureaging disorder Werner syndrome); (b) the RFC4 pro-tein, a DNA binding ATPase that acts as a processivityfactor for DNA polymerase delta and epsilon andloads proliferating ... multifuctional regulator of transcription, cell responses to genotoxic stress, protein degradationand signaling pathways [19]. Recent data indicate thatHBx localizes in mitochondria, and its overexpressioninduces...
- 12
- 468
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Miyazawa K, Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth ... Technology, Nagatsuta,Midori-ku, Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane ... kinase; HA, haemagglutinin; HAI-1, hepatocyte growth factor activatorinhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte growth...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... C-terminal adenylation domain A 4again is predicted to activate l-arginine, displaying60% identity to the characterized A- domain of MycC.Interestingly, A 1and A 4inherit a highly identical(90%) ... mLÆmin)1: lin-ear increase from 0% B to 50% within 20 min followed by a linear increase to 95% B in 5 min, holding B for anadditional 5 min. This gradient was also used to analyzecomparative extractions ... onto l-haOrn4. Takinginto account that the synthetases involved in the bio-synthesis of the DKP-inheriting toxins thaxtominand fumitremorgin also contain a C-terminal conden-sation domain,...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf
... recombinant chickenRPE65 to apparent homogeneity and demonstrated its isomerohydrolase activity, exploiting a novel enzymaticassay system that utilizes all-trans-retinyl palmitateincorporated into ... higher than its calculated value (60 944 Da) basedon the derived amino acid sequence [11], indicatingpost-translational modifications [12]. Hydropathy anal-ysis of the RPE65 amino acid sequence ... cellular retinaldehyde-binding protein. After 2 h of incuba-tion at 37 °C in the dark, the generated retinoids wereextracted with 300 lL of methanol and 300 lL of hexaneand analyzed by normal-phase...
- 11
- 587
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... reactions are pipetted into a 384-well plate,and acceptor beads containing antibody against HSF1 are added to the wells. After incubation, streptavidin-coated donor beads are added,and plates are ... domain.Stable binding requires simultaneous binding of allDNA-binding domains in a trimer to three adjacentnGAAn repeats. Therefore, a functional HSE containsat least three nGAAn repeats. ... TransLISA, a novel quantitative, nonradioactive assayfor transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre...
- 9
- 457
- 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis throughDR5 ... Leaman DW, Chawla-Sarkar M, Vyas K, Reheman M,Tamai K, Toji S & Borden EC (2002) Identification ofX-linked inhibitor of apoptosis-associated factor-1 as aninterferon-stimulated gene that ... J(2000) Cytochrome c release, mitochondrial membranedepolarization, caspase-3 activation, and Bax -a cleavageduring IFN -a- induced apoptosis in Daudi B lymphomacells. J Interferon Cytokine Res...
- 11
- 679
- 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified ... antiparasitic drugs. The African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large ... strains of Sac-charomyces cerevisiae. Its C-terminal catalytic domain sharesabout 30% amino acid identity, including all functionallyimportant residues, with the catalytic domains of humanPDEs....
- 11
- 566
- 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... chromatin incorpor-ating them. To see whether the increased transcription leakage observed at early addition of TSA can be explainedby an accumulation of acetylated forms of histones in a time-dependent ... triamcinolone acetonide (TA) at a concen-tration of 10)6M. TSA was added, at the same time, to a pool of injected oocytes, these are referred to as late TSA(L). Transcription was allowed to ... as well as histones in MMTV containingminichromosomesTreatment of oocytes with deacetylase inhibitors such asTSA may change the bulk acetylation pattern of histones,and in this way alter the...
- 10
- 500
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM