0
  1. Trang chủ >
  2. Y Tế - Sức Khỏe >
  3. Sức khỏe giới tính >

Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

... ORIGINAL RESEARCH Open Access Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines Leon Paolo R Lara*and Vicente Ocampo ... prospectivestudy in 2002 [8]. Biswas and Badrinath examined 2,010eyes of pulmonary TB patients and found a 1.39% ocular involvement [9].Other studies include data about ocular TB as a frac-tion of uveitis ... JrAbstractBackground: The objective of this study was to determine the prevalence of presumed ocular tuberculosis among diagnosed pulmonary tuberculosis patients in a tertiary government hospital...
  • 4
  • 517
  • 0
High rate of unintended pregnancy among pregnant women in a maternity hospital in Córdoba, Argentina: a pilot study docx

High rate of unintended pregnancy among pregnant women in a maternity hospital in Córdoba, Argentina: a pilot study docx

... Argentina and 2Department of Obstetrics and Gynecology, School of Medical Sciences, University of Campinas (UNICAMP), Campinas, BrazilEmail: Celina Palena - celinapalena@hotmail.com; M Valeria ... policymakers in improving FP programs.Methods The study was conducted at the Maternity and Neonatal Hospital of the Province of Córdoba, Argentina and the protocol was approved by the Institutional ... were mainly due to the smallsample size and the convenience sample which may notbe representative of the general situation at the provinceor at the country. Argentina has a population of almost...
  • 5
  • 456
  • 0
Predictors of relapse among pulmonary tuberculosis patients treated in a DOTS programme in South India pot

Predictors of relapse among pulmonary tuberculosis patients treated in a DOTS programme in South India pot

... were avail-able for 49 of these 51 patients at the time of relapse:39/49 (80%) relapses had drug-susceptible organismsand the remaining 10 patients had H-resistant organ-isms. Of the 32 patients ... RNTCP in the studysite at the time of investigation was below the nationalaverage (cure rate of 75% in the study area comparedto 85% at national level).7,8 Nearly one third of the patients ... irregular.Statistical analysis The data were computerised after scrutiny and furtheredited for completeness of all information relevantfor analysis. For calculation of the relapse rate, the nu-merator was the...
  • 6
  • 532
  • 0
EVALUATION OF DIFFERENT TYPES OF CHEST SYMPTOMS FOR DIAGNOSING PULMONARY TUBERCULOSIS CASES IN COMMUNITY SURVEYS pot

EVALUATION OF DIFFERENT TYPES OF CHEST SYMPTOMS FOR DIAGNOSING PULMONARY TUBERCULOSIS CASES IN COMMUNITY SURVEYS pot

... cough was relatively important andpredominant symptom among the symptomaticsas well as among cases as observed in all the threesurveys. A TB prevalence survey9 based onsymptom inquiry in Raichur ... surveys and the relative merits of eachsymptom employed in screening the population fordetection of cases.MATERIAL AND METHODS In 1999-2001, a baseline disease survey wasconducted in a random sample ... Indian Journal of Tuberculosis 116EVALUATION OF DIFFERENT TYPES OF CHEST SYMPTOMS FOR DIAGNOSING PULMONARY TUBERCULOSIS CASES IN COMMUNITY SURVEYSP. G. Gopi, R. Subramani and P.R. Narayanan(Received...
  • 6
  • 447
  • 0
Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx

Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx

... misleading as it may be accompanied by a decrease in the true positivity, and an increase in the relative number of false positives. This can be explained by the large number of treated patients ... Medical College and BYL Nair Charitable Hospital, Mumbai, India. 3 Department of Biology, Faculty of Science, Jazan University, Jazan, Kingdom of Saudi Arabia. *Corresponding Author: kismail@jazanu.edu.sa, ... the local ethical committee and Informed consent was obtained from patients. A total of 210 adult patients suspected to suffer from Pulmonary Tuberculosis on the basis of their clinical and...
  • 6
  • 465
  • 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

... evaluate the physicians' approach in the diagnosis and management of pulmonary tuberculosis. 2. To determine if there are deviations from the guidelines in TB management. MATERIALS AND ... It is the general objective of the study to determine the knowledge, attitudes and practices of specialist physicians in a tertiary care hospital as to: a. their idea of the magnitude of TB ... (n=36) of physicians fail to notify the health authority regarding pulmonary TB cases because of the lack of awareness among 53% (n=20) and because of paperwork involved in 26% (n=10) of respondents....
  • 10
  • 517
  • 1
Estimation of river discharge loadings of PAHs in a suburban river in Hiroshima Prefecture, Japan

Estimation of river discharge loadings of PAHs in a suburban river in Hiroshima Prefecture, Japan

... concentration. The yearly loading amount of PAHs was calculated with the data of river flow rate and PAH concentration, and the calculated yearly PAHs specific loading in the River on rainy days was 37 ... 2007)), the behavior of PAHs in Hiroshima Bay area was quantitatively investigated, and it was found that there was a major difference in PAHs loadings between the road traffic emission and the atmospheric ... discharge was calculated for estimating runoff ratio of each measured precipitation event. Specific discharge is defined as the ratio of runoff loadings to the area of a river basin, and runoff...
  • 12
  • 415
  • 0
Tài liệu The Formular of the National Discourse in Vietnam, 1940-1945 - Nguyễn Thế Anh pdf

Tài liệu The Formular of the National Discourse in Vietnam, 1940-1945 - Nguyễn Thế Anh pdf

... urban intellectuals to the Việt Minh cause and find ways of insinuating anti-French, anti-Japanese propaganda into legal newspapers and journals, the Peasants’ National Salvation Association, ... ‘Asia for the Asians’ and the feasibility of an equal and peaceful confederation. But the expediential policy of ‘maintaining tranquillity’ in Indochina adopted by Japan by leaving the French ... Association, the Students’ National Salvation Association, the Women’s National Salvation Association, the Teenagers’ National Salvation Association, and so on. Together, these associations acted as a...
  • 26
  • 716
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... (glutamate oraspartate) in transmembrane helix four as part of the ion-binding site. Therefore, the c ring of A. woodii hasonly 10 membrane-buried negative charges that areessential for binding ... binding the ion and also for the rotationalmechanism of the ring. The c ring of I. tartaricus has11 negative charges that are equally distributed along the horizontal axis of the rotor [8]. A positive ... direction in the membrane to the other two, forming the same patternas in the AFM surface representation of Fig. 2A. Bycomparison with the 3D structure of the I. tartaricusc ring [24], the black rings...
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan ... ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. 3. ACMSD I and ACMSD II extracellular expression. ... kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ andits complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢ and its...
  • 14
  • 601
  • 0

Xem thêm

Từ khóa: amp tobago and determination of drug susceptibility profile of tuberculosis isolates in the caribbeanthe applications of feature based image metamorphosis and eyelashes removal in the investigations of ocular thermographic sequencesliterary structures of religious meaning in the quran pdfhistory of biotechnology in the philippinesoverview of tourism in the philippinesoverview of tourism industry in the philippinesthe structure of the ethical terms in the quran pdfoverview of the origin of tourism in the philippinesschedule of english proficiency test for teachers in the philippinesherzberg theory of motivation in the workplace pdfdiscuss the origin of tourism in the philippinesdescribe the origin of tourism in the philippinesthe origin of tourism in the philippinesstructure of the banking system in the philippineshistory of fabric painting and printing in the philippinesNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ