0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt

Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt

Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt

... Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid Hiroaki Hayashi1, Pengyu Huang1, ... 353–729 of G. glabra GgbAS1 b-amyrin synthase [6], was prepared byPCR using GgbAS1 as a template, Taq DNA polymerase(Takara Shuzo, Kyoto, Japan), the primers 50-GAAGCATATCCACTATGAAGATGA-30 and ... T., Shibuya, M. & Ebizuka, Y. (2001) Cloning and characterization of a cDNA encoding b-amyrin synthase involved in glycyrrhizin and soyasaponin biosynthesis in licorice. Biol. Pharm. Bull....
  • 7
  • 491
  • 1
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

... (TaKaRa Bio Inc.). Forward primers 5¢-CGTTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CACAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi-trogen Corporation) and reverse primers 5¢-AAGTAGGCAACAAAACAACG-3¢ and ... proteins. PlantMol Biol 38, 77–99.16 Kamauchi S, Wadahama H, Iwasaki K, Nakamoto Y, Nishizawa K, Ishimoto M, Kawada T & Urade R (2008) Molecular cloning and characterization of two soybeanprotein ... wasgenerated from wild-type mRNA, and from mRNAthat contained AGG in place of both AUG1 and AUG2 (Fig. 1C, lanes 2–5), whereas it was not trans-lated from mutant mRNA in which both AUG3 and AUG4...
  • 12
  • 622
  • 0
Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

Báo cáo khoa học: Molecular cloning and characterization of two soybean protein disulfide isomerases as molecular chaperones for seed storage proteins doc

... as follows. DNA fragments were amplified from cDNAs of GmPDIL-1 and GmPDIL-2 by PCR using theoligonucleotide primers 5¢-GACGACGACAAGATGGAGGAATCATCGGAGAAAGAGTTC-3¢ and 5¢-GAGGAGAAGCCCGGTTCAAAGCTCATCTTTTCCTTTTTC-3¢ ... germi-nation and early growth [18]. Primary soybean seedstorage proteins are globulins called glycinin and b-conglycinin. They are folded and assemble into tri-mers in the ER, and are then transported ... 5¢-GAGGAGAAGCCCGGTTCAAAGCTCATCTTTTCCTTTTTC-3¢ forGmPDIL-1, and 5¢-GACGACGACAAGATGCTCACCGACGACGAGGACC-3¢ and 5¢-GAGGAGAAGCCCGGTTCATAATTCATCCTTCACATC-3¢ for GmPDIL-2. Ampli-fied DNA fragments were subcloned into...
  • 15
  • 424
  • 0
Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

Báo cáo khoa học: Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica doc

... GTCGTAATTAATCACTTAACCGTGCTCGCYP71 9A2 reverse GAAAGAAACAGAGCAAATCTTATCCTTTTACCCYP71 9A3 forward CCTCGTAACTAATATACCAGTGTGGTGCYP71 9A3 reverse GACAACCAAGCAAACTCTTATTCTTGTACInternal control geneb-actin ... (5¢-GTTATGGTGTAAGGCATAAAGATTAACCATAACC-3¢) and 5¢-GSP1 nested (5¢-TGTAAGGCATAAAGATTAACCATAACCCTAGTACC-3¢) and 3¢-RACE, 3¢-GSP1 (5¢-AATAAGGGTACTAGGGTTATGGTTAATCTTTATGC-3¢) and 3¢-GSP1 nested (5¢-AGGGTTATGGTTAATCTTTATGCCTTACACC-3¢). ... reverse CAATGGAGTTGGTGGGTGAABBE forward GAGATTAGTAGGAGTTGGGGTGAGABBE reverse ATTGGAGGGATACTTTGTGGATG4’-OMT forward CCTAGAAGAGGAATCAGAACATCCA4’-OMT reverse TCACTTCTCTCCCTTCCACCACYP71 9A2 forward...
  • 17
  • 376
  • 0
Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

Báo cáo khoa học: Molecular cloning and characterization of the crustacean hyperglycemic hormone cDNA from Litopenaeus schmitti Functional analysis by double-stranded RNA interference technique pot

... than six CHH-likecDNA have been identified and can be divided intoCHH -A and CHH-B groups [19]. In the crabs Can-cer pagurus, Carcinus maenas and Libinia emarginata and in the crayfishes Procambarus ... RNAs were allowed to anneal bymixing equal amounts of each strand, heating to 100 °C for1 min, and cooling gradually to room temperature for3–4 h. Single-stranded RNAs and the annealed RNA(dsRNA) ... Molecular cloning and characterization of the crustaceanhyperglycemic hormone cDNA from Litopenaeus schmittiFunctional analysis by double-stranded RNA interference techniqueJuana M. Lugo1,...
  • 9
  • 486
  • 0
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

... fluorophosphate was from FlukaChemie AG, Switzerland. Phenylmethanesulfonyl fluoride and okadaic acid were from Sigma. Trypsin of modifiedsequencing grade was obtained from Promega, and LysC of Achromobacter ... phosphatase and anendosomal protein may be of interest in the light of therecently described histidine phosphorylation of annexin I from a membrane preparation of ovine tracheal epithelia[34]. Although ... phosphopeptide I in the standard assayattherateof0.30nmolÆmin)1.The purified human recombinant phosphohistidine phos-phatase showed only one band in SDS/PAGE, with anapparent molecular mass of about...
  • 8
  • 666
  • 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

... N-terminalsequencing. The amino -acid sequences of proteins X and Y were identified in the Swiss-Prot databank as GatY and UP12, respectively. GatY (D-tagatose-1,6-bis-phosphatealdolase of class ... including UspA itself(Fig. 2), and one larger protein consisting of two UspAdomains in tandem [17]. The small members of this familyare proteins of 142–144 amino-acids long; they are acidic and ... was amplified byPCRusinga5¢ complementary deoxyoligonucleotide(5¢-CGCGGATCCATGTATAAGACAATCATTATGC-3¢)containing a BamHI site (underlined nucleotides) and a 3¢deoxyoligonucleotide harboring...
  • 9
  • 548
  • 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf

... Ishikara, T. & Fukagawa, Y. (1980) Deacetylation of PS-5, a new beta-lactam compound III. Enzymological char-acterization of L-amino acid acylase and D-amino acid acylase from Pseudomonas ... TheN-D-AAase had higher hydrolysing activity against N-ace-tyl-D-amino acid derivates containingD-methionine,D-leucine and D-alanine and against N-chloroacetyl-D-phe-nylalanine. Importantly, ... amidohydrolase; Alicaligenesfaecalis-DA1: Alcaligenes faecalis DA1N-acyl–D-amino acid amidohydrolase;V. paradoxus Iso1: Variovorax paradoxusIso1 N-acyl-D-amino acid amidohydrolase;P. abyssi: Pyrococcus...
  • 11
  • 656
  • 0
Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf

Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf

... drop-dialysed against water and analysed by MALDI-TOF MS.Phosphatase treatmentDry N-glycan samples were dissolved in 50 mMammoniumbicarbonate, and 1 U of calf intestinal alkaline phosphatase (New ... composed of anN-terminal heavy chain, the bradykinin moiety and a C-terminal light chain. The heavy chain and light chain areinterlinked by disulfide bridges. Kininogens are furtherclassified into ... proteinases like papain and ficin but they had noeffect on trypsin, a serine proteinase. Wolffish kininogencarried a2 ,3-sialylated biantennary and triantennary N-gly-cans with extensive sialic acid...
  • 8
  • 428
  • 0
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx

... between oyster CaM and CaLP. In the presence of calcium, oyster CaLP and CaM appeared as a single band with an apparent molecular weight of approximately 18 kDa and 14 kDa, respectively, whereas in ... second and thirdEF-hand domains in oyster CaM and CaLP, while itreflected Ca2+-binding to the first and second EF-handdomains in the case of VanScyoc et al.CaLP and CaM chromatography of extracts ... N,N,N¢,N¢-tetra-acetic acid (EGTA) in the presence of SDS. Calcium binding activity was examined by themethod of 45Ca overlay analysis [45]. The purified recom-binant oyster CaM and CaLP protein was transferred...
  • 12
  • 375
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ