Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"
... A qualitative study of morning ward rounds of anintensive care unit that triangulates data from video-basedinteraction analysis, observation, and interviews.Results Our analysis demonstrates ... complex nature of interaction of multidisciplinarycommunication in an ICU, we have chosen to triangulate threetypes of qualitative data: video-based interaction analysis,observation, and interviews. ... videoed (author AV).Data analysis methodologyOur analysis aims to answer the following question: How doesinteraction during clinical ward rounds vary when an EPR isused in place of a paper record?Given...
- 8
- 503
- 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
... (5¢)3¢)C7 3A AAATGAGCCCAACAAAGCCGAGAAAAACATTI9 7A- R9 8A AATTTGATGCTCGACAGGCTGCCGCGGAGACATGGW10 1A CAATCCGGGAGACAGCTGGTGATGAAAAF11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTTGCAGCCGCGGCCAAAAATGW16 2A TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A ... AGCAACTATCCACCGTTCGCTTCAGGGACTGE26 4A TGCTTCATCTTGCTGACGTGTACGTGGGACTC27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGCC29 5A AAAATGGCCTACAGTTTAGCTCGGTACCW31 5A CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATATC32 6A GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT234 ... TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A AGATGGGTTGGCAACTTTCGCTTCAAAAD17 7A- D17 9A- F18 1A TGAAAACCGCCAGTGCTATTGCTGTGAACAP23 3A- P23 4A CCTGACAGCAACTACGCAGCGTTCTGTTCAGC23 6A AGCAACTATCCACCGTTCGCTTCAGGGACTGE264A...
- 7
- 404
- 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... (Agilent, Santa Clara, CA). Total RNA (5 µg) were used for preparing biotinylated cRNA using GeneChip IVT Labeling Kit (Affymetrix, Santa Clara, CA). After confirmation of the quality of labeled ... forward, 5’-CCTGTACCCGTATTGCGACT-3’; ITGB4 reverse 5’-AGGCCATAGCAGACCTCGTA-3’; COBRA1 for-ward 5’-TGAAGGAGACCCTGACCAAC-3’; COBRA1 reverse 5’-ATCGAATACCGACTGGTGGA-3’; ANK3 forward 5’-GGAGCATCAGTTTGACAGCA-3’; ... 5’-GGAGCATCAGTTTGACAGCA-3’; ANK3 reverse 5’-TTCCACCTTCAGGACCAATC-3’; STAU2 forward 5'-CCGTGAGGGATACAGCAGTT-3'; STAU2 reverse 5’-GCCCATTCAGTTCCACAGTT-3’; HMGN3 forward 5’-TGCCAGATTGTCAGCGAAAC-3;...
- 8
- 702
- 0
Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf
... (M13F-cccagtcacgacgttgtaaaacg- and M13R-agcggataacaatttcacacagg) were fromLife Technologies, Inc. All other chemicals were of analy-tical grade or higher quality.Animals, venoms, and toxinsD. marsupialis ... kDa), carbonic anhydrase (30 kDa), soybean trypsininhibitor (20.1 kDa) and a- lactalbumin (14.4 kDa).Molecular massDM64 molecular mass was determined by MALDI-TOFMS on a Voyager DE-PRO instrument ... (a) highlybasic single-chain polypeptides of 42–45 amino acid residuescross-linked by three disulfide bridges, such as myotoxin a and crotamine, which are not enzymatically active and aretypically...
- 11
- 620
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... franciscanaOligomerization and thermotoleranceJulie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously ... cysts[57], and molecular mass markers o f 29 kDa (carbonicanhydrase), 66 k Da (bovine serum albumin), 150 kDa(alcohol dehydrogenase), 200 kDa (a- amylase), 443 kDa(apoferritin), and 669 kDa ... understanding the functional mechanisms of small h eat s hock /a- crystallin proteins.Keywords: small heat shock /a- crystallin protein; oligomeri-zation; thermotolerance; diapause; Artemia f ranciscana.Cells...
- 10
- 495
- 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
... receptors CCR5 and CD4 in liposomesFranc¸ois Devesa, Vida Chams, Premkumar Dinadayala, Alexandre Stella, Aude Ragas, Henri Auboiroux,Toon Stegmann and Yannick PoquetInstitut de Pharmacologie et ... the protein in mammalian cells. In orderto facilitate the proteins’ purification, a recombinant versionwas made containing a C-terminal myc tag followed by a His6sequence, by cloning the CCR5 ... facilitate infection by primary HIV-1 isolates.Cell 85, 1135–1148.23. Dragic, T., Litwin, V., Allaway, G.P., Martin, S.R., Huang, Y. ,Nagashima, K .A. , Cayanan, C., Maddon, P.J., Koup, R .A. ,Moore,...
- 12
- 541
- 0
Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt
... a- L-arabinopyranoside,b-L-arabinopyranoside, a- L-arabino-furanoside, a- D-man-nopyranoside, a- D-mannopyranoside, a- D-fucopyranoside, a- D-xylopyranoside, a- L-rhamnopyranoside) w as deter-mined u sing the ... ietary xenobiotics than f or other aryl-glycosides. Thesedata indicate that human CBG hydrolyses a broad range of dietary glucosides a nd may play a critical role in xenobioticmetabolism.Keywords: ... methanol, a single majorprotein band of 53 kDa was identi®ed following SDS/PAGE analysis of the culture supernatant, and only traceamounts of other proteins were visible a s faint bands (datanot...
- 10
- 775
- 0
Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt
... interface, but do not play a key role in binding. The loss of binding affinity of the four variantsI10 0A, L10 2A, Y1 0 3A a nd L20 8A i s not likely to be c ausedby extended structural alterations, a ... [6]),indicating that ccbinding contributes only m arginally toIL-4 binding affinity with the whole receptor complex (seealso [21]). Remarkably, only a l owering of t he ccbindingaffinity of ... analyzed. IL-4 Y1 24 probablyinteracts w ith the main functional side chains of the receptorlocated on loop EF1 (I100, L102, Y1 03), the binding of thealanine variants of which was too weak...
- 10
- 447
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... thatadaptation of cyanobacterial phycobilisomes to light bycomplementary chromatic adaptation is a complex processthat changes the ratio of phycocyanin to phycoerythrin in rods of certain ... allophycocyanins and phycocyanins,HPLC separation allowed a quantitative estimation of therelative amount of each protein component from the areaunderlying each peak. This was facilitated by the fact ... phycocyanins are also found, confirming a previous observation by Reuter et al. [25] that somephycocyanins do not participate in sup ramolecular organ-ization. Interestingly ESI-MS analysis of linkers...
- 9
- 477
- 0
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... were admittedto Stavanger University Hospital. We defined severetrauma as a primary diagnosis of traumatic injury and a National Committee on Aeronautics severity of injury orillness index (NACA) ... Another recent study also indicated thatdelaying ALS in critically injured patients until arrival in the trauma centre worsens outcome [21].One remaining question in this study is if any of thesuccessful ... pre-hospital ETI in traumaticbraininjuryinalmosthalfofthestudiedpopulation.Furthermore, the authors found a negative influence onrespiratory and metabolic parameters in patients notintubated. Another...
- 6
- 611
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ