0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

... threshold(Fig. 2) and by assuming that a CaM binding domainhas to have a length of at least around 15 residues.For quantitative estimates of the binding of CaM and CaM mutants to peptides and fusion ... assumed.AbbreviationsapoCaM, Apocalmodulin; BD, binding domain; CaM, calmodulin; EAG, ether a ` go-go; FCS, fluorescence correlation spectroscopy;hCaM, human calmodulin; hEAG, human ether a ` go-go; ... can conclude thatCaM is unable to close the hEAG1 channels in the absence of the N-terminal domain.Mutations in the N- and C-terminal CaM binding sites also affected the gating parameters of...
  • 13
  • 500
  • 0
Báo cáo khoa học: Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen docx

Báo cáo khoa học: Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen docx

... Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogenAntonietta R. Farina1, Antonella Tacconelli1, Lucia Cappabianca1, ... and ex 60%), the Ministry of Health, MURST-CNRÔBiomolecole per la Salute UmanaÕ Program and Associazione Italianaper la Lotta al Neuroblastoma and Progetto Speciale Ministero dellaSanita ` .REFERENCES1. ... a 3-h time course (Fig. 4B). Asstated above, PLB-1 impaired the laminin-degrading capa-city of tcuPA-activated intact plasminogen (Fig. 2C) and impaired the capacity of intact plasminogen to...
  • 8
  • 320
  • 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

... infection, as assessed by the mitochondrial release of cytochrome c, caspase-9 and caspase-3 activa-tion, and DNA fragmentation. In an in vitro assay, intact ETA inducedADP-ribosylation of EF-2 and ... Quantitative analysis of DNA fragmenta-tion after toxin-induced cell death was analyzed by immu-noassay determination of cytoplasmic histone-associatedDNA fragments, according to the manufacturer’s ... loss of intact ETA and ETA -A in the presence of ATP, with concomitant generation of ETA and ETA -A fragments. Incubation in the absence of ATP revealed a small amount of degrada-tion for intact...
  • 15
  • 588
  • 0
Báo cáo khoa học: Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives pdf

Báo cáo khoa học: Inhibition of recombinant human maltase glucoamylase by salacinol and derivatives pdf

... thatacarbose acts mainly by inhibiting human pancreatic a- amylase (HPA) and the breakdown of starch, and possibly other intestinal glucosidases but not MGA. The synthetic analogues of salacinol ... [33].However the method of action of acarbose is quitecomplex and it appears to be acting as a type of sui-cide inhibitor of a- amylase in a mechanism whereby the acarbose is rearranged into an active ... studies of the inhibitory effect of salac-inol and its derivatives against human a- amylase and fungal glucoamylase, rather than MGA, report the effectiveness of salacinol to be in the millimolar range[16,18,20]....
  • 11
  • 526
  • 0
Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx

Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx

... using the Protein Assay kitbased on the method of Bradford [44]. Standards and sam-ples were assayed in triplicate, according to the manufac-turer’s instructions. Sample absorbances were read against a ... occurring at the binding site, and to develop a tool that could assist further optimization of inhibitors, a molecular model of the methyltetra-hydrofolate -binding domain of the rat liver MetS wasconstructed. ... may displace the dimethylbenzimidaz-ole side chain of the cobalamin-cofactor or that it mayact on the binding site of the MetS allosteric cofactor,S-AdoMet, both effects which could explain...
  • 13
  • 424
  • 0
Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

... (C-LytA) of the major autolysin of S. pneumoniae. Two of these compounds (atropine and ipratropium) display a higher binding af n- ity to C-LytA than choline, and also increase the stability of the ... NaCl and the cor-responding amount of ligand. Samples containing ligandswere allowed to equilibrate for at least 10 min prior to application. Chromatography was run with the same bufferat a ... (GrantsBIO2000-0009-P4-C04 and BMC2003-00074), the Escuela Valenciana de Estudios para la Salud(Generalidad Valenciana, Spain, Grant 95 ⁄ 2005) and the Fundacio´n Salvat Inquifarma (Spain).References1 Cartwright...
  • 13
  • 465
  • 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... cells and a primer set of the forward pri-mer DN-5R and the reverse primer DN+854X (sequences5¢-CGGAATTCTCAGGATGAGGGGCATGAAG-3¢ and 5¢-CGCTCGAGGCTGCTCACTTCAGCATCAC-3¢, res-pectively) and directionally ... Kominato Y, Yamamoto F & Takizawa H(2002) Characterization of the human ABO gene pro-moter in erythroid cell lineage. Vox Sang 82, 39–46.34 Yasuda T, Awazu S, Sato W, Iida R, Tanaka Y &Kishi ... (Promega),followed by assay of DNase I and b-galactosidase activities,according to a previously described method [32].Preparation of nuclear extracts and EMSA The nuclear extract and probe were prepared as reportedpreviously...
  • 12
  • 609
  • 0
Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx

Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx

... then analysed by nativePAGE.Isolation and purification of the scrambled disulfideisomers of HPIIn the presence of denaturant and thiol catalyst asindicated above, HPI was converted into the ... discussion. We are grateful to K. Brazine at the Dana-Farber Cancer Institute for critical reading of this manuscript.This work was supported by the grants from the NationalFoundation of Natural Science ... refolding of the G1 isomer occurs by the same process as that of P4. To initiate the refolding of the scrambled G1 disulfide isomer, a low concentration of 2-mercaptoethanol was used as the thiol catalyst....
  • 11
  • 527
  • 0
Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx

Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx

... the matureFd was amplified by PCR u sing as primers the oligonucle-otides Fdup 5 ¢-GCAACACCATGGCTTCTTACAAAGTGAAA-3¢ and Fdlw 5¢-CCACAAGCTTGATATCATATCATAGCATAGCAGT-3¢ and the full length p ea ... 1(TTGGTTCCGCGTGGATCCCGAGCT) and 2 (AGTTCCAGTTCCCAACATGATGATGACAGTAGC) at the SacI s ite of plasmid pGF105 [30]. The insertion generates a fusion protein GST-FNR+ containing the amino acidsequence LVPRGSRA, ... from Anabaena was k indly provided by M. Medina(University of Zaragoza, Zaragoza, Spain). ApoFld fromAnabaena Fld was obtained by treatment with trichloro-acetic acid [33].Spectral analysesAbsorption...
  • 12
  • 585
  • 0
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

... singH2O2. The role of radical vs. nonradical processes has beeninvestigated, as has the prevention of such damage.MATERIALS AND METHODSAmino acids, peptides and antioxidants were commercialsamples ... peroxides a re alsoTable 1. Inhibition of glutathione reductase by H2O2 and N-Ac-Trp-OMe peroxides, and lactate dehydrogenase by H2O2, in the presence and absence of added Fe 2+ –EDTA. Samples ... N-Ac-Trp-OMe) and peroxide levelsassayed at the indicated times using a modified FOX assay. (¤)Catalase added; (h) no catalase added. Initial peroxide concentrationswere in the range of 420–520...
  • 10
  • 462
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP