Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide Daniela L. Catalano Dupuy, Daniela V. Rial and Eduardo A. Ceccarelli Molecular Biology Division, IBR (Instituto de Biologı ´ a Molecular y Celular de Rosario), Consejo Nacional de Investigaciones Cientı ´ ficas y Te ´ cnicas, Facultad de Ciencias Bioquı ´ micas y Farmace ´ uticas, Universidad Nacional de Rosario, Argentina Ferredoxin–NADP(H) reductases (FNRs) represent a pro- totype of enzymes involved in numerous metabolic path- ways. We found that pea FNR ferricyanide d iaphorase activity was inhibited by Zn 2+ (K i 1.57 l M ). Dichloro- phenolindophenol diaphorase activity w as also inhib ited by Zn 2+ (K i 1.80 l M ), but the addition of ferrocyanide was required, indicating that the inhibitor is an arrangement of both ions. Escherichia coli FNR was also inhibited b y Zn-ferrocyanide, suggesting that inhibition is a consequence of common s tructural features o f these fl avoenzymes. The inhibitor behaves in a noncompetitive manner for NADPH and f or artificial electron acceptors. Analysis of the oxida- tion state of the flavin during catalysis in the presence of the inhibitor suggests that the electron-transfer process between NADPH and the flavin is not significantly altered, and that the transfer between the flavin and the second substrate is mainly affected. Zn-ferrocyanide interacts with the reduc- tase, probably i ncreasing the acce ssibility of the prosthetic group to the solvent. Ferredo xin reduction was a lso inhib- ited by Zn-ferrocyanide in a no ncompetitive manner, bu t the observed K i was about nine times h igher t han t hose f or the diaphorase reactions. The electron transfer to Anabaena flavodoxin was not affected b y Zn-ferrocyanide. Binding of the apoflavodoxin to the reductase was sufficient to over- come the inhibition by Zn-ferrocyanide, suggesting that the interaction of FNRs with their proteinaceous electron partners may induce a conformational change in the reductase that alters or completely prevents the inhibitory effect. Keywords: ferredoxin; ferredoxin–NADP(H) reductase; flavodoxin; flavoproteins; zinc. Ferredoxin–NADP(H) reductases (FNRs) constitute a family of hydrophilic and monomeric enzymes that c ontain noncovanlently bound FAD [1,2]. One of the exceptional features of FNR is i ts ability to split electrons between obligatory one-electron a nd two -electron carriers, as a consequence of the biochemical properties of its prosthetic group. Flavoproteins with FNR activity have been found in phototrophic and heterotrophic bacteria, animal and yeast mitochondria, and apicoplasts of obligate intracellular parasites. They oper ate as general electronic switches a t the bifurcation steps of many different electron-transfer pathways (for review see References [ 1–3]). In chloroplasts, they catalyze the final step of photosyn- thetic electron transport, which involves electron transfer from the iron-sulfur protein ferredoxin (Fd), reduced by photosystem I, to NADP + . At the molecular level, the reaction proceeds to the reduction of NADP + via hydride transfer from the N5 atom of the flavin prosthetic group. This reaction provides the NADPH necessary for CO 2 assimilation in plants and cyanobacteria. Some bacteria and algae possess an FMN-containing protein, flavodoxin (Fld), which is able to e fficiently replace Fd as the electron partner of FNR in different metabolic processes, including photosynthesis. Fld expression is induced under conditions of iron deficit, when the [2Fe- 2S] cluster of Fd cannot be assembled [4–6]. FNR displays a strong preference for NADP(H) and is a very poorNAD(H) oxidoreductas e. At variance, the r educed flavin can donate electrons to a r emarkable variety of oxidants of very different structure and properties through a largely irreversible r eaction n amed ÔNADPH diaphoraseÕ [7]. The list of acceptors includes ferricyanide and other transition metal complexes, substituted phenols such as 2,6-dichlorophenolindophenol (DCPIP), nitroderivatives, tetrazolium salts, NAD + (transhydrogenase activity), vio- logens, quinones, and cytochromes (reviewed in [8]). Some of these artificial reactions may have technological relevance for bioremediation and the pharmaceutical industry [9,10]. Plant FNRs (% 35 kDa) comprise two structural domains, each containing % 150 amino acids [11]. The C-terminal region includes most of the residues i nvolved in NADP(H) b inding, and the large cleft between the two domains accommodates the FAD group. A large portion of the isoalloxazine moiety i s shielded from t he bulk s olution, but the edge of the dimethyl benzyl ring that participates in electron transfer remains exposed to solvent in the native holoenzyme. The structural determinants involved in the electron- transfer process, substrate recognition, and the likely Correspondence to E. A. Ceccarelli, IBR, Facultad de Ciencias Bio- quı ´ micas y Farmace ´ uticas, Universidad Nacional de Rosario, Suipa- cha 531 (S2002LRK) Rosario, Argentina. Fax: +54 341 4390465, Tel.: +54 341 4351235, E-mail: cecca@arnet.com.ar Abbreviations: FNR, ferredoxin–NADP(H) reductase; Fd, ferredoxin; Fld, flavodoxin; DCPIP, 2,6-dichlorophenolindophenol; FPR, Escherichia coli FNR; GST, glutathione S-transferase; DNT, 2,4-dinitrotoluene. (Received 1 3 August 2004, revised 6 October 2004, accepted 11 October 2004) Eur. J. Biochem. 271, 4582–4593 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04430.x catalytic mechanism h ave been inte nsely a nalysed a nd debated but aspects of the subject remain to be revealed. Here, we report the use of Zn 2+ , in conjunction with ferrocyanide, as a specific inhibitor to analyze the catalytic process and electron transfer in p ea FNR. Zn 2+ has catalytic, cocatalytic, and/or structural roles in a myriad of metalloenzymes [12]. In addition, it inhibits some enzymes that are not necessarily zinc ones [13–19]. Until now, no metal-binding site of high affinity has been identified in FNRs even thou gh there is some evidence of metal-binding sites in FNR-like enzymes (e.g. NO s ynthase) [13,20], other flavoproteins [14,15,21,22] and a number of different enzymes [18,19,23,24]. Our results may also have some environmental significance in the light of the enormous amount of metal cyanides released as industrial waste and recent evidence of ferrocyanide transport by plants [25]. FNRs can efficiently interact with and accommodate two completely different protein p artners, i.e. Fd a nd Fld. Contacts between Fd and FNR occur through ionic interactions including acidic and basic residues present in each protein, respectively. These interactions determine the initial relative orientation between both proteins, which is finally tuned for electron exchange [3,26,27]. We f ound that pea FNR diaphorase activities were inhibited in a n oncom- petitive manner by Zn 2+ when equimolar concentrations of this metal and ferrocyanide were present. Escherichia coli FNR ( FPR) behaves similarly to the pea enzyme with respect to the inhibitor. In c ontrast, to obtain a compara ble inhibition of the Fd reduction catalyzed by pea FNR, $9 times higher inhibitor concentration is needed. We observed that Fld from Anabaena is able to accept electrons from pea FNR, a nd that this reaction was not affected by Zn-ferrocyanide. Moreover, the addition of apoFld was sufficient to avoid enzyme inhibition by Zn-ferrocyanide, indicating that a conformational c hange is probably produced in the reductase upon binding of Fld. In addition, our data show that electron transfer from the reduced flavin to an oxidant can be inhibited without affecting the electron transfer between the NADPH a nd the prosthetic group. These r esults provide insights into enzyme catalysis and are discussed in the light of current knowledge. Experimental procedures Protein expression and purification Pea FNR, Y308 [28] and C266 FNR mutants were overexpressed in E. coli as reported [28] using vector pGF205+ [29]. Vector pGF205+ [29] was obtained by inserting an adapter formed from oligonucleotides 1 (TTGGTTCCGCGTGGATCCCGAGCT) and 2 (AGTT CCAGTTCCCAACATGATGATGACAGTAGC) at the SacI s ite of plasmid pGF105 [30]. The insertion generates a fusion protein GST-FNR+ containing the amino acid sequence LVPRGSRA, which includes a thrombin recog- nition site between the C-terminus of glutathione S-transferase (GST) and the first amino a cid of the mature FNR. Purification of pea FNR from E. coli JM109 was carried out as described [30], except that the gel-filtration step was replaced by anion-exchange chromatography usin g a DEAE Macroprep column (1.5 · 15 cm; Bio-Rad, Hercules, CA, USA) equilibrated in 50 m M Tris/HCl, pH 8 (buffer A). The resin was e xtensively washed with the same buffer, and FNR eluted using a linear gradient from 0 to 0.3 M NaCl in buffer A. T he fractions containing theenzymeweredialyzedagainst50m M Tris/HCl, pH 8, and concentrated on a D EAE M acroprep column (1 · 3 cm, equilibrated in 50 m M Tris/HCl) e luted with 250 m M NaCl in buffer A. Recombinant pea Fd was obtained by expression in E. coli. B riefly, a pET28-Fd expression vector was con- structed by inserting the cDNA corresponding to the mature pea Fd i nto the pET28a vector (Novagen Inc., Madison, WI, USA). The coding sequence for the mature Fd was amplified by PCR u sing as primers the oligonucle- otides Fdup 5 ¢-GCAACACCATGGCTTCTTACAAAG TGAAA-3¢ and Fdlw 5¢-CCACAAGCTTGATATCATA TCATAGCATAGCAGT-3¢ and the full length p ea Fd precursor cDNA as template. To facilitate the cloning process, NcoIandHindIII restriction sites were introduced in primers Fdup and Fdlw, respectively. After amplification, the product was digested with NcoIandHindIII, and the fragment (%350 bp) was ligated t o the pET28a vector digested with the same enzymes, obtaining the plasmid pET28-Fd. This vector allows the expression of pea Fd i n E. coli as a soluble protein with high yield. Fd purification was performed essentially as described [31]. The E. coli Fd-NADP + reductase was purified according to published procedures [32]. Fld from Anabaena was k indly provided by M. Medina (University of Zaragoza, Zaragoza, Spain). ApoFld from Anabaena Fld was obtained by treatment with trichloro- acetic acid [33]. Spectral analyses Absorption spectra were recorded on a Shimadzu UV-2450 spectrophotometer. To study the inh ibition by Zn-ferro- cyanide of the flavin reduction, the FNR samples were dilutedin50m M HEPES, pH 7.5 (at 25 °C) to a final concentration of % 20 l M . Absorption spectra were recor- ded both before and after the addition o f 2.5 m M NADPH (donor electron substrate), in either the absence or p resence of 20 l M Zn-ferrocyanide. This procedure was also carried out with 1 m M potassium ferricyanide (electron acceptor substrate) in the solution. Protein and flavin fluorescence was monitored using a Kontron SFM 25A spectrofluorimeter (Zu ¨ rich, Switzer- land) interfaced with a personal computer. Solution for fluorescence measurements contained % 1 l M protein in 50 m M HEPES, pH 8. Assays were performed in either the absence or pr esence of 15 l M Zn-ferrocyanide, at 25 °C. Activity measurements FNR-dependent diaphorase activity was determined by a published method [34]. The reaction mixture (1 mL) contained 50 m M HEPES, pH 7.5, 3 m M glucose 6-phos- phate, 0.3 m M NADP + , 1 U glucose-6-phosphate dehy- drogenase, and e ither 1 m M potassium ferricyanide or 0.033 m M DCPIP. After the addition of % 20 n M pea FNR (or 150 n M E. coli FPR), reactions were monitored spec- trophotometrically by following ferricyanide reduction at Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4583 420 nm (e 420 ¼ 1m M )1 Æcm )1 ) or DCPIP reduction at 600 nm (e 600 ¼ 21 m M )1 Æcm )1 ). Ferredoxin reductase activity of FNR was assayed in reaction medium (0.5 mL) containing 50 m M HEPES, pH 7.5, 0.3 m M NADPH and 25 l M Fd. After addition of % 75 n M FNR, the reaction was monitored spectro- photometrically by following the decrease in A 340 (e 340 ¼ 6.22 m M )1 Æcm )1 ). Diff erent FNR and Fd concentrations were tested to ensure linearity of the reaction. Fld-dependent oxidase activity of FNR was determined using Ana baena Fld. The r eaction mixture (0.6 mL) contained 50 m M HEPES, pH 7.5, 0.25 m M NADPH, 12.5 l M Fld and 100 n M FNR. The reaction was monitored by following NADPH oxidation at 340 nm. This activity was also assayed in the presence of 0.25 m M 2,4-dinitro- toluene (DNT). All kinetic experiments were performed at 30 °C. Inhibition assays Inhibition studies were performed by adding equimolar quantities o f ZnSO 4 and pot assium ferrocyanide (0–20 l M ) to the reaction medium, except for the f erricyanide diapho- rase re actions, in w h ich only ZnSO 4 was added. The inhibition reversibility was studied by adding 1 m M EDTA, pH 8.0, to the reaction medium. The inhibition by Zn-ferrocyanide of d ifferent FNR variants was studied by assaying ferricyanide diaphorase activity in the absence and presence of 5 l M ZnSO 4 in the reaction medium after the addition of FNR as follows: wild- type, 0.021 l M ; Y308G, 0.27 l M ; Y308F, 0.026 l M ; Y308S, 0.10 l M ; Y308W, 0.06 l M ; or C266A, 0.12 l M . The data obtained are presented as the percentage of the r emaining activity observed in the presence of Zn-ferrocyanide in each case. Determination of kinetic parameters To determine the kinetic parameters of the diaphorase and Fd reduction reactions, measurements were carried out at different NADPH, potassium ferricyanide, DCPIP or Fd concentrations, at a fixed saturating concentration of the other substrate, in both the absence and presence of inhibitor (0, 1.5, 3 a nd 5 l M Zn-ferrocyanide). Steady-state kinetic data were fitted to the t heoretical curves using SIGMAPLOT software (Jandel Scientific, San Rafael, CA, USA). Inhibition constants ( K i ) for the different substrates were determined by Dixon plots of 1/v plotted against inhibitor concentration (0, 1.5, 3 and 5 l M ), at different concentrations of NADPH (5, 10, 25, 50, 100 and 300 l M ), DCPIP (5, 10, 15, 25, 35 and 50 l M ), ferricyanide (100, 250, 500, 750 and 1000 l M ) and Fd (10, 15, 25, 40 and 50 l M ). Determination of the dissociation constants of the FNRÆNADP + , FNRÆFd and FNRÆFld complexes To determine the K d values of the c omplexes between FNR and NADP + or Fd, 0.6 l M flavoprotein in 50 m M HEPES, pH 8, was titrated at 25 °C with the corresponding substrate. After each addition, the flavin fluorescence (excitation at 456 nm; emission at 526 nm in the case of NADP + ) o r t he flavoprotein fluorescence quen ching (excitation at 270 nm; e mission at 340 nm for the FNRÆFd complex) were monitored using a Kontron SFM 25A spectrofluorimeter. The fluorescence data were fitted to a theoretical e quation as described in [35] for a 1 : 1 complex using t he nonlinear regression program included in the SIGMAPLOT software package (Jandel Scientific) t o optimize the value of K d [36]. The effect of Zn-ferrocyanide on the K d values of these complexes was also determined. The experimental setup was as above, except that 15 l M Zn-ferrocyanide was included in the solution. Difference absorption spectroscopy was used to evaluate the dissociation constant of the FNRÆFld complex [37]. The experiment was performed essentially as described [37] on a solution containing 6.55 l M FNR in 50 m M HEPES, pH 8, at room temperature, to which aliquots of Anabaena Fld were added. The absorbance differences (DA)at465nm were registered and fitted to the theoretical equation [38]: DA ¼ 0:5Defð½P t þ½L t þ K d Þ À ðð½P t þ½L t þ K d Þ 2 À 4½P t ½L t Þ 0:5 g for a 1 : 1 c omplex using a nonlinear regression, where [P] t and [L] t are the total concentration o f FNR and Fld, respectively, and, De the molar abso rtivity of the complex [37]. T his procedure does n ot require the determination of the titration endpoint [38]. Protection against inhibition by Fld The inhibition of DCPIP diaphorase activity was assayed in the presence of Fld, apoFld or Fld p reviously treated with 1 : 100 (w/w) trypsin (15 h, at 24 °C). After the addition of % 20 n M FNR, the reaction was monitored spectrophoto- metrically by following DCPIP reduction at 600 nm. The inhibition protection profile was made in the presence of 20 l M Zn-ferrocyanide and varying either Fld or apoFld concentrations (0–8 l M ). Inactivation of FNR by Zn-ferrocyanide The DCPIP diaphorase activity of FNR was assayed using FNR samples previously treated with 3 l M Zn-ferrocyanide during different periods of time (0–80 min). Results Inhibition of FNR activities by Zn-ferrocyanide TheeffectofthepresenceofZn 2+ during FNR c atalysis is shown in Fig. 1A. Ferricyanide diaphorase activity was inhibited by the addition of increasing concentrations of ZnSO 4 ,withanI 0.5 , the concentration that produces 50% inhibition, of about 1 l M Zn 2+ . In contrast, no e ffect was observed by Zn 2+ addition on the DCPIP diaphorase activity (Fig. 1A). NADPH oxidation catalyzed by FNR in the presence of Fd or F ld was not affected by the presence of up to 1 m M ZnSO 4 . The effect of equimolar concentrations of Zn 2+ and ferrocyanide on diaphorase activities with different sub- strates and Fd reduction were then investigated. In all cases, the addition of metal ion and ferrocyanide to the reaction medium produced strong enzyme inhibition (Fig. 1B). 4584 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Zn-ferrocyanide w as about six times more effective a t inhibiting diaphorase a ctivities t han Fd reduction. However, in all c ases total inhibition was obtained. At pH 7.5, a 50% inhibition was observed for the ferricyanide diaphorase activity with % 1 l M Zn 2+ , meanwhile 6 l M Zn-ferrocyanide was necessary to obtain the same inhibition of the Fd reduction. Likewise, when the FPR from E. coli was investigated, inhibition of diaphorase activity was obtained with Zn-ferrocyanide (Fig. 1C). Neither FNR nor FPR activity was inhibited by sodium sulfate or ferrocyanide alone using D CPIP or ferricyanide as electron acceptors. Similarly, no enzyme inhibition was d etected using ferrous sulfate. Co 2+ , whic h is able to replace Zn 2+ in metaloenz ymes, also inhibited the diaphorase reaction of pea FNR only if ferrocyanide was added with a I 0.5 of 25 l M .Cu 2+ and Ni 2+ were also tested, and no inhibition was observed up to 100 l M for the ferricyanide diaphorase activity using any of the m etals on pea reductase. Higher concentrations h ad some effect on the pea enzyme, but, in all cases, much lower inhibition was observed (not shown). I n all cases, the addition of 1 m M EDTA final concentration after 2 min of r eaction reversed the enzyme inhibitio n instantly and completely (not shown). This observation suggests that the Zn-ferrocyanide is accessible to the solvent. Incubation of the enzyme with Zn-ferrocyanide f or longer periods of time resulted in inactivation of % 57% in 60 min without the release of the prosthetic group (not shown). To evaluate this inhibitor in more detail, the steady-state kinetics of th e F NR for the different s ubstrates were examined at pH 7.5. Plots for the inhibitions of FNR diaphorase a ctivities with i ncreasing concentration o f Zn-ferrocyanide (range 0–5 l M of inhibitor) showed that Fig. 1. In hibition of FNR activities by Zn-fer- rocyanide. Resi dual FNR activity as a func- tion of ZnSO 4 concentration (A) or ZnSO 4 and potassium ferrocyanide equimolar con- centrations (B) using ferricyanide (d), DCPIP (s) and f erredoxin (m) as electron acceptors. (C) Inhibition of ferricyanide (d)and DCPIP (s) diaphorase activities of E. coli FPR as a function of Zn -ferrocyanide con- centration. In all cases, activity measurements were performed at pH 7.5. (D) A typical steady-state kinetics experiment o f the FNR diaphorase activity for different D CPIP con- centrations at a fixed NADPH concentration of 300 l M , performed at increasing concen- trations of inhibitor [0 (s), 1.5 (d), 3 (m)and 5(j) l M ]. Inset: a typical K i determination by Dixonplotof1/v (B) vs. inhibitor concentra- tion(A)atdifferentDCPIPconcentrations. Table 1. Kinetic, inhibition a nd binding parame ters for va ri ous activities of FNR. The k inetics parameters were determined as d escribe in E xperi- mental procedures. Each parameter value represents the average of three independent experiments. K i values were calculated from Dixon plots of Zn-ferrocyanide n oncompetitive inhibition with r espect to the indicated substrate at a fixed saturating concentration of the other substrate. ND, Not determined. Substrate K m (l M ) (no inhibitor) k cat (s )1 ) (no inhibitor) K i (l M ) K d (l M , NADP + ) (no inhibitor) K d (l M , NADP + ) (15 l M Zn-ferrocyanide) Type of inhibition NADPH a 19.7 ± 2.3 302.3 ± 7.8 1.16 ± 0.1 31.6 ± 2.3 33.0 ± 2.3 Noncompetitive Ferricyanide b 106.0 ± 15.9 321.0 ± 11.86 1.57 ± 0.1 ND ND Noncompetitive DCPIP c 43.3 ± 4.9 87.8 ± 4.3 1.8 ± 0.2 ND ND Noncompetitive Ferredoxin d 42.1 ± 12.0 3.3 ± 0.4 13.8 ± 0.9 1.1 ± 0.1 1.4 ± 0.1 Noncompetitive a,b NADPH-ferricyanide diaphorase activity. c NADPH-DCPIP diaphorase activity. d NADPH-Fd reduction. Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4585 the compound was a noncompetitive inhibitor of the enzyme for NADPH and ferricyanide. Similar results were obtained when DCPIP diaphorase activity and Fd reduc- tion were analysed for the substrates DCPIP and Fd, respectively (Table 1). In all cases a linear noncompetitive inhibition was observed, indicating that the inhibitor binding to the enzyme p roduces a nonproductive enzyme– substrate–inhibitor c omplex. D ixon plots were used t o calculate the K i values (Table 1), which were consistent with the I 0,5 values extracted from Fig. 1. Calculation of enzyme activity at infinitive inhibitor concentration showed that total inhibition was obtained in all cases. The dissociation constants of t he FNRÆNADP + and FNRÆFd comp lexes were estimated in the absence or presence of 15 l M inhibitor by m easuring flavin fluores- cence and flavoprotein fluorescence quenching, respectively, after addition of each substrate. As shown in Table 1, the presence of the inhibitor d id not change the enzyme affinity for its substrates. This is in agreement with the inhibition kinetic data presented above. Zn-ferrocyanide inhibition of the reduction and oxidation of the flavin We have analyzed the spectral properties o f FNR, and no differences were observed on addition of Zn-ferrocyanide (Fig. 2A, compare thick and thin solid lines). Then, w e studied the spectral changes of the enzyme by addition of an excess amount of NADPH. The oxidation state o f flavins can be distinguished by spectrophotometric means. They can exist in three different redox states: oxidized, one- electron reduced (semiquinone) radical, and fully reduced hydroquinone. The isolated FNR in solution contains mostly oxidized FAD. The neutral flavin radical absorbs light of long wavelength with a maximum at 570 nm, which is only detectable in FNR when the enzyme is anaerobically reduced. In aerobic conditions, when 2.5 m M NADPH was added to the enzyme solution and the spectral changes were recorded after 5 s, a decrease in absorbance was observed at 459 nm with a concomitant increase with a maximum at % 590 nm. Similar results were obtained when reduction of theenzymebyNADPHwasperformedinthepresenceof Zn-ferrocyanide (Fig. 2A, thick and thin dashed lines). These results indicate that, i n both cases under a erobic conditions and with an excess of NADPH, the neutral semiquinone of FAD appeared, with its typical a bsorption band which usually expands from 520 to 680 nm. The same experiment was then performed in the presence of the e lectron a cceptor potassium ferricyanide in the absence of the inhibitor, recording the spectral changes 5 s after the addition of the substrates. Under these conditions, the enzyme c ontaining a r educed flavin f orm was spectro- photometrically undetectable (Fig. 2B). The addition of 20 l M Zn-ferrocyanide in the reaction medium from the beginning of the measurement leads to the appearance of the reduced form of the enzyme, even in the presence of the electron acceptor (Fig. 2B). These results allow us to conclude that the electron-transfer process between NADPH and the flavin was not sign ificantly altered by the presence of the inhibitor, and disrupting the electron transfer between the flavin and the second substrate mainly causes enzyme inhibition by Zn-ferrocyanide. Effect of Fld on the inhibition of FNR activities by Zn-ferrocyanide In some photosynthetic systems, such as that of certain algae and cyanobacteria, the FMN-co ntaining protein Fld Fig. 2. Reduction and oxidation of the flavin. Optical spectra of FNR FAD reduction, 5 s after mixing, measured as the decrease in absorbance at 459 nm, and the increase at 550 nm to 650 nm range. All r eactions were performed under aerobic conditions an d contain 50 m M HEPES, pH 7 .5, 20 l M FNR and the following additions. (A) In the absence of an electron acceptor: thick solid line, no addition; thick dashed line, 2.5 m M NADPH; thin solid line, 20 l M Zn-ferro- cyanide; thin dashed line, 20 l M Zn-ferrocyanide and 2.5 m M NADPH. (B) In the presence of an electron acceptor: thick solid line, no addition; thick dotted line, 1 m M potassium ferricyanide; thick dashed line, 1 m M potassium ferricyanide and 2.5 m M NADPH; thin solid line, 20 l M Zn-ferrocyanide; th in d otted line, 20 l M Zn-ferro- cyanide and 1 m M potassium ferricyanide; thin dashed line, 20 l M Zn-ferrocyanide, 1 m M potassium ferricyanide and 2.5 m M NADPH. Insets: amplified view of the region between 500 and 700 nm of the corresponding figures. 4586 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004 can efficiently replace Fd in the protein–protein electron- transfer process catalyzed by FNR. Fld and Fd bind to the same FNR site for catalysis, and, despite t he difference in size, they seem to be equally oriented during binding to FNR and electron transfer [27]. A lthough there is no Fld in plants, Fld is able to efficiently accept electrons from plant FNR ([39] and this work). Surprisingly, Zn-ferrocyanide was unable to inhibit the electron transfer from NADPH to Fld catalyzed by pea FNR. We tested concentrations up to 20 l M Zn-ferro- cyanide without any apparent loss of enzyme activity. NADPH oxidation by FNR using Fld as electron acceptor proceeds at a low r ate. This rate can be e nhanced by the addition of the electron acceptor DNT. The interpretation of this observation is that Fld mediates the electron transfer between the reductase and DNT, as FNRs catalyze the reduction of DNT very slowly. This system can be used to better estimate the e lectron-transfer rate between the reductase and the Fld. Flavodoxin oxidase activity both in the absence and presence of DNT as artificial electron acceptor was insensitive to the addition of the metal ferrocyanide (Fig. 3A). Addition of Fld at saturating concentrations produced an increase of about 100% in the NADPH oxidation (Fig. 3A), which was not obtained by the addition of apoFld (not shown). Interestingly, Zn-ferrocyanide did not inhibit the reduction of DNT mediated by Fld, bu t completely prevented th e direct transfer to DNT (Fig. 3A). We also investigated the oxidase activity of FNR in the absence o f add ed electron acceptors and, unexpecte dly we found that it was completely insensitive to Zn-ferrocyanide (v ¼ 0.28 lmolÆmg )1 Æmin )1 in the presence of 15 l M Zn-ferrocyanide vs v ¼ 0.2 9 lmolÆmg )1 Æmin )1 in the absence of the inhibitor) (Fig. 3A). We then decided to investigate if Fld protects FNR against Zn-ferrocyanide inhibition. When the F NR DCPIP diaphorase activity was measured in the presence of 20 l M Zn-ferrocyanide and 12.5 l M Fld, no inhibition was observed (Fig. 3A,B). Under identical conditions, the reduc- tion of DCPIP was inhibited % 98% by Zn-ferrocyanide. Two possible explanations for the unexpected protection displayed can be envisaged. Fld may bypass the pathway that is inhibited by Zn-ferrocyanide, transferring the electron to DCPIP or, the binding of the carrier protein to the FNR directly affects the interaction of the inhibitor with the enzyme. As shown in Fig. 3B the apoprotein protects FNR against Zn-ferrocyanide inhibition. As a control, a sample containing Fld previously treated with trypsin did not display any protection (Fig. 3B), indicating that the effect was a result of the presence of the polypeptide itself. Figure 4 shows a protection assay of the inhibition by Zn- ferrocyanide of the DCPIP diaphorase activity at different Fld concentrations. It can be observed that flavoprotein and its apoform displayed similar abilities to protect the enzyme. Moreover, the protection profile obtain ed can be correlated with the affinity of the FNRÆFld complex (13.4 l M )as obtained from the binding experiment depicted in Fig. 5. Interaction of Zn-ferrocyanide with the FNR reductase To furth er investigate the interaction of Zn-ferrocyanide with FNR, the prosthetic group environment w as analyzed by fluorescence spectroscopy. Figure 6 shows t hat Zn-ferrocyanide interacts with the enzyme in the absence of its substrates. Addition of the metal complex ind uces an increase in FAD fluorescence with a concomitant shift of emission maximum to a lower wavelength resembling the one obtained with FAD in solution. This observation can be considered to indicate that the prosthetic group undergoes a Fig. 3. In hibition by Zn -ferroc yani de in the presence of Fld. (A) The inhibition of fl avodoxin oxidase a ctivity was assayed in a DNT i nde- pendent or dependent manner. The inhibition of DCPIP diaphorase activity was measured in the absence or presence of 12.5 l M Fld. Pure oxidase and DNT oxidase activities of FNR were assayed as controls. Activity was measured i n the ab senc e (hatche d bars) or p resence (so lid bars) of Zn-ferrocyanide. Reactions were monitored by following NADPH oxidation at 340 nm. (B) The inhibition of DCPIP diapho- rase activity was measured in the absence or presence of 12.5 l M Fld, apoFld, or F ld digested with trypsin. DCPIP reduction was followed at 600 nm. Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4587 rearrangement or that its exposure to the environment is increased. A putative Zn 2+ -binding site within the FNR structure The crystal structure of pea FNR (PDB entry 1QG0 [40]), was analyzed searching for structures that could be a ble to bind Zn 2+ . All residues potentially able to co-ordinate Zn 2+ were ide ntified, and distances and geometries within the surrounding residues were determined using the SWISS- PDBVIEWER 3.7. The FAD was also took into account in the analysis because it has long been known that flavins interact specifically with metals [41,42]. We found a serine, a glutamic acid, a cysteine and a tyrosine residue near the isoalloxazine in a spatial orientation suitable for the interaction with metals (Fig. 7A). We also observed that the space available to accommodate Zn 2+ is enough for appropriate binding of the metal ion, which remains accessible from the exterior (Fig. 7B). Distances between the N5 and O4 of the flavin, O of Ser90, S of Cys266, O of Glu306 and O of Tyr308 indicate that almost all of them are at bond distances between each other and nearly o riented correctly to participate in Z n 2+ co-ordination (Fig. 7C). This amino acid a rrangement around FAD is conserved in FPR and in the neuronal NO synthase (Fig. 7D,E). To obtain supporting evidence for the proposed b inding site and to investigate the participation of the a bove amino acids, several FNR mutants were a nalyzed. Table 2 shows the FNR inhibition by Zn-ferrocyanide obtained under identical experimental conditions with FNR mutants of Cys266 or Tyr308. Cysteine i s one of the amino acids most commonly observed after histidine as a Zn 2+ ligand in metalloproteins [12]. However, Cys266 does not appear to have a central role in the interaction with Zn-ferrocyanid e as its replacement by alanine generates an enzyme t hat is still affected by the inhibitor (Table 2). Similarly, replacing Tyr308 with other aromatic amino acids only slightly affects the inhibition by Zn-ferrocyanide on the enzyme. In contrast, replacing Tyr308 with glycine or serine consider- ably reduced the inhibition. Table 2 also shows the degree of nicotinamide ring occupancy of the binding site of Tyr mutants, as calculated by Piubelli et al. [ 43]. We found an inverse correlation between the extent of Zn 2+ inhibition and nicotinamide ring o ccupancy in the FNR v ariants. These observations indicate that the binding of NADP + to the enzyme either reduces the accessibility of the isoallox- azine itself to Zn 2+ and/or ferrocyanide or partially impairs the entry of the inhibitor to the proposed b inding site. Although a binding site for ferrocyanide, an octahedral Fig. 4. Protection of DCPIP diaphorase activity by Fld. DCPIP diaphorase a ctivity was assayed in the presence of 20 l M Zn-ferrocy- anide and different concentrations of either Anabaena Fld (solid bars) or apoFld (hatched bars). Fig. 5. Determination of the dissociation constant of FNRÆFld complex. (A) Difference absorption spectra obtained during the titration of pea FNR (6.55 l M )withAnabaena Fld. (B) Absorbance difference data at 465 n m fitted to the theoretical equation for a 1 : 1 stoichiometric complex by means of nonlinear regression. The K d value obtained was 13.4 l M . 4588 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004 complex anion with a diameter of about 6 A ˚ , has never been mapped within the structure of FNR, it could b e possible that this anion collides with the Zn 2+ -containing protein structure, interacting strongly and filling the open space near the isoalloxazine. Discussion The data presented in this work clearly show that the pea Fd-NADP(H) reductase is inhibited by Zn-ferrocyanide as a result of a specific combined interaction of both i ons with the enzyme. The inhibition was also observed on t he E. coli enzyme, a member of the same protein family, e ven though FPR is structurally distanced from the plant flavoprotein [44]. I nhibition by Zn 2+ has b een r eported for other flavin- containing en zymes. Cu 2+ and Z n 2+ inhibit all NADPH- dependent reactions catalyzed by the neuronal NO synthase [13]. The authors of this work have concluded that inhibition is produced by th e interaction of the metal with a unique site present in t he reductase domain of the enzyme [13]. This domain binds one equivalent of FMN and one of FAD and, members of t he Fd–NADP(H) reductase family share its structural features [45]. Similarly, it has been observed that Zn 2+ inhibits the isolated a-oxoglutarate dehydrogenase mitochondrial complex [14]. A more de- tailed study has shown that the dihydrolipoyl dehydro- genase component of the complex is responsible for the observed Zn 2+ inhibition [15]. T his enzyme is a homo- dimeric molecule which contains FAD and belongs to the NAD-disulphide oxidoreductases class I group, which is led by the glutathione reductase as the model protein [46]. The latter group does not contain either the well-defined conserved sequences or displayed sequence similarity with the chloroplast-type FNRs. Taken together, these results may support the idea that the flavin itself may be involved in the interaction of the flavoproteins with the metal. The kinetic analysis of all FNR activities inhibited by Zn-ferrocyanide r evealed noncompetitive behavior for NADPH, for a rtificial electron acceptors and, for Fd. The FAD fluorescence of FNR showed a slight increase due to the addition of the inhibitor ( 10–15%), together with a shift of the maximum emission wavelength to 526 nm, closer to that of the free flavin. These rather small perturbations could be caused by changes in the microenvironment of the isoalloxazine ring, which is probably more exposed to the solvent after binding of the metal ferrocyanide. Changes may also be produced by the interaction of the m etal itself with the isoalloxazine. However, the effect was only observed when Zn 2+ and ferrocyanide were added, indica- ting that the combination of the two ions, a nd not each one separately, was responsible for the observed change. Another hypothesis to explain the observed inhibition proposes that Zn 2+ and ferrocyanide interact directly with the prosthetic group and/or with amino acid residues involved in the electron-transfer process. S earching for structures that may be able to bind Zn 2+ on the crystal structure of FNR, we found a serine, a glutamic acid, a cysteine, and a tyrosine residue near the isoalloxazine in a spatial orientation suitable for the interaction with metals (Fig. 7 A), although n o definite sites were identified. It was also observed that t he space available to a ccommodate Zn 2+ is enough for appropriate binding of the metal ion. Interestingly, these amino acids are conserved in FPR and in the neuronal NO synthase ( Fig. 7D,E). The residue homo- logous to FNR Tyr308 is a Phe in the NO synthase. Consequently, it may be suggested that Tyr308 may not be directly involved in the Zn-ferrocyanide inhibition of the reductase. Cysteine, histidine and glutamic acid are com- mon Zn 2+ ligands in metalloproteins [12]. Although serine and tyrosine are less common Zn 2+ ligands, they can interact with ions such as Zn 2+ especially in proteins with more than one metal center such as alkaline phosphatase from E. coli [47]. We suggest that a p artially or totally co-o rdinated Zn 2+ interacting with the bulky ferrocyanide, which can also interact with other amino acids, represents the true inhib- itor. T he binding of ferricyanide and ferrocyanide has been detected in some enzymes [48,49]. Moreover, this interaction was proposed to occur v ia positively charged amino acids [49]. Indeed, the solubility of salts is a consequence of a large energy gain during hydration of ions that is surplus to the lattice energy. At the concentration of Zn-ferrocyanide used (0–30 l M ), the salt is soluble but near its solubility product. Thus, a small change in the availability of water, as would occur with the inclusion of both ions in a protein hydrophobic pocket, may i nduce a stable ionic interaction between Zn 2+ and ferrocyanide. We are not able to give an explanation for the participation of ferrocyanide as an obligate partner in the interaction of Zn 2+ with the enzyme. However, it may be suggested that binding of ferrocyanide, an octahedral complex a nion with a diameter of about 6 A ˚ , throughout the interaction with the bound Zn 2+ near the isoalloxazine could produce the observed inhibitory effect on FNR activity. This hypothesis i s also s upported by the finding that mutants with a catalytic site greatly occupied by the NADP + nicotinamide displayed a reduced susceptibility to Zn-ferrocyanide inhibition (Table 2). It is worth men- tioning that the c rystal structures of these m utants have Fig. 6. Interaction o f Zn-ferrocyanide with FNR. Fluorescence emis- sion spectra of FNR (k exc. ¼ 459 nm) in the absence (thick solid line) or presence of 15 l M Zn-ferrocyanide (thin solid line). Fluorescence emission of free FAD (th in dashed line). Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4589 been obtained and that the overall conformations are equivalent to those of wild-type spinach and pea leaf FNRs, with no significant changes in the relative orientation of amino acids, t he FAD o r the conformation and binding of the 2¢-P-AMP portion of NADP + [40]. It has been observed that A -type monoamine oxidase is inhibited by the zinc benzoate salt [16]. Similarly, a-chymotryp sin may be inhibited by a substrate analog that interacts w ith a Zn 2+ ion t hat is partially co-ordinated at the active site [17]. The K i for the inhibition of Fd reduction is 8.8 times higher than those f or diaphorase activity inhibition (Table 1). T hese results may be explained by the observa- tion that binding of Fd to FNR leads to structural changes in the reductase. After complex formation, the entire NADP(H) domain is displaced sligh tly as a single unit, and Glu306, which is located n ear the isoalloxazine, moves to within hydrogen-bonding distance of the hydroxy group of Ser90, as observed by Kurisu et al. [ 50] i n c rystals o f the Table 2. Inhibition of wild-type and mutant FNR diaphorase activity by Zn-ferrocyanide. ND, N ot determined. FNR variant Remaining activity (% of control) a Nicotinamide ring occupancy of the binding site (%) b WT 1.8 14 C266A 15.0 ND Y308S 79.5 100 Y308G 41.0 84 Y308F 23.2 85 Y308W 5.9 40 a Remaining ferricyanide diaphorase activity in the presence of 5 l M Zn-ferrocyanide with respect to the control. b Taken from Ref [43], calculated from the absorption coefficients at the peak near 510 nm of the difference spectra elicited by nicotinamide nucleotide binding to the various pea FNR forms; 100% refers to NADP + occupancy of FNR-Y308S. Fig. 7. Puta tive Zn 2+ -binding site in FNR-like enzymes. Detail view of the spatial distribution o f residues putatively involved in the interaction with Zn 2+ in (A) pea FNR, (D) E. c oli FPR and (E) rat neuronal NO synthase. Nitrogen 5 (N5) and oxygen 4 (O4) from FAD isoalloxazine are indicated. (B) Ribbon diagram of the putative Zn 2+ -binding site in pea FNR. (C) Distances between the atoms of pea FNR probably involved in the interaction with Zn 2+ were measured in A ˚ . The schemes were drawn using SWISS - PDBVIEWER 3.7 and rendered with POV - RAY from the tridimensional structures as determined by X-ray diffraction (Protein Data Bank entries 1QG0, 1FDR, 1TLL) [40]. 4590 D. L. Catalano Dupuy et al.(Eur. J. Biochem. 271) Ó FEBS 2004 FNRÆFd complex from maize. This glutamic acid is sufficiently exposed and r eadily available for the i nteraction with Zn 2+ (Fig. 7A,B). In the Anabaena FdÆFNR crystal- lographic association resolved by Morales et al.[26]the carboxy group of the homologous Glu301 is no more exposed to solvent but is hydrogen-bonded to the hydroxy group of Fd Ser64. The role o f these re sidues has b een thoroughly i nves- tigated by site-directed mutagenesis. When the homo log Glu301 from Anabaena FNR was mutated to Ala, the altered enzyme obtained was only 1% as active as the wild-typeenzymeinelectrontransfertoFd[51].As the photoreduction of NADP + was not affected to the same degree as the Fd reduction, the authors suggested that the r ate-determining step during c atalysis involves other p rocesses in addition to the electron-transfer process between the two prosthetic groups [51]. The semiquinone state o f FAD was significantly destabilized in the FNR mutant in which G lu301 was changed to Ala, and this was probably the main reason for the electron-transfer alter- ation observed in this mutant. Similarly, four different spinach FNR m utants of the equivalent Glu312 were obtained and analyzed [52]. The authors concluded that this residue is directly involved in the electron transfer between FNR and Fd. T hey also hypoth esized that the residue may c ontribute to the tuning of the redox potential of the flavin semiquinone to enhance efficient electron transfer and/or may be acting as a proto n donor/acceptor to FAD [51,52]. The O of Ser90 and the S of Cys266 of pea FNR are close to N5 and O4 of the isoalloxazine, which are involved in hydride transfer. The hydroxy group of Ser90 could accept a hydrogen bond and thus help to stabilize the reduced flavin. Meanwhile its interaction probably affects the transition state of hydride transfer. The Ser96Val mutant of FNR displayed a k cat nearly 2000 times lower than that of the wild-type enzyme [53]. Analysis of the crystal structure of wild-type pea FNR shows that the Zn 2+ ion can easily access Ser90. Moreover, serine is among the amino acids that could, although infrequently, co-ordinate Zn 2+ [12]. Thus, it may be one of the amino acid residues involved i n the inhibition of FNR by Zn-ferrocyanide. Our results (Fig. 2) allow us to suggest that Zn-ferro- cyanide mainly causes an i nterruption of the oxid ative half reaction in the diaphorase activity and the electron transfer between FNR red and Fd. It has been observed that electrophilic metal ions such as Zn 2+ prefer co-ordination with the one-electron reduced semiquinone state of flavin [42]. Thus, Zn-ferrocyanide may interact after reduction of the enzyme by NADPH with the semiquinone state of the flavoprotein, producing the observed inactive form or altering the proton e xchange between the flavin a nd the surrounding amino acid residues, in particular Glu306 and Ser90. Both residues have been proposed to participate in the proton-transfer pathway between the exterior and isoalloxazine [26,45,51–55]. It is interesting that Zn-ferrocyanide was unable to inhibit the electron t ransfer from NADPH to Fld catalyzed by pea FNR. At present, no crystal structures of the complex between FNR and Fld have been obtained. Using several charge-reversal mutants, it has been possible to infer that FNR uses the same site for the interaction with both electron partners, Fd and Fld [27]. Moreover, it has been shown that Fd and Fld could be completely overlapped on the basis of their surface electrostatic potentials [56], but the interaction with Fld has been proposed to involve a larger FNR surface [57]. Although the interaction of FNR with its substrates exhibits co-operativity [58,59], modifications of the structure that should lead to the observed effects have remained elusive or hard to detect [11,40,60]. Changes i n hydrophobic p atches of Anabaena FNR influenced the rates of electron transfer to and from Fld and Fd. However, the observed effects were more dramatic in the processes involving Fld than those involving Fd, suggesting that these Anabaena FNR residues do not participate to the same extent in the processes for the two proteins [61]. Recently, electron transfer was obtained with the hybrid system bovine adrenodoxin reductase/Anabaena Fld, indicating that a highly specific interaction is not essential and that the process may proceed through multiple weak interactions. So f ar no residue on the Fld surface has been identified to b e c ritical for the interaction and the electron-transfer processes between Fld and FNR [62]. It has t herefore been suggested that there is a lower specificity for the FNR–Fld interaction than for the FNR–Fd one [62]. Therefore a dynamic assembly of the former complex in which multiple orientations may exist can be proposed. The fact that Zn-ferrocyanide was unable to inhibit the pea FNR electron transfer to Fld may not only be related to the protein size o r a specific residue but also to the m echanisms of interaction between the reductase and Fld. The very short distance predicted b etween the two redox centers [62] may also account for our observations. On the other hand, interaction of FNR with Fd does lead to structural changes in both electron carriers relative to the free protein c onformations [26,50]. The protein–protein interaction also affects the microenvironments of the two prosthetic groups. In the case of the Fd and FNR, their redox poten tials (E m ) w ere shifted by )25 mV and +20 m V, respectively, reflecting theses changes [63]. We have observed that both F ld and its apoprotein are able to impede the inhibition of FNR by Zn-ferrocyanide. More remark able, the solely polypeptide interaction between FNR a nd apoFld is su fficient to p revent the inhibition, indicating that no participation of the Fld electronic transfer is involved in the observed protection. In addition, we observed that t he Fld c oncentration needed to protect FNR from Zn-ferrocyanide inhibition is similar to the K d for the pea FNRÆFld complex (13.4 l M ). It is worth mentioning that it ha s been determined that the structure of apoFld is virtually equivalent to that of the holoprotein, the only exception being that the isoalloxazine- binding site closed [64]. In summary, our results indicate that determinants on the FNR polypeptide are essential for electron transfer between the reduced flavin and the substrate and, that this process can be c ompletely inhibited by Zn 2+ in the p resence of ferrocyanide. We have ob tained evidence that isoalloxazine and t he surrounding amino acids are the binding site of the inhibitor. Clearly, the observation that binding of Fld or apoFld to the reductase was sufficient to overcome the inhibition may be taken as evidence for a conformational change produced in the reductase on interaction with this electron partner, modifying either the FAD environment or Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur. J. Biochem. 271) 4591 [...]... L.M & Trippi, V.S (2000) Inhibition of wheat nitrate reductase activity by zinc Biol Plant 43, 257–262 21 Egashira, T., Takayama, F & Sakai, K (2003) Inhibition by Zn (2+) of A-form monoamine oxidase in monkey brain mitochondria J Pharmacol Sci 91, 239–245 22 Brohawn, S.G., Miksa, I.R & Thorpe, C (2003) Avian sulfhydryl oxidase is not a metalloenzyme: adventitious binding of divalent metal ions to... Herrmann, R.G & Curti, B (1993) The role of cysteine residues of spinach ferredoxin-NADP+ reductase as assessed by site-directed mutagenesis Biochemistry 32, 6374–6380 55 Mayoral, T., Medina, M., Sanz-Aparicio, J., Gomez-Moreno, C & Hermoso, J.A (2000) Structural basis of the catalytic role of Glu301 in Anabaena PCC 7119 ferredoxin-NADP+ reductase revealed by x-ray crystallography Proteins 38, 60–69... 9354 Ó FEBS 2004 Inhibition of FNR by Zn-ferrocyanide (Eur J Biochem 271) 4593 32 Jenkins, C.M & Waterman, M.R (1998) NADPH–flavodoxin reductase and flavodoxin from Escherichia coli: characteristics as a soluble microsomal P450 reductase Biochemistry 37, 6106– 6113 33 Genzor, C.G., Beldarrain, A., Gomez-Moreno, C., LopezLacomba, J.L., Cortijo, M & Sancho, J (1996) Conformational stability of apoflavodoxin... understanding the changes in the reductase on binding of Fd and Fld that were not detected by other approaches and should help in further studies of the enzyme Acknowledgements E.A.C is a staff member of the Consejo Nacional de Investigaciones ´ Cientı´ ficas y Tecnicas (CONICET, Argentina) D.L.C.D and D.V.R are fellows of the same institution This study was supported by grants from CONICET and Agencia... D.H (2004) Inhibition of alphachymotrypsin with thiol-bearing substrate analogues in the presence of zinc ion Bioorg Med Chem Lett 14, 701–705 18 Maret, W., Jacob, C., Vallee, B.L & Fischer, E.H (1999) Inhibitory sites in enzymes: zinc removal and reactivation by thionein Proc Natl Acad Sci USA 96, 1936–1940 19 Maret, W., Yetman, C.A & Jiang, L (2001) Enzyme regulation by reversible zinc inhibition: ... binding site of ferredoxin-NADP reductase Biochim Biophys Acta 445, 14–24 35 Geren, L.M & Millett, F (1981) Fluorescence energy transfer studies of the interaction between adrenodoxin and cytochrome c J Biol Chem 256, 10485–10489 36 Aliverti, A., Lubberstedt, T., Zanetti, G., Herrmann, R.G & Curti, B (1991) Probing the role of lysine 116 and lysine 244 in the spinach ferredoxin–NADP+ reductase by site-directed... Zanetti, G (1998) Probing the function of the invariant glutamyl residue 312 in spinach ferredoxin-NADP+ reductase J Biol Chem 273, 34008–34015 53 Aliverti, A., Bruns, C.M., Pandini, V.E., Karplus, P.A., Vanoni, M.A., Curti, B & Zanetti, G (1995) Involvement of serine 96 in the catalytic mechanism of ferredoxin-NADP+ reductase: structure–function relationship as studied by site-directed mutagenesis and X-ray... Orellano, E.G., Calcaterra, N.B., Carrillo, N & Ceccarelli, E.A (1993) Probing the role of the carboxyl-terminal region of ferredoxin-NADP+ reductase by site-directed mutagenesis and deletion analysis J Biol Chem 268, 19267–19273 29 Rial, D.V., Arakaki, A.K & Ceccarelli, E.A (2000) Interaction of the targeting sequence of chloroplast precursors with Hsp70 molecular chaperones Eur J Biochem 267, 6239–6248... ferredoxin-NADP+ reductase Arch Biochem Biophys 311, 480–486 40 Deng, Z., Aliverti, A., Zanetti, G., Arakaki, A.K., Ottado, J., Orellano, E.G., Calcaterra, N.B., Ceccarelli, E.A., Carrillo, N & Karplus, P.A (1999) A productive NADP+ binding mode of ferredoxin-NADP+ reductase revealed by protein engineering and crystallographic studies Nat Struct Biol 6, 847–853 41 Yu, M.W & Fritchie, C.J Jr (1975) Interaction of. .. Teshima, K., Onda, Y., Kimata-Ariga, Y & Hase, T (2001) Structure of the electron transfer complex between ferredoxin and ferredoxinNADP (+) reductase Nat Struct Biol 8, 117–121 51 Medina, M., Martinez-Julvez, M., Hurley, J.K., Tollin, G & Gomez-Moreno, C (1998) Involvement of glutamic acid 301 in the catalytic mechanism of ferredoxin-NADP+ reductase from Anabaena PCC 7119 Biochemistry 37, 2715–2728 52 . from pea FNR, a nd that this reaction was not affected by Zn-ferrocyanide. Moreover, the addition of apoFld was sufficient to avoid enzyme inhibition by Zn-ferrocyanide, indicating. Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide Daniela L. Catalano Dupuy, Daniela