0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions Ronald ... consists of 99%D-galactose and 0.3%L -arabinose and is predominantly linear. Potatoarabinogalactan consists of 86%D-galactose and 6.6%L -arabinose, while soy arabinogalactan consists of ... listed in Materials and methods.Hydrolysis of arabinogalactans The sugar composition of the arabinogalactans from potato, onion and soy was determined as described [21].Onion arabinogalactan...
  • 9
  • 669
  • 0
Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

... by centrifugation, and the supernatant was analyzed to determine its alanine contentby performing an alanine dehydrogenase assay [50]. The alanine content of assay mixtures was determined based ... that is highly similar to that of IscS(Fig. 1A) , with a two-domain organization and the presence of both a- helices and b-strands. On the basis of these data and the fact that alr2505-expression ... Latifi A, Ruiz M, Jeanjean R & Zhang CC (2007)PrxQ -A, a member of the peroxiredoxin Q family, plays a major role in defense against oxidative stress in the cyanobacterium Anabaena sp. strain...
  • 11
  • 728
  • 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

... thatdephosphorylation and/ or catalytic turnover of EIIGlc,rather than binding of Glc, enhanced the reactivity of Cys421. As Cys421 is the only invariant cysteine in homologous transporters and also the only ... binding and/ or translocation of substrates via the periplasmic site.EIIGlc is rapidly inactivated by the 6-O-bromoacetyl esters of methyl a- D-glucopyranoside ( 1a) andmethyla-D-manno-pyranoside ... methyl 6-deoxy-6-isothiocyanato -a- D-glucopyranoside (1e), b-D-glucopyranosyl isothiocyanate(3c)andb-D-glucopyranosyl phenyl isothiocyanate (3d).Phosphorylation of EIIGlcprotects, indicating...
  • 12
  • 720
  • 0
Tài liệu Báo cáo Y học: The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacter jejuni genome sequenced strain NCTC 11168 pdf

Tài liệu Báo cáo Y học: The structures of the lipooligosaccharide and capsule polysaccharide of Campylobacter jejuni genome sequenced strain NCTC 11168 pdf

... Council of Canada, Ottawa, CanadaCampylobacter jejuni infections are one of the leading causes of human gastroenteritis and are suspected of being a pre-cursor to Guillain–Barre´ and Miller–Fisher ... missing in the latter [6].As already mentioned, the missing galactose can beattributed to the phase variability of wlaN. The lack of terminal GalNAc in this strain has recently been shown byGilbert ... As the absolute configuration of the sugars was known from the chemical analysis, from a comparison of chemical shifts and coupling constants with those of monosaccharides,residue A was assigned...
  • 18
  • 718
  • 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... the concentration of analyte, Rmax is the maximum analyte binding capacity in RU and R is the SPRsignal in RU at time t, k a the association rate constant and kd the dissociation rate constant.Using ... constant.Nonlinear regression analysis was used to determine the equilibrium dissociation constant from the sensorgrams and allows the calculation of both association and dissociationrate constants ... GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGCHJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCCHJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGAHJ1 AGAAGCTCCATGTAGCAAGGCTAGHJ2...
  • 10
  • 672
  • 0
Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx

Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx

... histonedeacetylase activity and to perhaps function through a mechanism that depends on interactions with components of the basal transcriptional machinery such as TATAbinding protein and transcription ... shows that yeast har-bouring an expression vector encoding a Gal4 activationdomain–Eos-mut fusion and a Gal4 DNA-bindingdomain–CtBP fusion grow in the absence of histidine, and Fig. 2F indicates ... secondary antibody solution was added and incubation was continued for 1 h. The membrane waswashed for 1 h in several changes of Tris/NaCl/Tween.Detection was carried out using the RenaissanceÒ...
  • 8
  • 334
  • 0
Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt

Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt

... membranes, and of causing the lysis of A. laidlawii B and human erythrocytes, are at least qualitatively correlated.As discussed earlier, GS10 and GS14 both exist in aqueous solution as antiparallel ... Dataacquisition and analysis was carried out usingMICROCALDA-2 (MicroCal LLC, Northampton, MA, USA) and ORIGIN software (OriginLab Corporation, Northampton,MA, USA). Samples containing the GS ring-size ... compare the relative antimicrobialpotencies of these three GS ring-size analogs against variousGram-positive and Gram-negative bacteria and against A. laidlawii, as the former types of bacteria...
  • 10
  • 683
  • 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

... methods. Enzyme activity was a nalysed by the standardassay and the i mmunoreactivity was detected by Western blot analysis and quantitated as described i n Materials and methods. Open and filled ... subtilases h ave about 20 aminoacids in this region and the large in sertion is a specialfeature of TPP II and pyrolysin [9,21]. There are, in total,12 amino -acid differences between the human and ... variants of TPP II ( i.e. rat,mouse, fruit y, Arabidopsis thaliana, Caenorhabdit is elegans and Schizosaccharo myces pombe), and at least three humanEST-clones covering this area (GenBank a...
  • 6
  • 520
  • 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

... resultsindicate that the increase in the affinity of NK to chromatin is an ATP-dependent reaction, and is caused by a kinase(s) in the c ytosol. Then, authentic p rotein kinase A (PKA) and calmodulin-dependent ... N-terminal and arginine-serinerepeat-containing regions to chromatin was suppressed bymild trypsinization of the chromatin and by pretreatmentwith a DNA solution. A new cell-free system for analyzing the ... treated proteins w ere extracted with SDS and then analyzed bySDS/PAGE, followed by CBB staining and autoradiography. Lanes 1 and 4 , GST; lanes 2 and 5, GST–NK; l anes 3 and 6, GST– RS. The arrowhead...
  • 11
  • 563
  • 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... electrophoretically to a poly(vinylidenedifluoride) membrane. The membrane was treated with a rabbit anti-iNOS polyclonal antibody or rabbit anti-PKCpolyclonal antibody at 1 : 1000 dilution and anti-(rabbitIgG) ... 378S–381S.7. Badamchian, M., Spangelo, B.L., Bao, Y. , Hagiwara, Y. ,Hagiwara, H., Ueyama, H. & Goldstein, A. L. (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulatesrelease ... horseradish peroxidase conjugated antibody at1 : 5000 dilution as a primary antibody and a secondaryantibody, respectively. The blots were detected with an enhanced chemiluminescence kit (Amersham...
  • 6
  • 494
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa họctài liệu báo cáo nghiên cứu khoa họctai lieu bao cao thuc tap y si da khoatai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhtai lieu bao cao thuc tap nganh the ducnghiên cứu các tài liệu báo cáo của các nhà nghiên cứu đi trước về các lập luận khoa học về trồng và phòng bệnh dịch cho hoa hồng cách quản lý sử dụng phân bón đúng cách vvbáo cáo y họctài liệu báo cáotài liệu báo cáo môn triếttài liệu báo cáo tài chínhtài liệu di truyền y họctài liệu báo cáo mônbáo cáo y họctài liệu báo cáo tài chính vốn bằng tiền tai doanh nghiệptài liệu vi sinh y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ