The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA Mark J. Dickman 1 , Stuart M. Ingleston 2 , Svetlana E. Sedelnikova 3 , John B. Rafferty 3 , Robert G. Lloyd 2 , Jane A. Grasby 4 and David P. Hornby 1 1 Transgenomic Research Laboratory, Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, UK; 2 Institute of Genetics, University of Nottingham, Queens Medical Centre, UK; 3 Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, UK; 4 Krebs Institute, Centre for Chemical Biology, University of Sheffield, UK The RuvABC resolvasome of Escherichia coli catalyses the resolution of Holliday junctions that arise during genetic recombination and DNA repair. This process involves two key steps: branch migration, catalysed by the RuvB protein that is targeted to the Holliday junction by the structure specific RuvA protein, and resolution, which is catalysed by the RuvC endonuclease. We have quantified the interaction of the RuvA protein with synthetic Holliday junctions and have shown that the binding of the protein is highly struc- ture-specific, and leads to the formation of a complex con- taining two tetramers of RuvA per Holliday junction. Our data are consistent with two tetramers of RuvA binding to the DNA recombination intermediate in a co-operative manner. Once formed this complex prevents the binding of RuvC to the Holliday junction. However, the formation of a RuvAC complex can be observed following sequential addition of the RuvC and RuvA proteins. Moreover, by examining the DNA recognition properties of a mutant RuvA protein (E55R, D56K) we show that the charge on the central pin is critical for directing the structure-specific binding by RuvA. Keywords: RuvABC resolvasome; Holliday junction; surface plasmon resonance. Genetic recombination is a fundamental cellular process that serves both to protect and expand the coding potential of all organisms. Through recombination events the genes within and between chromosomes may be rearranged, segregation at cell division may be modulated and DNA repair facilitated. All organisms have evolved many different ways to repair the damage to DNA and failure of these mechanisms leads to chromosomal disorders that can result in mutation, malignant transformation or death. Studies in Escherichia coli and other bacteria have provided consider- able insights into the molecular pathways of DNA repair. Prominent amongst these pathways is recombination. Genetic recombination occurs via breakage and reunion of DNA chains and generally conserves sequence [1]. DNA recombination has also been shown to play a role in re-establishing stalled replication forks [2]. During the late stages of recombination in E. coli, Holliday junction intermediates made by RecA-mediated homologous pairing and strand exchange are processed into mature recombinants by the RuvA, RuvB and RuvC proteins [3,4]. RuvA has been shown to be a highly structure specific DNA binding protein whose function is to target RuvB to the Holliday junction [5,6]. RuvB assembles around the DNA as hexameric rings, which are thought to move along the DNA using energy derived from the hydrolysis of ATP. RuvC is an endonuclease that cleaves the junction via a process involving a dual incision mechanism at base specific contacts in which nicks are introduced into two strands having the same polarity, around a defined target sequence with the consensus 5¢ (A/T)TT(G/C) [7,8]. Genetic studies have indicated that RuvAB mediated branch migration is intrinsically linked to RuvC mediated Holliday junction resolution [9–11]. Taking into account the sequence specificity of RuvC, different models have been proposed to reconcile the genetic and biochemical data on the resolution of Holliday junctions. In one scenario RuvAB promotes branch migration until suitable sequences are encountered, at which point the complex dissociates to allow RuvC binding. Alternatively RuvC may act as part of a RuvABC complex in which migration and resolution are coupled. RuvA is a 22-kDa protein which exists as a tetramer in solution [12] and binds to both ssDNA and dsDNA [13], but binds with the greatest affinity to Holliday junctions. Binding is structure specific and completely independent of DNA sequence. When the RuvA protein is bound to the Holliday junction in solution and is subjected to nondenaturing gel electrophoresis, two different complexes are observed. Their electrophoretic mobilities are consis- tent with the formation of protein–DNA complexes containing one and two tetramers of RuvA [14,15]. Under conditions in which RuvB exhibits a low affinity for DNA, the presence of RuvA results in the formation of a RuvAB–Holliday junction complex, indicating that RuvA targets RuvB to the junction [16]. The determination of the molecular structure of RuvA [17] has shown that the four monomers of RuvA are related by fourfold sym- metry (see Fig. 1), similar to a four petal flower with concave and convex surfaces normal to the fourfold axis. Correspondence to D. P. Hornby, Transgenomic Research Laboratory, Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, Western Bank, Sheffield S10 2TN, UK. Fax: + 44 114276 2687, Tel.: + 44 114222 4236, E-mail: d.hornby@shef.ac.uk (Received 4 July 2002, accepted 11 September 2002) Eur. J. Biochem. 269, 5492–5501 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03250.x The two faces of the RuvA tetramer are different; one face is convex and is mainly negatively charged whereas the opposite face is concave and positively charged. The negatively charged central pin containing the conserved Glu55 and Asp56 residues is shown in Fig. 2. Three crystal structures have been determined for a RuvA–synthetic Holliday junction complex [18–20]. The crystal structures of the E. coli RuvA–DNA complex consist of a single RuvA tetramer with a nearly square planar DNA molecule bound to its concave surface [18–20]. This is in agreement with a predicted model derived from the RuvA crystal structure [17]. The DNA duplex arms in the junction are located in the grooves on the surface of the RuvA as predicted, and a central pin region of the concave surface, which includes the conserved Glu55 and Asp56 residues, perfectly matches a hole of approximately 20 A ˚ diameter at the centre of the junction. The crystal structure of the Mycobacterium leprae RuvA–junction complex contains a RuvA tetramer on both faces of the junction, such that the DNA is sandwiched between two tetramers [19]. In the latter structure RuvA forms an octameric shell through which the DNA must pass during branch migration. Recently it has been shown that the acidic pin of E. coli RuvA modulates Holliday junction resolution by preventing binding to duplex DNA and constraining the role of branch migration in the RuvAB complex [21]. One of the enduring questions relating to the molecular recognition of the Holliday junction–resolvasome is the molecular nature of the components involved in the catalytic complex. In this paper we have carried out a detailed quantitative analysis of the binding of E. coli RuvA to synthetic Holliday junctions using a variety of biochemical procedures. Specifically we investigated protein–DNA interactions involving the RuvA and RuvC proteins, and have analysed both quantitative and qualitative differences between wild-type RuvA and a mutantwhichlacksthewild-typeacidicpin.Weshow that two RuvA tetramers bind to Holliday junctions possibly via a co-operative mechanism with an overall K d of approximately 0.2 n M and also demonstrate the formation of a RuvA/C complex on the Holliday junction. MATERIALS AND METHODS Synthesis and purification of oligodeoxynucleotides used in the binding studies Oligonucleotide synthesis was performed on an Applied Biosystems 394 DNA synthesiser using cyanoethyl phos- phoramidite chemistry. The biotin phosphoramidite was obtained from Glen Research. Oligodeoxynucleotides were provided in solution after deprotection in 30% ammonia. The oligonucleotides were purified using dena- turing PAGE and subsequently evaporated to dryness and desalted using a Pharmacia NAP 10 column according to the manufacturer’s instructions. Synthetic Holliday junc- tions, HJ24 and HJ50, each comprised four 24-mer and four 50-mer oligonucleotides. DNA annealing and puri- fication were essentially as described previously [33]. HJ50 contained HJ5, 6, 7 and 8. HJ 25 contained HJ1, 2, 3 and 4. Three way junctions were prepared using HJ5, 6 and 7 and duplex DNA annealed using D1 and D2, ASP1 and ASP2. All oligonucleotides used in the binding studies are shown in Table 3. Fig. 2. Molecular surface of the pin region of the RuvA tetramer showing its electrostatic surface potential. The view is along the fourfold axis of the tetramer into the concave face with electrostatic surface potential displayed (blue, positive; red, negative). The conserved Glu55 and Asp56 residues in each monomer are highlighted. Fig. 1. Molecular representation of an Escherichia coli RuvA tetramer illustrating its fourfold symmetry. The helices (barrels) and strands (arrows) are coloured red and blue, respectively. The view is along the fourfold symmetry axis into the concave face of the tetramer. Domains A, B, C and D are indicated for one monomer and the dashed lines depict the flexible linkers. Ó FEBS 2002 Assembly of RuvA and RuvC on Holliday junctions (Eur. J. Biochem. 269) 5493 Synthesis and purification of proteins used in the binding studies RuvA was purified as described [31]. RuvC was overex- pressed to about 10% of total cell protein in BL21 plysS (Cm r ) harbouring pGS775 (RuvC + cloned in pT7-7) (Ap r ). RuvC was then purified to 90% using two stages of chromatography. The first step involved pseudo-affinity chromatography using heparin-Sepharose. The second step was gel filtration on a Hi-Load Superdex-200 column (Pharmacia) in buffer A (0.5 M NaCl, 50 m M Tris/HCl, pH 7.5). Protein was then concentrated by precipitation with ammonium sulphate (0.55 gÆmL )1 ) to approximately 10 mgÆmL )1 and dialysed against buffer A to remove the ammonium sulphate. The RuvA and RuvC proteins were diluted in the appropriate running buffer to give final concentrations between 2000 and 1 n M . Binding assays using surface plasmon resonance The SPR analysis was performed using a BIAcore 2000 TM (BIAcore, Uppsala, Sweden). The oligonucleotides were diluted in HBS [0.01 M Hepes (pH 7.4), 0.15 M NaCl, 3 m M EDTA, 0.05% (v/v) surfactant P20] buffer to final concen- tration of 1 ngÆmL )1 and passed over a streptavidin sensor chip (SA) at a flow rate of 10 lLÆmin )1 until approximately 100–200 response units of the oligonucleotide was bound to the sensor chip surface. The protein was diluted in HBS. A range of protein concentrations (1–2000 n M ) were injected over the DNA attached to the sensor chip at a flow rate of 20 lL minute )1 for 3 min and were allowed to dissociate for 5 min. The bound protein was then removed by injecting 10 lLof1 M NaCl. This regeneration procedure did not alter to any measurable extent the ability of the Holliday junction to bind to RuvA. Analysis of the data was performed using the BIAevaluation software supplied with the BIAcore. To remove the effects of the bulk refractive index change at the beginning and end of the injections (which occur as a result of a difference in the composition of the running buffer and the injected protein), a control sensorgram obtained over the streptavidin surface was substracted from each protein injection. Stoichiometry analysis The biotinylated Holliday junctions were injected over the surface of the streptavidin coated sensor chip and the changes in response recorded. RuvA (1 l M )dilutedinHBS buffer was then injected over the Holliday junction attached to the sensor chip surface. The change in response of RuvA binding to the junction was recorded, the stoichiometry was calculated using Eqn (1): S ¼ R max RuvA R junc M r RuvA M r junc  ð1Þ where R max RuvA is the maximum response of RuvA binding, R junc is the response of the binding of the biotinylated Holliday junction, M r RuvA is the molecular mass of RuvA and M r junc is the molecular mass of the Holliday junction. The following values were used: M rRuvA 88 000, M rjunc (HJ50) 63 200, M r junc (HJ24) 32 000, M rRuvC 38 000. Kinetic analysis The dissociation rate constants were calculated using linear regression analysis assuming a zero order dissociation using Eqn 2: dR=dt ¼Àk d R 0 e Àk d ðtÀt 0 Þ ð2Þ where dR/dt is the rate of change of the SPR signal, R and R 0 , is the response at time t and t 0 . k d is the dissociation rate constant. Nonlinear regression analysis was used to determine the equilibrium dissociation constant from the sensorgrams and allows the calculation of both association and dissociation rate constants from a single sensorgram using the following equation. Using a 1 : 1 homogenous single site binding model: R ¼½ðk a CR max Þ=ðk a C þ k d Þ ð1 À e Àðk a C þ k d Þt Þð3Þ where C is the concentration of analyte, R max is the maximum analyte binding capacity in RU and R is the SPR signal in RU at time t, k a the association rate constant and k d the dissociation rate constant. Using a heterogenous model (where the component interactions are independent of each other, the response curve is the sum of the separate binding events), the following equation can be used: R ¼ X n nÀ1 ½ðk a;n C n R max;n Þ=ðk a;n C n k d;n Þ Âð1 À e Àðk a;n C n þ k d;n Þt Þð4Þ This equation assumes the analyte species bind independ- ently to separate ligand sites (BIA evaluation software). Equilibrium binding analysis BIAcore equilibrium binding experiments were performed as described by Myszka et al. [28] with minor modifications. The instrument was equilibrated at 25 °C with HBS buffer (0.01 M Hepes (pH 7.4), 0.15 M NaCl, 3 m M EDTA, 0.05% (v/v)surfactantP20)ataflowrateof100lLÆmin )1 . Baseline data were collected for 45 min at the start of the experiment, before the incorporation of the protein into the running buffer. After equilibrium binding profiles had been generated, the responses from the four flow cells were baseline corrected during the initial washing phase. The response from the reference flow cell was subtracted from the other three flow cells to correct for refractive index changes, nonspecific binding and instrument drift. RESULTS Stoichiometry and kinetics of the RuvA–Holliday junction interaction The stoichiometry and kinetics of the RuvA–Holliday junction interaction was analysed using surface plasmon resonance (SPR) on a BIAcore 2000. The biotinylated synthetic Holliday junctions (HJ50/HJ24, see Materials and methods) were immobilized on a streptavidin coated sensor chip (SA) and the protein injected over the surface of the immobilized Holliday junction. The sensorgram can be used to derive kinetic and equilibrium constants and also allows 5494 M. J. Dickman et al. (Eur. J. Biochem. 269) Ó FEBS 2002 the calculation of the stoichiometry of the interaction. This method has been used previously to study protein–DNA interactions [22,23]. To calculate the stoichiometry of the interaction of RuvA with the Holliday junction, the biotinylated Holliday junc- tions were injected over the surface of the streptavidin coated sensor chip and the change in response recorded. 1 RU corresponds to 1 pgÆmm )2 protein [24]. For DNA, a value of 1 RU corresponding to 0.73 pgÆmm )2 was used, as deter- mined by Speck et al. [23] The change in response for the binding of the RuvA to the junction was recorded and using Eqn (1) (see Materials and methods), the stoichiometry at a given RuvA concentration was calculated and the results are summarized in Table 1. From these results it can be concluded that two RuvA tetramers bind to the Holliday junction, this occurs in both the 24-mer strand and 50-mer strand junctions. This experiment was repeated using differ- ent amounts of junction bound to the sensor chip surface. The results were consistent with two RuvA tetramers bound per Holliday junction. These results support the evidence from both gel shift assays [15], electron microscopy studies [25] and neutron scattering data [26], which demonstrate that two RuvA tetramers can bind to synthetic Holliday junctions. Crystallographic studies of the RuvA–synthetic Holliday junction show either one [18,20] or two [19] RuvA tetramers bound to the Holliday junction. The results from the SPR experiments described here support the latter model in solution. These experiments also show that complete removal of RuvA from DNA can be affected by addition of 1 M salt, highlighting the role of electrostatic interactions in the binding of RuvA to the junction (data not shown). The binding of RuvA was studied using the BIAcore to obtain kinetic parameters for the interaction of RuvA with the synthetic Holliday junctions attached to a streptavidin sensor chip. The interaction of RuvA with both the 24-mer and the 50-mer Holliday junctions was then investigated. From the sensorgrams obtained (see Fig. 3) the data were fitted to a mathematical model which describes the inter- action of two analyte molecules (two RuvA tetramers) binding to a single ligand (Holliday junction) at different sites. The model used was a heterogeneous parallel model (BIAevaluation software) which describes the interaction: A+B ¡ AB þ B ¡ AB 2 This mathematical model was used to obtain association and dissociation rate constants for the above reaction (see Eqn 4). However, the results clearly show that this model produces an unsatisfactory fit to the data. The residuals shown in Fig. 3B indicate how well the mathematical model fits the data. High residual values, indicating a poor fit to the data, are obtained for the association phase. However, by contrast, low residuals were obtained for the dissociation phase indicating a very acceptable fit to the data. Several other mathematical models were used to fit the data, including a 1 : 1 Langmuir binding model. All yielded poor correlation with the association phase of the RuvA– Holliday junction interaction. The mathematical models employed, appeared to be unable to support the very fast association kinetics observed experimentally. Such a kinetic mechanism obtained for the interaction of two RuvA tetramers with the Holliday junction could be explained by a co-operative effect during the association phase. Two analyte molecules interacting with a single ligand at different sites may introduce a co-operative function not described by the mathematical models. This co-operativity may lead to the fast association kinetics observed in the binding of RuvA to the Holliday junction. Whilst there are other possible explanations for the binding data, the experiments carried out below seem to be consistent with a co-operative component to the RuvA–DNA interaction. Equilibrium binding profile of the RuvA–Holliday junction interaction To further evaluate the interaction of RuvA with the Holliday junction, equilibrium binding analysis was Table 1. Stoichiometry of RuvA and RuvC bound to Holliday junctions as determined by SPR analysis using Eqn (1) (see Materials and meth- ods). Holliday Junction RuvA a RuvC b 1 l M 2 l M 0.75 l M HJ 24 2.3 2.5 1.2 HJ 50 2.6 2.7 1.4 a Tetramers bound per Holliday junction. b Dimers bound per Holliday junction. Fig. 3. Kinetic analysis of the RuvA–Holliday junction interaction. (A) Binding of RuvA at various concentrations (10–2000 n M )tothesyn- thetic Holliday junction (HJ50). The experimental binding curve is shown as a continuous line and the fitted data is shown as a broken line. The data were fitted to a mathematical model describing the interaction of two analyte molecules binding a ligand at two separate sites (a homogenous parallel model). The residuals, the difference of the experimental data and the fitted values for the association and dissociation phase, are shown in (B). Ó FEBS 2002 Assembly of RuvA and RuvC on Holliday junctions (Eur. J. Biochem. 269) 5495 performed. The protein was placed directly in the running buffer, which was then passed over the sensor chip surface continuously. The chip contained duplex DNA and the Holliday junction attached to the different flow cells. Figure 4 shows the equilibrium binding profile for the E. coli RuvA interacting with the Holliday junction (HJ50) and duplex DNA (D1/2). The binding profiles clearly demonstrate the higher affinity of RuvA for Holliday junctions in comparison to duplex DNA. This is illustrated by the binding of RuvA to the Holliday junction at lower concentrations (0.022 and 0.22 n M ). No binding to duplex DNA is seen until a concentration of 22.6 n M is used, where it is also seen to bind to the duplex arms of the Holliday junction. These results demonstrate that the E. coli RuvA has the ability to target Holliday junctions over duplex DNA with approximately 1000-fold greater efficiency. Also, E. coli RuvA has the ability to bind to the duplex arms of the Holliday junctions after specifically binding to the Holliday junction at the crossover point. From the analysis of the equilibrium binding profile it can also be shown that at low concentrations of RuvA (0.0026 and 0.026 n M ) only very small amounts of protein bind to the Holliday junction even after 2.5 h of incubation. Only after the concentration of RuvA is increased to 0.22 n M ,is significant binding to the Holliday junction observed. However, at this concentration, equilibrium is soon reached with only small amounts of additional binding to the junction at concentrations above this value. Therefore over only a 10-fold increase in protein concentration, nearly 100% of the binding sites are occupied by RuvA. The concentration at which approximately 50% of the DNA binding sites are bound by RuvA is 0.2 n M . Previous analysis of the high affinity Ets1 protein–DNA interaction [27] showed that binding occurs over three to four orders of magnitude of protein concentration until 100% of the binding sites are occupied. However, the RuvA–Holliday junction binding occurs over two orders of magnitude of RuvA concentration until 100% of the binding sites are occupied. These results provide further evidence to support a co-operative mode of binding in the RuvA–Holliday junction interaction; an idea supported by the RuvA tetramer–tetramer interactions observed in the M. leprae RuvA–Holliday junction complex [19]. Whilst complex modes of interaction could account for the data, a co-operative mode of binding seems to be the most plausible explanation. SPR analysis of the RuvAC–Holliday junction ternary complex To further examine the hypothesis that a tetramer of RuvA can bind to each face of a Holliday junction, the effect of the addition of RuvC to the RuvA–Holliday junction complex was investigated. Analysis of the interaction of RuvA and RuvC with the Holliday junction was performed by sequential addition of the RuvA and RuvC proteins to the Holliday junction. The resulting sensorgram is shown in Fig. 5A and shows that after the addition of RuvA (1 l M ) to the Holliday junction, RuvC (1 l M ) does not bind to the junction. This would be expected, if RuvA occupies the site for this interaction. A series of concentrations of RuvC (10–2000 n M )were injected over the immobilized Holliday junctions attached to the sensor chip surface and the stoichiometry calculated as previously. A summary of the values obtained are shown in Table 1. From the results it can be seen that at high concentrations (2 l M ), RuvC forms a complex in which more than one dimer interacts with the junction, suggesting that RuvC possibly binds to both faces of the junction in a similar manner to RuvA. It had been thought previously that only one RuvC dimer binds to the junction, which is the active form of the complex [7]. However, at lower concentrations of RuvC, the complex only con- tains on average one RuvC dimer per DNA junction as expected. These experiments also show that complete removal of RuvC from DNA can be effected by addition of 1 M salt (data not shown), highlighting the role of electrostatic interactions in the binding of RuvC to the junction. A further experiment was performed by first binding RuvC (2 l M ) to the junction followed by the addition of RuvA (1 l M ). The resulting sensorgram is shown in Fig. 5B. No significant RuvA binding was observed, which indicates that two RuvC dimers may bind to the junction in a similar manner to the two RuvA tetramers, and that the two bound RuvC dimers prevent the binding of RuvA under the conditions used in the experiment. A small amount of RuvA binding is observed, possibly due to RuvC dissociation from the Holliday junction before the injection of RuvA. A final experiment was carried out in which RuvC was added to the Holliday junction under conditions where the mean stoichio- metric calculation shows one RuvC dimer was bound per junction. After adding RuvC (0.75 l M ) to the junction, RuvA (1 l M ) was then added and the resulting sensorgram is shown in Fig. 5C. These results show that under these conditions RuvA can bind to a RuvC–Holliday junction complex, allowing the formation of a RuvAC complex on the Holliday junction. The effect of addition of antibodies raised against RuvA (anti-RuvA) to the proposed RuvAC complex is shown in Fig. 5D. The sensorgram shows the binding of RuvA after the addition of RuvC, followed by the binding of the anti-RuvA. A large response is seen due to the large molecular mass of the anti-RuvA complex. These results demonstrate that after the addition of RuvC, RuvA can bind to the complex as confirmed by the binding of the anti-RuvA. No binding of the anti-RuvA is seen on the RuvC complex (data not shown). Fig. 4. Equilibrium binding of the E. coil RuvA protein to linear duplex and Holliday junction substrates. The profiles shown were obtained by incorporating the E. coli RuvA in the running buffer at concentrations of 0.00226 n M (a), 0.0226 n M (b), 0.226 n M (c), 2.6 n M (d) and 22.6 n M (e). The arrows indicate the time points that the concentration of RuvA was altered. 5496 M. J. Dickman et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Comparison of DNA recognition by RuvA and a mutant RuvA (E55R D56K) SPR analysis demonstrated that two tetramers of E. coli RuvA bind to Holliday junctions in a structure specific manner, with a significantly greater affinity than for duplex DNA. A further experiment was performed to compare the binding of RuvA and a mutant RuvA. The mutant E. coli RuvA has the negatively charged central pin residues Glu55 and Asp56 mutated to Arg55 and Lys56, which results in a positively charged central pin. A biotinylated Holliday junction (HJ50), a three-way junction and a duplex DNA (D1/2, see Materials and methods) were immobilized on different flow cells on a streptavidin sensor chip. The binding of 2 l M E. coli RuvA with the different complexes is shown in Fig. 6A. The difference in stability of the duplex and three-strand-RuvA complex compared to the four-strand-RuvA–protein com- plex can clearly be seen in the sensorgram (note the gradient of the dissociation phase). The dissociation rate constants were calculated using Eqn (2) (see Materials and methods) and shows a three- to fourfold difference between the duplex/three-strand junctions, compared to the four-strand- RuvA complexes (see Table 2), indicating that the formation of the Holliday junction-protein complex is more stable than the duplex/three-way junction complex. Using small duplex DNA (< 25 bp) no significant binding of the E. coli RuvA was seen using SPR (data not shown). These experiments present further evidence that the E. coli RuvA is highly structure specific in its binding to Holliday junctions. The effect of the charge on the central pin with respect to the specificity of the interaction was further investigated by SPR analysis of the mutant E. coli RuvA (RuvA E55R D56K). The protein was passed over the streptavidin sensor chip containing the duplex and the three/four-strand junctions. The resulting sensorgram is shown in Fig. 6B. The dissociation rate constants were calculated for the dissociation of the protein from the different complexes and are shown in Table 2. These results demonstrate that all the protein-DNA complexes have very slow dissociation rates, indicating the formation of very stable protein–DNA complexes. The calculated rate constants are lower than Fig. 5. Binding of RuvA and RuvC to Holliday junctions. (A) SPR sensorgram showing the binding of RuvA to the Holliday junction followed by the addition of RuvC. 1 shows the binding of RuvA (1 l M ) to the Holliday junction to form a proposed complex con- taining two RuvA tetramers bound to the Holliday junction. 2 shows the subsequent addition of RuvC (1 l M ) to the RuvA–Holliday junction complex, the sensorgram indicates no binding of RuvC. (B) Sensorgram showing the binding of RuvC to the Holliday junction followed by the addition of RuvA. 1 shows the binding of RuvC (2 l M ) to the Holliday junction to form a proposed complex con- taining two RuvC dimers bound to the junction. 2 shows the subse- quentadditionofRuvA(1l M ) and indicates no significant binding to the RuvC–junction complex. (C) Sensorgram showing the formation of a RuvAC-junction complex. 1 shows the binding of RuvC (0.75 l M ) to the Holliday junction to form a proposed complex which contains one RuvC dimer bound to the junction. 2 shows the subsequent addition of RuvA (1 l M ) to the RuvC–junction complex. The sen- sorgram indicates after RuvC has bound to the junction RuvA can bind to the RuvC–junction complex to form a RuvAC complex. (D) Sensorgram showing the binding of anti-RuvA to the RuvAC-junction complex. 1 shows the binding of RuvA to form the RuvAC complex. 2 shows the binding of the RuvA antibody to the RuvAC complex. The sensorgram demonstrates that the antibody can bind to the complex, indicating further evidence of the formation of the RuvAC-complex. Fig. 6. SPR sensorgram showing the DNA binding specificity of RuvA. (A) Binding of wild-type RuvA (2 l M ) and (B) binding of the mutant RuvA (E55R D56K) (1.2 l M ) to Holliday junction, linear duplex and 3-strand junction substrates. Ó FEBS 2002 Assembly of RuvA and RuvC on Holliday junctions (Eur. J. Biochem. 269) 5497 previous values obtained for the binding of the wild-type E. coli RuvA protein, and show similar values for the binding to the duplex, three-strand and four-strand junc- tions; demonstrating that the mutant RuvA protein forms a complex with duplex DNA which is of equal stability as the Holliday junction–protein complex. The sensorgram in Fig. 6B also illustrates that increased amounts of the protein interact with the DNA, as shown by the larger response observed on the sensorgram compared to the wild-type E. coli RuvA. These results give stoichiometry values of five RuvA tetramers bound per DNA. From the SPR analysis it shows that the effective charge of the central pin region dramatically influences the binding of duplex DNA to the protein: changing the charge on the central pin from negative to positive, increases the stability of the duplex DNA-protein com- plexes. These results are consistent with those obtained by Ingleston et al. [21] using gel retardation assays and indicate that the charge on the central pin of the RuvA has a substantial effect on the ability of the protein to bind to duplex DNA, and therefore to direct the structure specificity involved in binding a Holliday junction. The mutant E. coli RuvA forms a stable complex with duplex DNA, there is no additional stability of the Holliday junction–protein interaction over the duplex DNA–protein interaction. These data suggest that the protein may now be binding to the duplex arms of the junction, as opposed to only the crossover points of the junction, suggesting that the protein may no longer be binding in a structure specific manner to the junction, but in a nonspecific fashion to duplex DNA. Equilibrium binding profile of the mutant E. coli RuvA (E55R D56K) protein To further analyse the interaction of the mutant E. coli. RuvA protein, equilibrium binding analysis was performed similar to that performed with wild-type E. coli RuvA. The equilibrium binding profiles were generated to obtain further information on the specificity of binding. Figure 7A shows the binding profile of the mutant E. coli RuvA protein to the DNA complexes. From this profile it can clearly be seen that the protein binds to both the Holliday junction and the duplex DNA at the same concentration (2.6 n M ), indicating that the protein has a similar affinity for the duplex DNA and the Holliday junction. These results demonstrate that the mutant E. coli protein is binding to the duplex arms of the Holliday junction and is no longer binding in a structure specific manner to the Holliday junction. Table 2. Dissociation rate constants (k d ) for RuvA–DNA complexes as determined by SPR analysis. DNA RuvA wild-type (1/s) ± SD RuvA E55R,D56K (1/s)±SD Duplex 19 · 10 )4 ± 2.2 · 10 )4 8 · 10 )5 ± 4.2 · 10 )6 3-strand junction 17 · 10 )4 ± 1.9 · 10 )4 2.7 · 10 )5 ± 6.2 · 10 )6 4-strand junction 5.5 · 10 )4 ± 4.2 · 10 )5 4.7 · 10 )5 ± 6.4 · 10 )6 Fig. 7. Equilibrium binding of the mutant RuvA (E55R D56K) protein to linear duplex and Holliday junction substrates. The profiles shown were obtained by incorporating the mutant RuvA in the running buffer at concentrations of 0.064 n M (A), 0.64 n M (B), 6.4 n M (C) and 37 n M (D). The arrows indicate the time at which the concentration of the protein was altered. Table 3. Oligodeoxynucleotides. Name Sequence (5¢-3¢) ASP1 Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG ASP2 CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT DU1 Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA DU2 TAGGCAGACTGACCCGGGAGCTGCTCGTAC HJ5 Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT HJ6 GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC HJ7 TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC HJ8 CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA HJ1 AGAAGCTCCATGTAGCAAGGCTAG HJ2 CTAGCCTTGCTAGGACATCTTCCG HJ3 CGGAAGATGTCCATCTGTTGTAGG HJ4 Bio-AAAAAACCTACAACAGATCATGGAGCTTCT 5498 M. J. Dickman et al. (Eur. J. Biochem. 269) Ó FEBS 2002 DISCUSSION Co-operative binding of RuvA tetramers to Holliday junctions The stoichiometry analysis presented here (see Table 1), clearly shows that two RuvA tetramers bind to synthetic Holliday junctions, which is in agreement with the crystal structure obtained for the M. leprae RuvA–Holliday junc- tion complex [19]. In this structure the two RuvA tetramers make direct protein–protein contacts at four equivalent points. The protein–protein contacts involve side chain interactions between the helix from residues 117–129 of an A chain in one tetramer, with the same helix in a B chain on the other tetramer. A total of six ion-pair interactions are formed at the helix–helix interface (see Fig. 8). The residues involved in protein–protein interactions are also conserved in the E. coli RuvA protein. These protein–protein interac- tions may be the source of the co-operativity proposed from the binding profiles observed for E. coli RuvA and synthetic Holliday junctions presented here. The two binding surfaces of the Holliday junction are expected to bind to the RuvA tetramers with different affinities: the binding surface of the Holliday junction in the crystal structure obtained by Hargreaves et al. [18] is predicted to be the optimal binding site. The second RuvA tetramer that binds to the opposite surface of the Holliday junction may bind with lower affinity. The results obtained from the equilibrium binding profile of the interaction of RuvA with the Holliday junction demonstrate that only a 10-fold increase in protein concentration is required for the formation of a complex with two RuvA tetramers bound to the Holliday junction. No intermediate is seen where equilibration is reached with one RuvA tetramer bound to the Holliday junction. This suggests co-operativity in the binding of the tetramers, which may involve protein-protein contacts between the two tetramers, leading to a possible stabilization of the weaker binding RuvA tetramer. A model for the active RuvAB branch migration complex bound to the Holliday junction has been proposed [5,24]. The complex comprises a central RuvA oligomer with RuvB hexameric rings bound to the duplex arms on opposite sides of the Holliday junction. Roe et al. [19] propose that the RuvB ATPase is anchored to the complex to achieve maximum efficiency of branch migration, and this can only be achieved by the presence of two RuvA tetramers. Our data suggest that two RuvA tetramers bind to the Holliday junction in the absence of RuvB in a co- operative manner, with no observable intermediate con- taining one RuvA tetramer. These data provide further evidence to support the formation of a RuvAB complex containing two RuvA tetramers which subsequently under- goes branch migration. Observation of a RuvAC–Holliday junction complex The formation of the RuvAC–Holliday junction complex, in which one RuvA tetramer and one RuvC dimer are bound on opposite faces of the junction, is significant. Its formation may represent an important stage in the trans- ition between RuvAB mediated branch migration and RuvC mediated cleavage. Alternatively this structure could be part of a larger RuvABC–junction complex. The assembly of a RuvABC complex has been supported through various experiments [15,28,29]. RuvBC promoted branch migration has been observed [29] providing addi- tional support for a RuvABC active complex. However, formation of a RuvABC complex by displacement of a RuvA tetramer from the octameric RuvAB complex is not supported by our results. Figure 5A demonstrates that there was no displacement of RuvA when RuvC was added to the octameric RuvA complex. However the formation of a RuvABC complex after the formation of a RuvBC complex containing a single RuvC dimer is supported by the binding of RuvA after the addition of RuvC to form a RuvAC complex (see Fig. 5C). Eggleston et al. [28] proposed that an equilibrium may exist between two types of complex: a RuvAB branch migration complex and a RuvABC branch migration/resolution complex. The charge on the central pin modulates DNA recognition The SPR profiles reveal that E. coli RuvA is a structure specific protein that binds with a much greater affinity to Holliday junctions compared to duplex DNA. The E. coli RuvA was demonstrated to target Holliday junctions 1000 times more efficiently than duplex DNA. The mutant E. coli RuvA (E55R D56K), which contains a positively charged pin region, binds to duplex DNA with high affinity. These results are consistent with those obtained using gel retarda- tion assays, which demonstrated that the protein binds Holliday junctions with approximately the same affinity as it binds duplex DNA [21]. The SPR analysis shows that the mutant protein no longer binds to Holliday junctions in a structure specific manner but binds to the duplex arms of the junction (see Fig. 7). The data also show that the pro- tein binds with a greater stoichiometry (five tetramers) compared to the binding of the wild-type E. coli RuvA Fig. 8. Protein–protein interface in the structure of the M. leprae RuvA Holliday junction complex. The side chains along the helices from 117 to129areshownwiththeAchainandBchaincolouredgoldand purple, respectively. The basic side chains are shown in blue, acidic in red and hydrophobic in grey. Ó FEBS 2002 Assembly of RuvA and RuvC on Holliday junctions (Eur. J. Biochem. 269) 5499 (two tetramers) to Holliday junctions, indicating that more than one tetramer or octamer binds to the DNA molecule. This suggests that the protein does not simply bind at the ends of the duplex DNA arms but binds along the linear duplex DNA across the central pin. The formation of a positive charge on the pin region also leads to a further increase in affinity for duplex DNA. There remains the caveat that alteration of these amino acids may have affected the conformation of this pin. However, the mutant protein was purified using the same procedure designed for wild-type RuvA, indicating that the mutation caused little effect on the overall structure of the protein [21]. The overall structure of the pin region, which exquisitely matches a cavity of approximately 20 A ˚ diameter at the center of the junction, was expected to direct the structure specific binding of the protein to the Holliday junction. The observed structural specificity seems to originate both from the charge and the structure of the pin region. However, the charge carried by the pin region appears to have an equally important role. Ingleston et al. [21] demonstrated that the E55R D56K mutant E. coli protein was unable to block the activity of RusA resolvase in vivo and inhibited junction resolution and branch migration with respect to the wild-type RuvA. These data are consistent with the SPR analysis, which indicates that the protein does not target Holliday junctions, and multiple tetramers or octamers bind along linear duplex DNA. However, Ingleston et al.[21]also demonstrated that the E. coli RuvA mutants with a more positively charged pin were unable to promote repair more efficiently than those with a more negative pin. Excluding the E55R D56K protein their results demon- strated that the mutant proteins increased the rate of branch migration in the RuvAB complex compared to the wild-type RuvA. The changes also reduced the ability to stimulate RuvC in the RuvABC resolvasome. It still remains to be seen if the increased rate of branch migration directly inhibits the ability of RuvC to perform junction cleavage in the resolvasome complex. Ingleston et al. had previously shown the RuvA mutants have an increased rate of branch migration of the RuvAB complex and in conjunction with the reduced ability to target Holliday junctions this may explain the inability of the mutant proteins to promote DNA repair. ACKNOWLEDGEMENTS We thank the Wellcome Trust for the Prize Wellcome Studentship awarded to Mark J. Dickman and the Medical Research Council for the programme Grant awarded to Robert G. Lloyd and Gary J. Sharples. REFERENCES 1. West, S.C. (1992) Enzymes and molecular mechanisms of genetic recombination. Annu. Rev. Biochem. 61, 603–640. 2. Cox, M.M., Goodman, M.F., Kreuzer, K.N., Sherratt, D.J., Sandler, S.J. & Marians, K.J. (2000) The importance of repairing stalled replication forks. Nature 404, 37–41. 3. Shinagawa, H. & Iwasaki, H. (1996) Processing the Holliday junction in homologous recombination. Trends Biochem. Sci. 21, 107–111. 4. West, S.C. (1997) Processing of recombination intermediates by the RuvABC proteins. Annu.Rev.Genet.31, 213–244. 5. Parsons, C.A., Tsaneva, I., Lloyd, R.G & West, S.C. (1992) Inter- action of Escherichia coli RuvA and RuvB proteins with synthetic Holliday junctions. Proc. Natl Acad. Sci. USA 89, 5452–5456. 6. Iwasaki, H., Takahagi, M., Nakata, A & Shinagawa, H. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 6, 2214–2220. 7. Shah, R., Cosstick, R & West, S.C. (1997) The RuvC protein dimer resolves Holliday junctions by a dual incision mechanism that involves base-specific contacts. EMBO J. 16, 1464–1472. 8. Shida, T., Iwasaki, H., Saito, A., Kyogoku, Y & Shinagawa, H. (1996) Analysis of substrate specificity of the RuvC Holliday junction resolvase with synthetic Holliday junctions. J. Biol. Chem. 271, 26105–26109. 9. Lloyd, R.G., Buckman, C & Benson, F.E. (1987) Genetic analysis of conjugational recombination in Escherichia coli K12 strains deficient in RecBCD enzyme. J. Gen. Microbiol. 133, 2531–2538. 10. Mandal, T.N., Mahdi, A.A., Sharples, G.J & Lloyd, R.G. (1993) Resolution of Holliday intermediates in recombination and DNA repair: indirect suppression of RuvA, RuvB, and RuvC mutations. J. Bacteriol. 1, 4325–4334. 11. Sharples, G.J., Benson, F.E., Illing, G.T & Lloyd, R.G. (1990) Molecular and functional analysis of the Ruv region of Escherichia coli K-12 reveals three genes involved in DNA repair and recombination. Mol. Gen. Genet. 221, 219–226. 12. Tsaneva, I.R., Illing, G., Lloyd, R.G & West, S.C. (1992) Pur- ification and properties of the RuvA and RuvB proteins of Escherichia coli. Mol. Gen. Genet. 235, 1–10. 13. Shiba, T., Iwasaki, H., Nakata, A & Shinagawa, H. (1991) SOS- inducible DNA repair proteins, RuvA and RuvB, of Escherichia coli: functional interactions between RuvA and RuvB for ATP hydrolysis and renaturation of the cruciform structure in super- coiled DNA. Proc. Natl Acad. Sci. USA 88, 8445–8449. 14. Parsons, C.A., Stasiak, A., Bennett, R.J & West, S.C. (1995) Structure of a multisubunit complex that promotes DNA branch migration. Nature 374, 375–378. 15. Whitby, M.C., Bolt, E.L., Chan, S.N & Lloyd, R.G. (1996) Interactions between RuvA and RuvC at Holliday junctions: inhibition of junction cleavage and formation of a RuvA–RuvC– DNA complex. J. Mol. Biol. 264, 878–890. 16. Parsons, C.A & West, S.C. (1993) Formation of a RuvAB–Holl- iday junction complex in vitro. J. Mol. Biol. 232, 397–405. 17. Rafferty, J.B., Sedelnikova, S.E., Hargreaves, D., Artymiuk, P.J., Baker, P.J., Sharples, G.J., Mahdi, A.A., Lloyd, R.G & Rice, D.W. (1996) Crystal structure of DNA recombination protein RuvA and a model for its binding to the Holliday junction. Science 274, 415–421. 18. Hargreaves, D., Rice, D.W., Sedelnikova, S.E., Artymiuk, P.J., Lloyd, R.G & Rafferty, J.B. (1998) Crystal structure of E. coli RuvA with bound DNA Holliday junction at 6 A ˚ resolution. Nat. Struct. Biol. 5, 441–446. 19. Roe, S.M., Barlow, T., Brown, T., Oram, M., Keeley, A., Tsaneva, I.R & Pearl, L.H. (1998) Crystal structure of an octa- meric RuvA–Holliday junction complex. Mol. Cell 2, 361–372. 20. Ariyoshi, M., Nishino, T., Iwasaki, H., Shinagawa, H & Mor- ikawa, K. (2000) Crystal structure of the Holliday junction DNA in complex with a single RuvA tetramer. Proc. Natl Acad. Sci. USA 97, 8257–8262. 21. Ingleston, S.M., Sharples, G.J & Lloyd, R.G. (2000) The acidic pin of RuvA modulates Holliday junction binding and processing by the RuvABC resolvasome. EMBO J. 19, 6266–6274. 22. Panayotou, G., Brown, T., Barlow, T., Pearl, L.H & Savva, R. (1998) Direct measurement of the substrate preference of uracil- DNA glycosylase. J. Biol. Chem. 273, 45–50. 23. Speck, C., Weigel, C & Messer, W. (1999) ATP- and ADP-dnaA protein, a molecular switch in gene regulation. EMBO J. 18, 6169– 6176. 5500 M. J. Dickman et al. (Eur. J. Biochem. 269) Ó FEBS 2002 24. Stenberg, E., Persson, B., Roos, H & Urbaniczky, C. (1991) Quantitative-determination of surface concentration of protein with surface-plasmon resonance using radiolabeled proteins. J. Colloid Interface Sci. 143, 513–526. 25. Yu, X., West, S.C & Egelman, E.H. (1997) Structure and subunit composition of the RuvAB–Holliday junction complex. J. Mol. Biol. 266, 217–222. 26. Chamberlain, D., Keeley, A., Aslam, M., Arenas-Licea, J., Brown, T., Tsaneva, I.R & Perkins, S.J. (1998) A synthetic holliday junc- tion is sandwiched between two tetrameric Mycobacterium leprae RuvA structures in solution: new insights from neutron scattering contrast variation and modelling. J. Mol. Biol. 284, 385–400. 27. Myszka, D.G., Jonsen, M.D & Graves, B.J. (1998) Equilibrium analysis of high affinity interactions using BIACORE. Anal Biochem. 265, 326–330. 28. Eggleston, A.K., Mitchell, A.H & West, S.C. (1997) In vitro reconstitution of the late steps of genetic recombination in E. coli. Cell 89, 607–617. 29. van Gool, A.J., Shah, R., Mezard, C & West, S.C. (1998) Func- tional interactions between the Holliday junction resolvase and the branch migration motor of Escherichia coli. EMBO J. 17, 1838– 1845. 30. 2 Parsons, C.A & West, S.C. (1990) Specificity of binding to four- way junctions in DNA by bacteriophage T7 endonuclease I. Nucleic Acids Res. 18, 4377–4384. 31. Sedelnikova, S.E., Rafferty, J.B., Hargreaves, D., Mahdi, A.A., Lloyd, R.G & Rice, D.W. (1997) Insights into the symmetry of the Holliday junction from the crystallisation of RuvA. Acta. Crys- tallogr. D53, 122–124. Ó FEBS 2002 Assembly of RuvA and RuvC on Holliday junctions (Eur. J. Biochem. 269) 5501 . Holliday junction, the effect of the addition of RuvC to the RuvA Holliday junction complex was investigated. Analysis of the interaction of RuvA and RuvC. migration. Observation of a RuvAC–Holliday junction complex The formation of the RuvAC–Holliday junction complex, in which one RuvA tetramer and one RuvC