0

 chapter 7 contains a longitudinal analysis of the subset of companies that had participated in the previous study collis 2003 as well as the present survey

A comparative analysis of methods to represent uncertainly in estimating the cost of constructing wastew

A comparative analysis of methods to represent uncertainly in estimating the cost of constructing wastew

Môi trường

... the literature (Tanaka and Asia, 198 4a, 1984b; Jajuga, 1986; Tanaka, 19 87; Tanaka and Watada, 1988; Tanaka et al 1989; Chen, 1988; Diamond, 1988) Later on, the advances in theory have been made ... used in this analysis is approximately 27NT$/lUS$ in 1995 Such a normalized cost database, representing a large-scale calibrated effort to integrate the nationwide baseline information of wastewater ... Cost information associated with 48 domestic wastewater treatment plants and 29 industrial wastewater treatment plants was collected and included in the cost database within a thorough investigation...
  • 27
  • 762
  • 0
A longitudinal analysis of port systems in asia

A longitudinal analysis of port systems in asia

Tổng hợp

... Asia Southeast Asia includes a group of countries consisting of Singapore Malaysia, Thailand, Indonesia and Philippines while Northeast Asia comprises of Korea, Japan, China, Hong Kong, Macau and ... and Kansai), China (Beijing Capital, Shanghai), Taiwan (Chiang Kai-Shek), Macau, Malaysia (Kuala Lumpur), Indonesia (Soekarno-Hatta), Thailand (Bangkok) and Philippines (Ninoy Aquino) 2.2.2 The ... flights that carry passengers and cargo, this study thus uses total terminal area as a proxy to the amount of physical capital used in an airport 24 Chapter Cargo Traffic Performances at East Asian...
  • 323
  • 458
  • 0
a contrastive analysis of lexical and grammatical cohesion in inaugural speeches by the u s president barrack obama and vietnamese former president

a contrastive analysis of lexical and grammatical cohesion in inaugural speeches by the u s president barrack obama and vietnamese former president

Văn học - Ngôn ngữ học

... learners of the second language to avoid making errors and use the language as natively as their mother tongue Aims of the study This thesis aims at: - giving a general theoretical background of ... planet Many other anaphoras can be found in the text as in the following example: Today I say to you that the challenges we face are real They are serious and they are many They will not be met easily ... particular features of language use and characteristics of this type of writing in Vietnamese As a matter of fact, many learners of English often transfer their ideas in Vietnamese to the target...
  • 43
  • 1,028
  • 1
A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse

A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse

Khoa học xã hội

... something can perhaps be seen as a failure to activate suitable metaphors at the conceptual level a failure to assimilate the new to the already existing Many of todays standard meaning of words and ... arguing that it was public acceptance of President Bushs use of metaphor in the rhetoric leading up to the crisis that actually generated war in the Gulf rather than avoidance of war and a continuation ... occurrences of each lexeme Thus, for example, the string increa was searched for, in order to turn up all occurrences 24 of increase, increasing, increases and increased The results of this analysis are...
  • 33
  • 1,109
  • 3
Báo cáo khoa học:

Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

Báo cáo khoa học

... speaker and the second the gender of the other speaker, i.e FF, FM, MF, MM The task remains the same: given the transcript of a conversation side, classify it according to the appropriate category ... is a task much harder than the binary classification we had in subsection 4.1, because given only the transcript of a conversation side we must make inferences about the gender of the current as ... current as well as the other conversation side We have used SVMs as the learning method In their basic formulation, SVMs are binary classifiers (although there has been recent work on multi-class SVMs)...
  • 8
  • 347
  • 0
A RETROSPECTIVE ANALYSIS OF COMORBID TRAITS AFFECTING FEEDING IN INFANTS WITH DOWN SYNDROME

A RETROSPECTIVE ANALYSIS OF COMORBID TRAITS AFFECTING FEEDING IN INFANTS WITH DOWN SYNDROME

Y dược - Sinh học

... August 2008 Data regarding cardiac, gastrointestinal, endocrine, airway, auditory, and feeding abnormalities have been collected and incedences and comorbidites of these traits has been examined ... expressions include a small mandible, protruding tongue, and a flattened nasal bridge These traits may affect the feeding, breathing, and swallowing of individuals with DS Because some complications may ... K!E3 >7" T`"+_@"D2>"!;D:;8@"1!89":4 87> 75"D 775 !;E"@8>:87E !7@ ":;5":8" 47: @8"812"?!@!8@IIIIIIIIIIIIII WV" K!E3 >7" OX`"+_@"D2>"!;D:;8@"1!89":4 87> 75"D 775 !;E"@8>:87E !7@ "!;"8 97" C >7@ 7;G7"2>":F @7; G7"2D":" @7? 7 >7" ,0":F;2>
  • 125
  • 347
  • 0
analysis of four-wave-mixing effects in up stream transmission using  soa as transmiter

analysis of four-wave-mixing effects in up stream transmission using soa as transmiter

Kĩ thuật Viễn thông

... beams, and also ensured thatnonlinear interaction of the two signals occurred only in the applied fiber The peak power of the pump into thefiber was -10 dBm, while the power of the signal was In ... J Yamawaku, H Takara, T Ohara, K Sato, A Takada, T Morioka, O Tadanaga, H Miyazawa, and M Asobe, “Simultaneous 25GHz-spaced DWDM wavelength conversion of 1.03Tbit/s (103×10Gbit/s) signals in ... (b) The reason behind this phase mismatch is that, in real fibersk(3ω) ≠3k(ω) so any difference like (3ω −3k) is called as phase mismatch The phase mismatch can also be understoodas the mismatch...
  • 4
  • 298
  • 0
Báo cáo y học:

Báo cáo y học: "Prescription profile of potentially aristolochic acid containing Chinese herbal products: an analysis of National Health Insurance data in Taiwan between 1997 and 2003." ppsx

Báo cáo khoa học

... investigation of the 2004 database found an alarming number of cases of CHPs containing AA herbs (Tianxianteng or Madouling) prescribed after the ban was announced on November 2003 We found a total of ... Containing trace amounts of AA [29,30], Radix et Rhizoma Asari (Xixin) is banned [19,31] but still available in Mainland China, Taiwan, Japan and Korea [32] The CHPs currently covered by the National ... Bureau of Food and Drug Analysis in Taiwan is mandated to regularly monitor AA-containing Chinese herbal products (AA-CHPs) in the market by quantitative and qualitative analysis Substitution of...
  • 6
  • 335
  • 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell

A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell

Môi trường

... into account convection and diffusion of different species in the channel as well as in the porous gas diffusion layer, heat transfer in the solids as well as in the gases, and electrochemical ... total displacement and the degree of the deformation in membrane are directly related to the increasing of ambient temperature and decreasing of relative humidity, due to increasing of heat generation ... are required to relate the level of over- and undersaturation as well as the amount of liquid water present to the amount of water undergoing phase change In the present work, the procedure of...
  • 16
  • 727
  • 0
A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA

A discourse analysis of english oscar acceptance speeches delivered by film award winners in the USA

Khoa học xã hội

... covers a broad domain Thus, there are some interesting points that need deeper research : An investigation into speech acts in EOASs An investigation into thematisation in EOASs More study on word ... choice and syntactic features of EOASs? What are the discourse characteristics of EOASs in term of cohesive devices and stylistic devices? What are the implications drawn from the analysis of EOASs ... the findings: synthesize the findings and draw conclusion - Putting forwards some implications 3.5 DATA ANALYSIS On the basis of 100 EOASs, the data will be investigated into some discourse features...
  • 13
  • 851
  • 1
A contrastive analysis of linguistic features of the adjective black in english and đen in vietnamese

A contrastive analysis of linguistic features of the adjective black in english and đen in vietnamese

Khoa học xã hội

... addition, the source of data as well as data analysis are also mentioned And in Chapter Four the findings of the research on the semantic and pragmatic features of the adjectives Black and Đen are presented ... using a statistical package for the same tasks 11 12 CHAPTER METHODOLOGY AND PROCEDURES - Examining the pragmatic features of the adjectives Black and Đen - Giving contrastive analysis of Black and ... fields as well as pragmatic features of the adjectives of Black and Đen The finding of the study may be in one way or another beneficial to the language learners since it provides a good background...
  • 13
  • 1,921
  • 5
A discourse analysis of advertisements in english and vietnamese on the internet

A discourse analysis of advertisements in english and vietnamese on the internet

Khoa học xã hội

... suggests that the analysis of discourse is, necessarily the analysis of language in use [ 17] , [26] 2.2.2 Overview of Advertising on the Internet 2.2.2.1 Definition of Advertising Especially, a definition ... strongly that he falls I’m a man 11 He stands up and takes dirt off his I spell m -a- n man clothes Talk “We can have a baby Nissan Maxima The forward sponsored 21 22 Class Innovation for daddy, Lastly ... found in Vietnamese ads on the internet structures to ensure the beat and rhythm of the syntagm in the ads in As in Metalingual function, we realized that English ads the two languages employed the...
  • 15
  • 2,309
  • 3
A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese

A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese

Khoa học xã hội

... fields as well as pragmatic features of the WDBs The finding of the pragmatic features of the WDBs leads both teachers and learners of study may be in one way or another beneficial to the language ... denotation is a part of the According to Crystal [3, p.346-3 47] , semantic field is defined meaning of a word or phrase that relates it to phenomena in the real as the view that vocabulary of a language ... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body and spirit As Analysis of the Semantic and Pragmatic...
  • 13
  • 1,702
  • 5
A discourse analysis of presuppositions in the declaration of independence made by president ho chi minh = phân tích diễn ngôn các tiền giả định trong tuyên ngôn độc lập của chủ tịch hồ chí minh

A discourse analysis of presuppositions in the declaration of independence made by president ho chi minh = phân tích diễn ngôn các tiền giả định trong tuyên ngôn độc lập của chủ tịch hồ chí minh

Khoa học xã hội

... War II was in the final stage World War II was the war between two factions: the Allies including Britain, France, America and Russia, and the Fascism including Japan, Germany and Italy The Fascists ... is that the statement in the Declaration of Independence of the United States of America was understood in some way; however the original sense was not made in a “broad” way As known, the declaration ... colony, that they had civilized this land and that returning was a matter of course, particularly after the Japanese had been defeated All the situations above are what president Ho Chi Minh assumes...
  • 47
  • 1,467
  • 8
An analysis of nouns formed by suffixes in english   a case study of the textbook solutions   pre intermedite

An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite

Khoa học xã hội

... The suffix can attach to practically any adjective, and apart from 13 adjectival base words we find nouns as in “thingness”, pronouns as in “usness” and frequently phrases as in “all-or-nothing-ness” ... about an interesting theme It supplies for learners a large of vocabulary and grammar There are many reading texts and basing on these reading texts, learners have the chance to know about the ... female humans and animals Eg:  Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia  Lioness (Noun): a female lion 15 g/ The...
  • 63
  • 988
  • 3
A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

Kinh tế - Quản lý

... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... but there exists a wide range of meanings The specific modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysis of the meanings ... the constraint of L1 or the borrowing of a first language pattern or rule that leads to an error or inappropriate form in L2 As one of the goals of CA is the effective teaching and the learning...
  • 56
  • 2,601
  • 19
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf

Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf

Sức khỏe trẻ em

... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... domains and between the domains and the total score at baseline, at endpoint after the placebo-controlled period, and for the change from baseline to that endpoint Sub-domains At baseline At ... subdomains (see Tables 4, for the loadings) The factor analysis was based on baseline data only The first factor of the 12-factor solution mainly consists of items from the subdomains IRA and TA,...
  • 15
  • 1,153
  • 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Báo cáo khoa học

... described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell gallery was ... which present high AnnexinV-Fluos staining and low propidium-iodide staining are clearly more abundant after treatment with daunorubicin (D) Fig Quantitative determination of the uptake of daunorubicin ... contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline as unique...
  • 7
  • 581
  • 0
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc

Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc

Cao đẳng - Đại học

... with an average increase over 2012-18 of $3.09 per acre (an increase of 0 .7 percent in total operating costs) Soybeans showed the smallest absolute increase ($0.45 per acre) In the absence of the ... long-term analysis we assume the structure of the agricultural economy in the United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... Receipts and Net Farm Income Net farm income declines marginally in the near term Based on the EPA energy price impacts, and including the EITE provisions, we estimate that net farm income would fall...
  • 13
  • 651
  • 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học

... ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC ... substrate The effects of these mutations on RNA-binding and cleavage assays were evaluated A RNA binding assay of the different mutants was performed using native MS, as indicated above In all cases, ... RuizEchevarrı´ a et al [16] Important information on the basic mechanisms of RNA cleavage by RNases can be obtained using minimal RNA substrates [ 17, 18] In the case of the Kid toxin, using the minimal...
  • 14
  • 477
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25