chapter 7 contains a longitudinal analysis of the subset of companies that had participated in the previous study collis 2003 as well as the present survey
... the literature (Tanaka and Asia, 198 4a, 1984b; Jajuga, 1986; Tanaka, 19 87; Tanaka and Watada, 1988; Tanaka et al 1989; Chen, 1988; Diamond, 1988) Later on, the advances in theory have been made ... used in this analysis is approximately 27NT$/lUS$ in 1995 Such a normalized cost database, representing a large-scale calibrated effort to integrate the nationwide baseline information of wastewater ... Cost information associated with 48 domestic wastewater treatment plants and 29 industrial wastewater treatment plants was collected and included inthe cost database within a thorough investigation...
... Asia Southeast Asia includes a group of countries consisting of Singapore Malaysia, Thailand, Indonesia and Philippines while Northeast Asia comprises of Korea, Japan, China, Hong Kong, Macau and ... and Kansai), China (Beijing Capital, Shanghai), Taiwan (Chiang Kai-Shek), Macau, Malaysia (Kuala Lumpur), Indonesia (Soekarno-Hatta), Thailand (Bangkok) and Philippines (Ninoy Aquino) 2.2.2 The ... flights that carry passengers and cargo, this study thus uses total terminal area asa proxy to the amount of physical capital used in an airport 24 Chapter Cargo Traffic Performances at East Asian...
... learners ofthe second language to avoid making errors and use the language as natively as their mother tongue Aims ofthestudy This thesis aims at: - giving a general theoretical background of ... planet Many other anaphoras can be found inthe text asinthe following example: Today I say to you thatthe challenges we face are real They are serious and they are many They will not be met easily ... particular features of language use and characteristics of this type of writing in Vietnamese Asa matter of fact, many learners of English often transfer their ideas in Vietnamese to the target...
... something can perhaps be seen asa failure to activate suitable metaphors at the conceptual level a failure to assimilate the new to the already existing Many of todays standard meaning of words and ... arguing that it was public acceptance of President Bushs use of metaphor inthe rhetoric leading up to the crisis that actually generated war inthe Gulf rather than avoidance of war and a continuation ... occurrences of each lexeme Thus, for example, the string increa was searched for, in order to turn up all occurrences 24 of increase, increasing, increases and increased The results of this analysis are...
... speaker and the second the gender ofthe other speaker, i.e FF, FM, MF, MM The task remains the same: given the transcript ofa conversation side, classify it according to the appropriate category ... is a task much harder than the binary classification we hadin subsection 4.1, because given only the transcript ofa conversation side we must make inferences about the gender ofthe current as ... current aswellasthe other conversation side We have used SVMs asthe learning method In their basic formulation, SVMs are binary classifiers (although there has been recent work on multi-class SVMs)...
... August 2008 Data regarding cardiac, gastrointestinal, endocrine, airway, auditory, and feeding abnormalities have been collected and incedences and comorbidites of these traits has been examined ... expressions include a small mandible, protruding tongue, and a flattened nasal bridge These traits may affect the feeding, breathing, and swallowing of individuals with DS Because some complications may ... K!E3 >7" T`"+_@"D2>"!;D:;8@"1!89":4 87> 75"D 775 !;E"@8>:87E !7@ ":;5":8" 47: @8"812"?!@!8@IIIIIIIIIIIIII WV" K!E3 >7" OX`"+_@"D2>"!;D:;8@"1!89":4 87> 75"D 775 !;E"@8>:87E !7@ "!;"8 97" C >7@ 7;G7"2>":F @7; G7"2D":" @7? 7 >7" ,0":F;2>
... beams, and also ensured thatnonlinear interaction ofthe two signals occurred only inthe applied fiber The peak power ofthe pump into thefiber was -10 dBm, while the power ofthe signal was In ... J Yamawaku, H Takara, T Ohara, K Sato, A Takada, T Morioka, O Tadanaga, H Miyazawa, and M Asobe, “Simultaneous 25GHz-spaced DWDM wavelength conversion of 1.03Tbit/s (103×10Gbit/s) signals in ... (b) The reason behind this phase mismatch is that, in real fibersk(3ω) ≠3k(ω) so any difference like (3ω −3k) is called as phase mismatch The phase mismatch can also be understoodas the mismatch...
... investigation ofthe 2004 database found an alarming number of cases of CHPs containing AA herbs (Tianxianteng or Madouling) prescribed after the ban was announced on November 2003 We found a total of ... Containing trace amounts of AA [29,30], Radix et Rhizoma Asari (Xixin) is banned [19,31] but still available in Mainland China, Taiwan, Japan and Korea [32] The CHPs currently covered by the National ... Bureau of Food and Drug Analysisin Taiwan is mandated to regularly monitor AA-containing Chinese herbal products (AA-CHPs) inthe market by quantitative and qualitative analysis Substitution of...
... into account convection and diffusion of different species inthe channel aswellasinthe porous gas diffusion layer, heat transfer inthe solids aswellasinthe gases, and electrochemical ... total displacement and the degree ofthe deformation in membrane are directly related to the increasing of ambient temperature and decreasing of relative humidity, due to increasing of heat generation ... are required to relate the level of over- and undersaturation aswellasthe amount of liquid water present to the amount of water undergoing phase change Inthepresent work, the procedure of...
... covers a broad domain Thus, there are some interesting points that need deeper research : An investigation into speech acts in EOASs An investigation into thematisation in EOASs More study on word ... choice and syntactic features of EOASs? What are the discourse characteristics of EOASs in term of cohesive devices and stylistic devices? What are the implications drawn from theanalysisof EOASs ... the findings: synthesize the findings and draw conclusion - Putting forwards some implications 3.5 DATA ANALYSIS On the basis of 100 EOASs, the data will be investigated into some discourse features...
... addition, the source of data aswellas data analysis are also mentioned And inChapter Four the findings ofthe research on the semantic and pragmatic features ofthe adjectives Black and Đen are presented ... using a statistical package for the same tasks 11 12 CHAPTER METHODOLOGY AND PROCEDURES - Examining the pragmatic features ofthe adjectives Black and Đen - Giving contrastive analysisof Black and ... fields aswellas pragmatic features ofthe adjectives of Black and Đen The finding ofthestudy may be in one way or another beneficial to the language learners since it provides a good background...
... suggests thattheanalysisof discourse is, necessarily theanalysisof language in use [ 17] , [26] 2.2.2 Overview of Advertising on the Internet 2.2.2.1 Definition of Advertising Especially, a definition ... strongly that he falls I’m a man 11 He stands up and takes dirt off his I spell m -a- n man clothes Talk “We can have a baby Nissan Maxima The forward sponsored 21 22 Class Innovation for daddy, Lastly ... found in Vietnamese ads on the internet structures to ensure the beat and rhythm ofthe syntagm inthe ads inAsin Metalingual function, we realized that English ads the two languages employed the...
... fields aswellas pragmatic features ofthe WDBs The finding ofthe pragmatic features ofthe WDBs leads both teachers and learners ofstudy may be in one way or another beneficial to the language ... denotation is a part ofthe According to Crystal [3, p.346-3 47] , semantic field is defined meaning ofa word or phrase that relates it to phenomena inthe real asthe view that vocabulary ofa language ... important and significant characteristics ofthe WDBs Asa result, the topic A Contrastive animals that nature has provided to feed both our body and spirit AsAnalysisofthe Semantic and Pragmatic...
... War II was inthe final stage World War II was the war between two factions: the Allies including Britain, France, America and Russia, and the Fascism including Japan, Germany and Italy The Fascists ... is thatthe statement inthe Declaration of Independence ofthe United States of America was understood in some way; however the original sense was not made ina “broad” way As known, the declaration ... colony, that they had civilized this land and that returning was a matter of course, particularly after the Japanese had been defeated All the situations above are what president Ho Chi Minh assumes...
... The suffix can attach to practically any adjective, and apart from 13 adjectival base words we find nouns asin “thingness”, pronouns asin “usness” and frequently phrases asin “all-or-nothing-ness” ... about an interesting theme It supplies for learners a large of vocabulary and grammar There are many reading texts and basing on these reading texts, learners have the chance to know about the ... female humans and animals Eg: Lion (Noun): a large powerful animal ofthe cat family that hunts in group and lives in parts of Africa and southern Asia Lioness (Noun): a female lion 15 g/ The...
... in language B He considers CA asa form of interlanguage study and asa central and substantial component of applied linguistics Asa matter of fact, CA has had much to offer to practical teaching ... but there exists a wide range of meanings The specific modal ina certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysisofthe meanings ... the constraint of L1 or the borrowing ofa first language pattern or rule that leads to an error or inappropriate form in L2 As one ofthe goals of CA is the effective teaching and the learning...
... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item inthat sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... domains and between the domains and the total score at baseline, at endpoint after the placebo-controlled period, and for the change from baseline to that endpoint Sub-domains At baseline At ... subdomains (see Tables 4, for the loadings) The factor analysis was based on baseline data only The first factor ofthe 12-factor solution mainly consists of items from the subdomains IRA and TA,...
... described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell gallery was ... which present high AnnexinV-Fluos staining and low propidium-iodide staining are clearly more abundant after treatment with daunorubicin (D) Fig Quantitative determination ofthe uptake of daunorubicin ... contrast and fluorescence photographs of selected field of cells obtained under the same magnification and contrast acquisition characteristics, and using the autofluorescence ofthe anthracycline as unique...
... with an average increase over 2012-18 of $3.09 per acre (an increase of 0 .7 percent in total operating costs) Soybeans showed the smallest absolute increase ($0.45 per acre) Inthe absence ofthe ... long-term analysis we assume the structure ofthe agricultural economy inthe United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... Receipts and Net Farm Income Net farm income declines marginally inthe near term Based on the EPA energy price impacts, and including the EITE provisions, we estimate that net farm income would fall...
... ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC ... substrate The effects of these mutations on RNA-binding and cleavage assays were evaluated A RNA binding assay ofthe different mutants was performed using native MS, as indicated above In all cases, ... RuizEchevarrı´ a et al [16] Important information on the basic mechanisms of RNA cleavage by RNases can be obtained using minimal RNA substrates [ 17, 18] Inthe case ofthe Kid toxin, using the minimal...