universal plug and play a technology introduced in 1999 by
![dictionary of e-business [electronic resource] a definitive guide to technology and business terms](https://media.store123doc.com/images/document/14/y/mw/small_mwq1401352273.jpg)
dictionary of e-business [electronic resource] a definitive guide to technology and business terms
... frequency band and was also used in South America, Far East, and in the Asia Pacific region including Australia and New Zealand In the Asia Pacific country of Japan, NTT’s MCS system was the first ... of a company using balance sheets and profit and loss 35 Anonymous class accounts, and may also make certain forecasts regarding growth It is typically used by business analysts and investors and ... creating ActiveX controls that may also be created using the: • C++ programming language • Java programming language • Visual Basic programming language (See Active X Control, Java, and Visual...
- 379
- 3,486
- 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf
... database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech recognition language ... Systems In Proceedings of the 40th ACL pp 376-383 Michael Johnston and Srinivas Bangalore 2005 Finitestate Multimodal Integration and Understanding Journal of Natural Language Engineering 11.2 Cambridge ... pointing gestures made on the display, and handwritten inputs, are all passed to a multimodal understanding server which uses finite-state multimodal language proc379 Evaluation After designing...
- 8
- 585
- 0
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc
... could also improve recall For example, Q245 What city in Australia has rain forests? it answered correctly, but the transcription What city in Australia has rainforests (without a space), got no answers ... story In Proc Content-Based Multimedia Information Access Conf., apr J Kupiec, D Kimber, and V Balasubramanian 1994 Speech-based retrieval using semantic co-occurrence filtering In Proc ARPA Human ... Table contains a random sample The primary function of this training feature in NaturallySpeaking is to add new words to the lexicon; the nature of the other adaptations is not clearly documented...
- 4
- 276
- 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot
... in passing that although collapsing multilinear data-structures onto a single tier increases the likeliness of combinatorial explosion in processing when using the two-level a u t o m a t a as ... phonological research undertaken in the tone sequence paradigm The handling of accentuation and phrmsing by the generator resembles the syntacto-semantic approaches Only a few tags such as emphasis ... between intonational phra~ses (IP), are inserted by the generator in between words and these T and B are then mapped to GToBI labels (German Tones and Break Indices- (Grice et al 96)) or discarded...
- 5
- 498
- 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc
... levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis and Diagnosis Human analysis is crucial in the ... reference and two candidate translations (boldface and underline indicate nonmatched items in candidate and 2, respectively) Similarly, metrics in another category measure the edit distance of a translation, ... Nizar Habash, and Mona Diab 2007 Semi-Automatic Error Analysis for Large-Scale Statistical Machine Translation Systems In Proc of the MT Summit XI, Copenhagen, Denmark Maja Popovi´ and Hermann...
- 6
- 453
- 0
Lab 3.1.5 Configuring a Serial Interface
... the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details discovered by issuing this ... the name and passwords for Router a On Router 1, enter the global configuration mode and configure the hostname as shown in the chart b Configure the console, virtual terminal and enable passwords ... combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface...
- 5
- 341
- 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx
... the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface ... Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following ... logoff by typing exit Turn the router off Remove and store the cables and adapter 3-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1.5 Copyright 2003, Cisco Systems, Inc Erasing and reloading...
- 5
- 535
- 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc
... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface ... show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line ... Inc Erasing and reloading the router Enter into the privileged exec mode by typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the...
- 6
- 368
- 0
Tài liệu Troubleshooting a Serial Interface doc
... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface ... show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line ... Inc Erasing and reloading the router Enter into the privileged exec mode by typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the...
- 6
- 275
- 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt
... the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface ... Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following ... logoff by typing exit Turn the router off Remove and store the cables and adapter 3-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1.5 Copyright 2003, Cisco Systems, Inc Erasing and reloading...
- 5
- 431
- 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf
... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface ... show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line ... Inc Erasing and reloading the router Enter into the privileged exec mode by typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the...
- 6
- 323
- 0
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt
... trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classified to determine ... high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial EEG data at channel ... principal components analysis) is learned using training data and is subsequently applied to the EEG data when the system is being used Fourth, the data vectors obtained for each channel and a given...
- 6
- 551
- 0
Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx
... cấu tạo giống 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ Mạch ASIC ( Application Specific Integrated Circuit ): não ổ đ a Flash USB Nó gồm có xử lý trung tâm 50 MHz ARM7 RISC, quản lý toàn chuyện ghi ... đoạn hư NAND Flash: chip, có nhớ lưu trữ liệu từ 256 MB đến GB có Flash usb lên đến 16 GB thông dụng có giá thành cao, 200 USD Hiện có nhiều loại flash memory khác co loại chip NAND thông dụng ... NAND thông dụng rẻ 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ Sau lớp ổ đ a, gồm có phần sau: Một mạch in ( printed circuit board ) đựoc hàn chung với nhớ ổ đ a nhiều thành phần khác Các nhà sản xuất...
- 19
- 471
- 1
AN1157 a serial bootloader for PIC24F devices
... memory: program Flash, data EEPROM and Configuration bits Additionally, there are commands for special operations, such as repeating the last command, replicating the data and resetting the device ... Microchip Technology Inc Data EEPROM Operations Some PIC24F devices have built -in data Flash memory EEPROM The bootloader allows data Flash to be read and erased at a word level, bytes at a time Erases ... contains one command and its associated data The commands are detailed in Appendix A: “PIC24F Serial Bootloader Command Summary” COMMAND RESPONSE LATENCY Flow control is built into the protocol...
- 26
- 532
- 0
Serial Interface (SCI)
... use as a counter A CR (Carriage Return) code and a LF (Line Feed) code are transmitted to effect a line feed after each line of data has printed The CR and LF are represented by H'0D and H' 0A, ... http://resource.renesas.com Page 142 What are the characteristics of serial data input/output compared with that of parallel data? Enter an appropriate word in parentheses Answer It takes (longer) time for inputting/outputting ... PC by an RS-232C interface as shown below to carry out debugging using a monitor program and HTERM software In this setup, characters (ASCII code) can be transferred between the PC and SCI channel...
- 18
- 289
- 0
Serial Interface to PIC
... in many technical manuals on web and may be referred for in depth information [44–46] 4.3 Displaying Data on HyperTerminal RS232 (single-ended) communication with PC was introduced way back in ... of sharewares which is doing the same things The download URLs are given in the references [41, 42] In fact they have more capabilities than that included in MS Windows [43] The main advantage ... size and requires no external capacitors The applications developed in this chapter resorts to MAX-232 for achieving compatibility Online tutorials for indepth information regarding the RS-232 and...
- 10
- 271
- 0
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt
... were indexed in a way that retained their internal tree structure, while multilingual files can easily be handled during indexing and searching phases; S Whittaker and M Walker 1991 Toward a theory ... application needs had to be taken into consideration The main goal was to develop a text-based search engine module capable of handling files in the xml format and accessed by local and remote users ... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating...
- 4
- 294
- 0
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx
... that it can be directly touched and manipulated to create a feeling of warmth and closeness On hearing a greeting or being called by its name, the IFR opens its eyes and enters a state that can ... program database Response statements to input statements may take various forms depending on the patterns and current circumstances, and they are here generated by taking into account slot information, ... by pattern matching in units of morphemes and the meaning ascribed beforehand to that statement is obtained An example of such pattern is shown in Figure using the metacharacters listed in Table...
- 4
- 271
- 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA ... GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in X/preC ... System 9700; Applied Biosystems) and in a 10 μl reaction volume containing 0.5 U LA Taq (TaKaRa) The primers were WA-R and WA-L (Table 2) The cycling conditions were initial denaturation at 95°C for...
- 7
- 404
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008