transformation of a pattern and gradient
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... (lane 3) Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes ... University Animal Care and Use Committee Cell lines Cultures of normal and immortalized keratinocytes, dermal fibroblasts, melanocytes and melanoma cells were carried out according to standard protocols...
- 11
- 475
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... fraction is designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred ... assembly of an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization of a series of respiration-deficient...
- 9
- 622
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, ... as means ± standard error, n ¼ Lys[Z(NO2)]-Val, Lys(4-nitrobenzyloxycarbonyl)-Val Compound Bip-[3H]Pro uptake (%) Control Gly Gly-Sar Bip-Pro Ala-Ala Pro-Ala Lys-Lys Ala-Asp D-Phe-Ala Ala-Ala-Ala...
- 10
- 490
- 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt
... based on DNA sequences obtained previously Thus, the sequences of the primers used for 5Â RACE were: 5Â-GGGCATCACGGA AGAAATAG-3Â for a reverse transcription and 5Â-GC TCTAGAGCATTCGTCACATCGATACC-3Â ... purication and characterization of the recombinant pulchellin A- chain Clones of several RIP-2 toxins, such as ricin and abrin have been obtained in other laboratories and shown to From A pulchellus ... enzymatic activity of rPAC Figure shows an Fig Deduced amino acid sequence of recombinant pulchellin A- chain (rPAC) aligned to abrin -a, abrin-c and ricin (RTA) A- chains Conserved amino acids are highlighted...
- 10
- 390
- 0
Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf
... kDa molecular mass range In contrast, the puri®ed plasma BChE showed a faint band at 170 kDa (nonreducible dimer) and a major broad band at 85 kDa (monomer) under reducing conditions (Fig 2A) ... was carried out by anion-exchange Ó FEBS 2002 and af®nity chromatography Axelsen et al reported that decamethonium, used during the last af®nity chromatography step of T californica AChE, was ... Lazar, A. , Kronman, C., Barak, D., Ariel, N., Shaerman, A. , Silman, I & Sussman, J.L (2000) Structures of recombinant native and E202Q mutant human acetylcholinesterase complexed with the snake-venom...
- 8
- 472
- 0
Báo cáo khoa học: Membrane targeting of a folded and cofactor-containing protein potx
... formation of the mutant protein For the in vivo analyses, the RRfiKK exchange was achieved using the primers 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ... dithiothreitol Aggregated material was removed by a final centrifugation at 15 000 g, and the clear supernatant was divided into aliquots and frozen in liquid nitrogen Cofactor tracing and membrane-targeting ... procedure, and time-dependent 55Fe accumulation was monitored The data indicated that only a small amount of 55Fe could be associated with the membrane in the absence of ATP, and addition of ATP enhanced...
- 11
- 419
- 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... dithionite was added gradually to the verdohaem complex under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum ... 2A, a slight decrease in absorbance between 300 and 600 nm (compare spectra a and b) was probably due to the precipitation of free a- hydroxyhaem These observations indicated that a- hydroxyhaem ... Reactions of oxophlorines and their, p radicals J Am Chem Soc 97, 7141–7152 29 Omata, Y., Asada, S., Sakamoto, H., Fukuyama, K & Noguchi, M (1998) Crystallization and preliminary X-ray diffraction...
- 9
- 501
- 0
university of california press from marriage to the market the transformation of womens lives and work aug 2006
... an agenda and set of categories based on one group of men, and the heavy-handed role often given to capitalism in some accounts, can we gain a clear understanding of the profound changes now taking ... time It also shows that behind the familiar story of men’s rapid movement off the land and into work for wages lay a far more gradual process of change, as many old ways of life and labor remained ... rates of African American women and their children are evidence that their own domestic economy was near collapse Urbanization and an Expanding Industrial Economy By 1920, about half of all Americans...
- 311
- 412
- 0
báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx
... eruption, defects of cleft lip and palate as well as any craniofacial anomaly, Class II and Class III buccal occlusions, and hypodontia Only the highest scoring trait is used to assess treatment need ... that affect dental appearance and have an impact on participants' daily lives may not be captured by IOTN In addition, DAI has many more measures of malocclusion affecting the anterior teeth than ... individuals who have a DHC grade of or 5, or grade with an AC of or above All other cases were therefore classified as having no need For DAI, 10 occlusal traits were assessed and a score was obtained...
- 6
- 594
- 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc
... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... Table 2: Missing data, means and end effects for NFAS-4 and NFAS-5 items (N = 3325) Missing % NFAS-4 NFAS-5 Walking/standing Standing Walking less than a kilometre on flat ground Walking than ... Mann Whitney U-test Data quality The response rates and the low levels of missing data show that both versions of the NFAS are acceptable to the population A few items had a high percentage of...
- 9
- 489
- 0
Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx
... coefficient calculated on the basis of the amino acid sequence The purity and the proper tetramer formation of mAbs and mAb-FIs were analyzed by SDS-PAGE in the presence and absence of a reducing agent ... that the variable region of the CCR5mAb in BFFI contributes to the antiviral activity Figure Design and biochemical characterization of BFFI Design and biochemical characterization of BFFI A ... NNTTWEAWDRAIAEYAARIEALIRAAQEQQEKNEAALREL B performed BFFI and CCR5mAb had very similar binding affinity to human CCR5, suggesting that addition of the FI did not alter the binding affinity of the...
- 10
- 341
- 0
Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx
... 0021-9045(88)90006-8 Shah, WM: A generalization of a theorem of Paul Turan J Ramanujan Math Soc 1, 67–72 (1996) Aziz, A, Rather, NA: A refinement of a theorem of Paul Turan concerning polynomials Math Ineq Appl ... Cite this article as: Zireh: On the maximum modulus of a polynomial and its polar derivative Journal of Inequalities and Applications 2011 2011:111 Submit your manuscript to a journal and benefit ... http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial of degree n, having all zeros in the...
- 9
- 423
- 0
Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf
... total circuit and incidental noise is random with a worstcase peak to peak spread of 3.87 mV As the negative and positive excursions are relatively uniform about a mean, EURASIP Journal on Advances ... the case of a hand-held instrument, allows for a “snapshot” of the data stream to be made manually at a time chosen by the operator Use of this additional facility does not interrupt the data stream ... environmental EMR and internal circuit generated noise and furnishes a compact and low cost method for the capture and integrated digital processing of measurement data in a range of situations including...
- 6
- 391
- 0
Step by Step Drawing of a Simple and Funny Cartoon Monkey ppt
... Draw another larger circle that overlaps part of the head circle Add two half circles to the sides of the head to make ears Add an oval to the middle-lower part of the head to show the mouth area ... area Add two little eyes above the oval Step - Body & Arms Draw two long skinny rectangles to form the arms At the eng of the arms draw an egg shape to make the form of the hands When drawing a ... drawing a surface to stand on You can this either by adding a line under the feet of the character, or by drawing a shadow underneath him This places your character 'somewhere' rather than having it...
- 5
- 319
- 0
transformation of knowledge information and data theory and applications
... organizational model, along with a goal model This results in a view of organizational management based on cycles of transformations Typically, we have transformations of organizational models and ... theory and applications in this book are rooted in database schema transformation, as well as in database contents transformation This allows for other transformations, including transformation of ... such as semantics preservation and propagation can be studied rigorously Indeed, the transformational paradigm is particularly suited to database schema manipulation and translation, that are...
- 339
- 806
- 0
Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf
... journal of combinatorics 16 (2009), #R81 For any root θ of µ(G, x), it was shown by Neumaier [6, Corollary 3.3] that the analogue of Gallai’s Lemma holds when G is a tree A different proof was given ... the idea of the proof of Theorem 5.3 in [3], we shall prove the Stability Lemma for trees with any given root of its matching poynomial Note that the Stability Lemma is a weaker statement than Theorem ... Theorem 1.2 If G has a Hamiltonian path, then all roots of its matching polynomial are simple The above is the source of motivation for our work It is natural to ask when does equality holds in...
- 12
- 287
- 0
Báo cáo toán học: "Automorphism groups of a graph and a vertex-deleted subgraph" pot
... Stephen G Hartke and A. J Radcliffe Mckay’s canonical graph labeling algorithm In Communicating Mathematics, volume 479 of Contemporary Mathematics, pages 99–111 American Mathematical Society, ... reconstruction In Handbook a o of combinatorics, Vol 1, 2, pages 1447–1540 Elsevier, Amsterdam, 1995 [Bol01] B´la Bollob´s Random graphs, volume 73 of Cambridge Studies in Advanced e a Mathematics Cambridge ... there exists a graph G and edge e ∈ E(G) so that Aut(G) ∼ Γ1 and Aut(G − e) ∼ Γ2 If a specific graph G = = ∼ Γ1 and Aut(G − x) ∼ Γ2 , the deletion relation may be and subobject x give Aut(G) = =...
- 8
- 268
- 0
báo cáo khoa học: "Colonic perforation resulting from ingested chicken bone revealing previously undiagnosed colonic adenocarcinoma: report of a case and review of literature" ppt
... Pathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City, Kansas, USA 2Pathology and Laboratory Medicine Service, Veterans Affairs Medical Center, Kansas City, Missouri, USA ... The authors thank Mr Dennis Friesen for photographic assistance, Ms Peggy Knaus for secretarial assistance, and Ms Inga Barringer for translation assistance Author details Department of Pathology ... segmental resection Authors’ information Douglas H McGregor is Professor of Pathology at the University of Kansas Medical Center and Director of Surgical Pathology at the Kansas City Veterans Affairs...
- 4
- 309
- 0
báo cáo khoa học: "Metastatic eccrine porocarcinoma: report of a case and review of the literature" pptx
... Arapakis I, Kayser G, et al: Eccrine porocarcinoma of the ear mimicking basaloid squamous cell carcinoma Otolaryngol Head Neck Surg 2006, 135:158-160 Shiohara J, Koga H, Uhara H, Takata M, Saida ... porocarcinoma (malignant eccrine poroma): a clinicopathologic study of 69 cases Am J Surg Pathol 2001, 25:710-720 McMichael AJ, Gay J: Malignant eccrine poroma in an elderly AfricanAmerican woman ... from a preexisting lesion as degenerative progression, and it can manifest clinically as a solitary lesion with non characteristic macroscopic appearance, as an ulcerated nodule or as a plaque,...
- 4
- 404
- 0
Báo cáo khoa học: "Malignant inguinal monophasic synovial sarcoma: report of a case and review of the literature" potx
... Wada T, Ida K, Sato Y, Nagoya S, Tsukahara T, Kimura S, Sahara H, Ikeda H, Shimozawa K, Asanuma H, Torigoe T, Hiraga H, Ishii T, Tatezaki SI, Sato N, Yamashita T: Phase I vaccination trial of ... Berean KW: Intraneural biphasic synovial sarcoma: an alternative “glandular” tumor of peripheral nerve Mod Pathol 1996, 9:738-741 Page of 18 Naito N, Ozaki T, Kunisada T, Kawai A, Dan’ura T, ... in patients with disseminated synovial sarcoma J Transl Med 2005, 3:1-9 27 Ishibe T, Nakayama T, Aoyama T, Nakamura T, Toguchida J: Neuronal differentiation of synovial sarcoma and its therapeutic...
- 4
- 394
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25