... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... (lane 3) Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes ... University Animal Care and Use Committee Cell lines Cultures of normal and immortalized keratinocytes, dermal fibroblasts, melanocytes and melanoma cells were carried out according to standard protocols...
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... fraction is designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred ... assembly of an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization ofa series of respiration-deficient...
... based on DNA sequences obtained previously Thus, the sequences of the primers used for 5Â RACE were: 5Â-GGGCATCACGGA AGAAATAG-3Â for a reverse transcription and 5Â-GC TCTAGAGCATTCGTCACATCGATACC-3Â ... purication and characterization of the recombinant pulchellin A- chain Clones of several RIP-2 toxins, such as ricin and abrin have been obtained in other laboratories and shown to From A pulchellus ... enzymatic activity of rPAC Figure shows an Fig Deduced amino acid sequence of recombinant pulchellin A- chain (rPAC) aligned to abrin -a, abrin-c and ricin (RTA) A- chains Conserved amino acids are highlighted...
... kDa molecular mass range In contrast, the puri®ed plasma BChE showed a faint band at 170 kDa (nonreducible dimer) anda major broad band at 85 kDa (monomer) under reducing conditions (Fig 2A) ... was carried out by anion-exchange Ó FEBS 2002 and af®nity chromatography Axelsen et al reported that decamethonium, used during the last af®nity chromatography step of T californica AChE, was ... Lazar, A. , Kronman, C., Barak, D., Ariel, N., Shaerman, A. , Silman, I & Sussman, J.L (2000) Structures of recombinant native and E202Q mutant human acetylcholinesterase complexed with the snake-venom...
... formation of the mutant protein For the in vivo analyses, the RRfiKK exchange was achieved using the primers 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ... dithiothreitol Aggregated material was removed by a final centrifugation at 15 000 g, and the clear supernatant was divided into aliquots and frozen in liquid nitrogen Cofactor tracing and membrane-targeting ... procedure, and time-dependent 55Fe accumulation was monitored The data indicated that only a small amount of 55Fe could be associated with the membrane in the absence of ATP, and addition of ATP enhanced...
... dithionite was added gradually to the verdohaem complex under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum ... 2A, a slight decrease in absorbance between 300 and 600 nm (compare spectra aand b) was probably due to the precipitation of free a- hydroxyhaem These observations indicated that a- hydroxyhaem ... Reactions of oxophlorines and their, p radicals J Am Chem Soc 97, 7141–7152 29 Omata, Y., Asada, S., Sakamoto, H., Fukuyama, K & Noguchi, M (1998) Crystallization and preliminary X-ray diffraction...
... an agenda and set of categories based on one group of men, and the heavy-handed role often given to capitalism in some accounts, can we gain a clear understanding of the profound changes now taking ... time It also shows that behind the familiar story of men’s rapid movement off the land and into work for wages lay a far more gradual process of change, as many old ways of life and labor remained ... rates of African American women and their children are evidence that their own domestic economy was near collapse Urbanization and an Expanding Industrial Economy By 1920, about half of all Americans...
... eruption, defects of cleft lip and palate as well as any craniofacial anomaly, Class II and Class III buccal occlusions, and hypodontia Only the highest scoring trait is used to assess treatment need ... that affect dental appearance and have an impact on participants' daily lives may not be captured by IOTN In addition, DAI has many more measures of malocclusion affecting the anterior teeth than ... individuals who have a DHC grade of or 5, or grade with an AC of or above All other cases were therefore classified as having no need For DAI, 10 occlusal traits were assessed anda score was obtained...
... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... Table 2: Missing data, means and end effects for NFAS-4 and NFAS-5 items (N = 3325) Missing % NFAS-4 NFAS-5 Walking/standing Standing Walking less than a kilometre on flat ground Walking than ... Mann Whitney U-test Data quality The response rates and the low levels of missing data show that both versions of the NFAS are acceptable to the population A few items had a high percentage of...
... coefficient calculated on the basis of the amino acid sequence The purity and the proper tetramer formation of mAbs and mAb-FIs were analyzed by SDS-PAGE in the presence and absence ofa reducing agent ... that the variable region of the CCR5mAb in BFFI contributes to the antiviral activity Figure Design and biochemical characterization of BFFI Design and biochemical characterization of BFFI A ... NNTTWEAWDRAIAEYAARIEALIRAAQEQQEKNEAALREL B performed BFFI and CCR5mAb had very similar binding affinity to human CCR5, suggesting that addition of the FI did not alter the binding affinity of the...
... 0021-9045(88)90006-8 Shah, WM: A generalization ofa theorem of Paul Turan J Ramanujan Math Soc 1, 67–72 (1996) Aziz, A, Rather, NA: A refinement ofa theorem of Paul Turan concerning polynomials Math Ineq Appl ... Cite this article as: Zireh: On the maximum modulus ofa polynomial and its polar derivative Journal of Inequalities and Applications 2011 2011:111 Submit your manuscript to a journal and benefit ... http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial of degree n, having all zeros in the...
... total circuit and incidental noise is random with a worstcase peak to peak spread of 3.87 mV As the negative and positive excursions are relatively uniform about a mean, EURASIP Journal on Advances ... the case ofa hand-held instrument, allows for a “snapshot” of the data stream to be made manually at a time chosen by the operator Use of this additional facility does not interrupt the data stream ... environmental EMR and internal circuit generated noise and furnishes a compact and low cost method for the capture and integrated digital processing of measurement data in a range of situations including...
... Draw another larger circle that overlaps part of the head circle Add two half circles to the sides of the head to make ears Add an oval to the middle-lower part of the head to show the mouth area ... area Add two little eyes above the oval Step - Body & Arms Draw two long skinny rectangles to form the arms At the eng of the arms draw an egg shape to make the form of the hands When drawing a ... drawing a surface to stand on You can this either by adding a line under the feet of the character, or by drawing a shadow underneath him This places your character 'somewhere' rather than having it...
... organizational model, along with a goal model This results in a view of organizational management based on cycles of transformations Typically, we have transformations of organizational models and ... theory and applications in this book are rooted in database schema transformation, as well as in database contents transformation This allows for other transformations, including transformationof ... such as semantics preservation and propagation can be studied rigorously Indeed, the transformational paradigm is particularly suited to database schema manipulation and translation, that are...
... journal of combinatorics 16 (2009), #R81 For any root θ of µ(G, x), it was shown by Neumaier [6, Corollary 3.3] that the analogue of Gallai’s Lemma holds when G is a tree A different proof was given ... the idea of the proof of Theorem 5.3 in [3], we shall prove the Stability Lemma for trees with any given root of its matching poynomial Note that the Stability Lemma is a weaker statement than Theorem ... Theorem 1.2 If G has a Hamiltonian path, then all roots of its matching polynomial are simple The above is the source of motivation for our work It is natural to ask when does equality holds in...
... Stephen G Hartke and A. J Radcliffe Mckay’s canonical graph labeling algorithm In Communicating Mathematics, volume 479 of Contemporary Mathematics, pages 99–111 American Mathematical Society, ... reconstruction In Handbook a o of combinatorics, Vol 1, 2, pages 1447–1540 Elsevier, Amsterdam, 1995 [Bol01] B´la Bollob´s Random graphs, volume 73 of Cambridge Studies in Advanced e a Mathematics Cambridge ... there exists a graph G and edge e ∈ E(G) so that Aut(G) ∼ Γ1 and Aut(G − e) ∼ Γ2 If a specific graph G = = ∼ Γ1 and Aut(G − x) ∼ Γ2 , the deletion relation may be and subobject x give Aut(G) = =...
... Pathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City, Kansas, USA 2Pathology and Laboratory Medicine Service, Veterans Affairs Medical Center, Kansas City, Missouri, USA ... The authors thank Mr Dennis Friesen for photographic assistance, Ms Peggy Knaus for secretarial assistance, and Ms Inga Barringer for translation assistance Author details Department of Pathology ... segmental resection Authors’ information Douglas H McGregor is Professor of Pathology at the University of Kansas Medical Center and Director of Surgical Pathology at the Kansas City Veterans Affairs...
... Arapakis I, Kayser G, et al: Eccrine porocarcinoma of the ear mimicking basaloid squamous cell carcinoma Otolaryngol Head Neck Surg 2006, 135:158-160 Shiohara J, Koga H, Uhara H, Takata M, Saida ... porocarcinoma (malignant eccrine poroma): a clinicopathologic study of 69 cases Am J Surg Pathol 2001, 25:710-720 McMichael AJ, Gay J: Malignant eccrine poroma in an elderly AfricanAmerican woman ... from a preexisting lesion as degenerative progression, and it can manifest clinically as a solitary lesion with non characteristic macroscopic appearance, as an ulcerated nodule or as a plaque,...
... Wada T, Ida K, Sato Y, Nagoya S, Tsukahara T, Kimura S, Sahara H, Ikeda H, Shimozawa K, Asanuma H, Torigoe T, Hiraga H, Ishii T, Tatezaki SI, Sato N, Yamashita T: Phase I vaccination trial of ... Berean KW: Intraneural biphasic synovial sarcoma: an alternative “glandular” tumor of peripheral nerve Mod Pathol 1996, 9:738-741 Page of 18 Naito N, Ozaki T, Kunisada T, Kawai A, Dan’ura T, ... in patients with disseminated synovial sarcoma J Transl Med 2005, 3:1-9 27 Ishibe T, Nakayama T, Aoyama T, Nakamura T, Toguchida J: Neuronal differentiation of synovial sarcoma and its therapeutic...