... ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, a large amount ofthe available surface area ofthe molecule is buried upon pentamerization, increasing the stability ofthe ... cloning site The forward oligomer 5¢-TCCGAAACCAGCGGCCGCTT TATCGCGTTAAAACCGGTGATCAAACCCC-3¢ andthe reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ were used to introduce a Not1 site ... the resulting gene was removed using the complementary oligomers 5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAAT TATCGCCCCTCCCGCC-3¢ (reverse) Virus amplification...
... each primer 50 lM CM-AAT1 was amplified by using RSB-5¢: 5¢-CAAAGAGCACCCTCATTCCAGCC-3¢, and FSD-3¢: 5¢-AGGAGGCAAGCATAGACTTAACG-3¢; CM-AAT2 was amplified with RSB-5¢ and FSA-3¢: 5¢-GATAATT CCACACCCTCCAATTA-3¢; ... the same activity CM-AAT1 is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the same substrates CM-AAT1 has the same enzyme activity as a strawberry ... ofthe same family RESULTS AND DISCUSSION Sequence analysis Both CM-AAT1 and CM-AAT2 encode proteins of 461 amino acids with a theoretical molecular mass of 51.5 kDa and 51.8 anda pI ofand 8.5,...
... accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢ The incorporation of mutations was verified by DNA ... E19 0A, 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E19 4A, 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; ... Journal compilation ª 2008 FEBS L M F Mendonca and S R Marana ¸ Following the characterization ofthe binding of different types of aglycone, a comparative analysis ofthe mutational effect on their...
... turn, alter the catalytic activity ofthe complex The mutation could also affect the binding ofthe ISP to the bc1 complex and distort the Qo site Our data showed that, in the mutant, the bc1 activity ... Instability ofthe mutant enzyme Further analysis ofthe kinetic parameters ofthe G167E mutant was hindered by rapid inhibition ofthe activity of Fig QH2-cytochrome c reductase activity The assays ... Medical School, Hanover, NH, USA) Fig Optical spectra ofthe wild type and mutant cells Optical spectra ofcell suspensions ofthe wild type (wt) and mutant (G167E) were obtained as described in the...
... 2400 VÆh)1 at a constant power of 18 W, at 10 °C and continuous buffer circulation in a DESAGA VA-200 apparatus (DESAGA, Germany) After separation, the protein bands were cut out andthe gel slices ... For clarity, only the two important regions (NH and aliphatic) ofthe spectra are presented The main differences between the spectral data ofthe E- and Z-configurations are emphasized by the E/Z-difference ... are marked by arrows andthe integrated protein peaks are labeled by arrowheads Z-configuration are resolved in the aliphatic region ofthe difference spectrum Because ofthe height andthe sharpness...
... tracheobronchial tree, nasal mucosa and sweat glands [25] Human tear lipocalin has significant sequence homology with thehuman forms of OBP and, at least in humans, partially shares a similar tissue ... to the same family It is produced by the lachrymal and lingual salivary glands, and has been found to be expressed by several other secretory tissues such as prostate, mucosal glands ofthe tracheobronchial ... where they are inactivated Hence, this mechanism might be considered as an extracellular counterpart ofthe chemical inactivation of HNE that occurs intracellularly via GST and other enzymes that...
... antibody AA5 The action of four separate isolates of tryptase (L1 and L2 from lung and S1 and S2 from skin) was tested on a range of substrates, each at 0.50 mM, and compared with the standard assay ... yielding the input value of Km as Km anda weighted average ofthe input values of kcat as the computed value of kcat (case of Fig 8A) If each form had a different value of Km, however, although the ... we have puried tryptase from both lung and skin tissues, and have compared the kinetics of cleavage ofa range of chromogenic substrates Materials and methods Isolation of lung mast cells Human...
... 5.0 software were as follow: ABCC2 forward: 5'-CTC ACTTCAGCGAGACCG-3'; ABCC2 reverse: 5'-CCAGCCAGTTCAGGGTTT-3'; ACTB forward: 5'-CACCCAGCACAATGAAGAT-3'; ACTB reverse: 5'-CA AATAAAGCCATGCCAAT-3' ... procedures and in the interpretation ofthe data, SXW, XL, TFL and WBX gave advises on the work and helped in the interpretation ofthe data, KTY supervised all the work and wrote the paper together ... Wada M, Kohno K, Nakamura T, Kawabe T, Kawakami M, Kagotani K, Okumura K, Akiyama S, Kuwano M: Ahuman canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant...
... primarily along and about the implant axis Distal migration accounted for 94 to 99% ofthe total translational migration The average absolute rotational migration was smaller than 0.04° in the sagittal ... performed the design and execution ofthe experimental setup and analysis, as well as drafted the manuscript CA executed and analyzed the experiment, performed statistical analsys as well as drafted the ... motion ofa triangular plate that was rigidly attached to the lateral surface ofthe implant through a hole in the cortex The implant motion was calculated from the motion ofthe triangle using a...
... such as GaSb/GaAs [8-10], InAlAs/InP [11], InP/InGaP [12, 13], InP/GaAs [14], GaAsSb/GaAs [15], and InAs/GaSb [16, 17] The reason is that they offer comparatively large bandgap energies and provide ... in Figure 1a, the statistical data indicate that the density ofthe QDs is approximately × 109 cm−2 and that the shape of GaSb QDs is rectangular-shaped which is the same with GaSb/GaAs QDs [9] ... (100) substrate, the AFM and STEM measurements were carried out Figure shows the AFM and STEM images of GaSb/In0.53Ga0.47As QDs andthe histogram ofthe height of GaSb/In0.53Ga0.47As QDs As shown...
... located above a broad band Figure Evolutions ofthe positions ofthe LO3 and TO3 peaks, andthe LO3/TO3 intensity ratio, as a function ofthe annealing temperature Debieu et al Nanoscale Research ... explained by the increase ofthe Si-np density as well as the increase of non-radiative de-excitation channels of both Si-np and Nd3+ The Nd3 + PL intensity is then maximal after annealing at ... generally admitted as the optimal annealing temperature for the PL of Si-np Figure shows the behavior ofthe PL spectra ofthe thin films annealed at 1100 °C as a function ofthe Nd concentration...
... images of GaSb/In0.53Ga0.47As QDs and histogram ofthe height of GaSb/In0.53Ga0.47As QDs (a) The AFM image of GaSb/In0.53Ga0.47As QDs, (b) histogram ofthe height of GaSb/In0.53Ga0.47As QDs, and ... Ga 0.47 As QDs As shown in Figure 1a, the statistical data indicate that the density ofthe QDs is approximately × 109 cm-2 and that the shape of GaSb QDs is rectangular-shaped which is the same ... GaSb/InGaAs QDs on InP (100) substrate, the AFM and STEM measurements were carried out Figure shows the AFM and STEM images of GaSb/ In0.53Ga0.47 As QDs andthe histogram ofthe height of GaSb/In...
... images of GaSb/In0.53Ga0.47As QDs and histogram ofthe height of GaSb/In0.53Ga0.47As QDs (a) The AFM image of GaSb/In0.53Ga0.47As QDs, (b) histogram ofthe height of GaSb/In0.53Ga0.47As QDs, and ... Ga 0.47 As QDs As shown in Figure 1a, the statistical data indicate that the density ofthe QDs is approximately × 109 cm-2 and that the shape of GaSb QDs is rectangular-shaped which is the same ... GaSb/InGaAs QDs on InP (100) substrate, the AFM and STEM measurements were carried out Figure shows the AFM and STEM images of GaSb/ In0.53Ga0.47 As QDs andthe histogram ofthe height of GaSb/In...
... For the synthesis ofthe rare earth-doped SnO2 samples, an aqueous solution ofa rare earth citrate was prepared from a rare earth nitrate (Y and Ce-nitrates, Alfa Aesar, USA, purity [99.9%) and ... h, also in air, to allow the organic material to be completely oxidized and to promote the crystallization ofthe SnO2 phase Sample Characterization The specific surface area ofthe samples was ... was then fed to the reactor containing 150 mg ofthe catalyst The reactants andthe composition ofthe reactor effluent were analyzed with a gas chromatograph (Shimadzu GC 8A) , equipped with a...
... TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA ... ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT S10 0A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA ... collected the normal and OA cartilage and produced the cDNA libraries from femoral cartilage CMR undertook the laboratory work associated with real time PCR analysis ofthe normal and OA cartilage...
... called a base-pair The notation a • b is used to denote that the bases at indices aand b in s are paired to each other A folding (or a secondary structure) of s is a set F of base-pairs ofthe ... than a base-pair in an RNA string Call a pair (A, F), where A is an alignment of an SAF instance S and F is a folding of A, an alignment with folding of S (Figure 17b) Define the score of an alignment ... accelerate the practical running times of different variants of CFG and RNA related algorithms Nevertheless, these techniques either retain the same worst case running times ofthe standard algorithms...
... Figure Characterization ofthe dimerization state and splicing of viral RNA (A) Dimerization analysis of virion RNA Virion RNAs of different proviral constructs were separated on a native agarose ... RNA in the SL1 deletion virion was replaced by host RNA and that the virion maintained an RNA level similar to that of wild type To characterize the cellular RNA packaged into the wildtype and ... mRNA compared to the wild type; 3- to 5-fold less HIV-1 mRNA was associated with the revertant Figure Characterization ofthe association between Gag and HIV-1 RNA (A) Measurement ofthe association...
... plasma membrane component(s) ofthe fungal target and/ or destabilizing the fungal plasma membrane Abad et al (1996) demonstrated that tobacco osmotin could cause membrane leakage and dissipated ... chitinase or in a tobacco class I chitinase caused a great loss of activity (Andersen et al., 1997; Iseli-Gamboni et al., 1998) In addition, mutation of Tyr 123 ofa Zea mays chitinase anda similar ... whereas thaumatin mainly has a basic surface in the cleft region The acidic residues involved in the formation ofthe acidic cleft are three aspartate residues and one glutamate residue, and they...
... out the similarities and differences ofthe two languages in terms of structures and semantics 1.2 AIMS AND OBJECTIVES 1.2.1 Aims ofthe study The study aims at analyzing the structures and semantics ... surfactants Detergent is any ofa group of synthetic, organic, liquid or water-soluble cleaning agents that, unlike soap, are not prepared from fats and oils, are not inactivated by hard water, and ... can make our choices 12 Social role- helping increase productivity and raise the standard of living To the society, advertising can accelerate the growth of economy, and thus improve the standard...
... placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal ... cytokine analysis (MCP-1, TNF -a, IL-6, IL-10, IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ± ... because it may form the basis ofa drug acting in pathological situations involving the overexpression of TNF -a Materials and methods Preparation of rIris, mutant L33 9A andthe cleaved forms of...