... (5' ACTCTAGCTAGCACGGCGCCAACCCGATCCAAGACA 3') and VP22 R8 (5' ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCTGGACCCTCGACGGGCCGTCTGGGGCGAGA 3') Additionally, the gene for PA63 was PCR amplified from pGPA using ... Construction of DNA vaccines The DNA vaccine pGPA contains the signal sequence for human plasminogen activator fused to the N-terminus ofthe gene forthe 63 kDa fragment of PA [19] and was a kind ... we evaluate the potential of VP22 to enhance DNA vaccines against anthrax The spore-forming bacterium Bacillus anthracis causes the disease anthrax The current UK-licensed vaccine is an alum-precipitated...
... years, e.g Data Exchange Wales initiative (DEWi) data, information from primary schools via the transition plan, gender-specific data and the national core data set information Find school data ... learners of all ages and abilities as the classroom will be used by a range of classes In this case, there will need to be both generic material and class-specific space forthe display of learners’ ... same advantages as those described above If they learn a skill through the medium of one language they can, in most cases, transfer that skill to their second language and can certainly talk about...
... H2SO4 and the absorbance was measured at 450 nm Quantification of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay Preparation ... )76) ofthe mouse iNOS promoter plus the downstream 47 base pairs, designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 ... (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as probes for EMSA The oligonucleotides were annealed and labeled with [32P]dCTP[aP] Binding reactions were performed (20 lL ofthe total volume)...
... company chairman and the director (general director) in the case ofa limited liability company; the chairman ofthe board of management and the director (general director) in the case ofa shareholding ... company; all partners in the case ofa partnership; and the owner in the case ofa private enterprise shall be liable forthe truthfulness and accuracy ofthe amount certified as legal capital ... stipulated in the company charter shall apply Unless otherwise stipulated in the company charter, the chairman ofthe members’ council, the company chairman, the chairman ofthe board of management...
... University of Basilicata, V.le dell’Ateneo Lucano, 10, Campus of Macchia Romana, 85100 Potenza, Italy Email: Alberto Cialdea∗ - cialdea@email.it; Vita Leonessa - vita.leonessa@unibas.it; Angelica Malaspina ... Integral representationsfor solutions of some BVPs forthe Lam´ system in multiply connected domains e Alberto Cialdea∗1 , Vita Leonessa1 and Angelica Malaspina1 Department of Mathematics and ... Lifanov IK, Poltavskii LN, Vainikko GM: Hypersingular integral equations and their applications, Volume of Differential and Integral Equations and Their Applications Chapman & Hall/CRC, Boca Raton,...
... University of Basilicata, V.le dell’Ateneo Lucano, 10, Campus of Macchia Romana, 85100 Potenza, Italy Email: Alberto Cialdea∗ - cialdea@email.it; Vita Leonessa - vita.leonessa@unibas.it; Angelica Malaspina ... Integral representationsfor solutions of some BVPs forthe Lam´ system in multiply connected domains e Alberto Cialdea∗1 , Vita Leonessa1 and Angelica Malaspina1 Department of Mathematics and ... Lifanov IK, Poltavskii LN, Vainikko GM: Hypersingular integral equations and their applications, Volume of Differential and Integral Equations and Their Applications Chapman & Hall/CRC, Boca Raton,...
... In fact, there is a whole spectrum of explanatory and pragmatic trials [5] The second level of reporting is related to the appraisal ofthe effect ofthe health service Appraisal means that an ... is based on the levels of assessment and appraisal as shown in Table The appraisal of health care services presumes that preferences can be measured and can be made available to the policy and ... properties ofa therapy but not all therapies may cover the patients’ preferences The obtained information is rather important as the consideration of patients’ preferences was requested as part of evidence-based...
... sequences and NA random variable sequences are the most important and special cases of pairwise NQD random variable sequences, then we have the following results as two corollaries of Theorems 2.1 and ... China Authors’ contributions HH, DW and QW carried out the design ofthe study and performed the analysis QZ participated in its design and coordination All authors read and approved the final manuscript ... Foundation (2010GXNSFA013120) The authors are very grateful to the referees and the editors for their valuable comments and some helpful suggestions that improved the clarity and readability of the...
... independent random variables have been extended to dependent random variables by many authors The concept of negatively associated random variables was introduced by Alam and Saxena [6] and carefully ... negatively associated and negatively dependent random variables and then they proved the case of mean zero by using these results However, this approach is not good Forthe case of negatively associated ... negatively associated random variables Theorem 1.4 Let {Xni, ≤ i ≤ kn, n ≥ 1} be an array of rowwise negatively associated random variables and {an, n ≥ 1} a sequence of nonnegative constants Suppose...
... to thank the referee and the editor for their careful reading ofthe manuscript and their many valuable comments and suggestions The research was supported by the Natural Science Foundation of ... introduced a notion of convex metric space, which is more general space, and each linear normed space is a special example ofthe space Late on, Ciric et al proved the convergence of an Ishikawa type ... Fixed Point Theory and Applications considered the Ishikawa iteration process to approximate the common fixed point of mean nonexpansive mappings in uniformly convex Banach space Takahashi first...
... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...
... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...
... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...
... that the conditional expectation ofa performance future offspring of some animal i ofthe parent population is equal to and the variance given the performances of all the ,i d Y ofa animals ... performances ofthe offspring ofthe candidate for selection The selection criterion (21) is then a true measure ofthe candidate’s value, and can be considered as an approximation ofthe criterion ... expressions are given numerical values after estimates of genetic values and of variance components are available General formulae can be derived that take into account all performances ofthe whole...
... the combination of ipsilateral fracture ofthe elbow and forearm Gausepohl et al [7] reported a case with fracture dislocation ofthe elbow combined with unstable distal forearm fracture ofthe ... neurovascular examination was normal Plain radiographs showed a displaced fracture at the proximal metaphyseal-diaphyseal junction ofthe left humerus and ipsilateral displaced extension type supracondylar ... DP: Management ofthe floating elbow injury in children Simultaneous ipsilateral fractures ofthe elbow and forearm Arch Orthop Trauma Surg 2000, 120:205-208 Gül A, Sambandam S: Ipsilateral proximal...
... of persons with schizophrenia [30], and also because this scale was already part ofthe SfW program in Scandinavia and the feedback from the SfW instructors about the ability ofthe participants ... was defined as a change between - cm and cm, and an increase was defined as cm increase or more For weight a decrease was defined as a loss of at least kg, stable weight was a Page of 12 change ... to play any role here The choice ofthe short-form ofthe SWN scale in this study was governed by the history ofthe scale as it was developed and validated in a clinical trial measuring the subjective...
... group the participant has been randomised to at the end of 12 months treatment At the end ofthe study, these guesses will be compared against chance Statistical analysis Statistical analysis for ... because it is providing an acceptable standard of care In the latter case, the implication might be that better training and support for existing staff is required rather than the formation ofa ... be aware of Costs of time off work will be calculated from the patient’s own account of their salary and normal expectations of overtime and informal care to the depressed patient will be calculated...
... the action ofthe cilia that continue to clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of ... view ofthe foreign body in the supero medial aspect ofthe maxillary sinus Intraoperative endoscopic view ofthe foreign body in the supero medial aspect ofthe maxillary sinus Figure Intraoperative ... left maxillary sinus Computed tomography scan (coronal plane) showing the foreignof the upper first the supero medial aspect ofthe maxillary Figure sinus and partial mucosal thickening of the...