the space time continuum of the special theory of relativity considered as a euclidean continuum
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... Mitochondrial free radical generation, oxidative stress, and aging Free Rad Biol Med 29, 222–230 44 Takasawa, M., Hayakawa, M., Sugiyama, S., Hattori, K., Ito, T & Ozawa, T (1993) Age-associated damage ... replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace, D.C (1997) Mitochondrial DNA in aging and disease...
- 7
- 444
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... 1988 Ajzen I: The theory of planned behaviour Organizational Behaviour and Human Decision Processes 1991, 50:179-211 Armitage CJ, Conner M: Efficacy of the theory of planned behaviour: a meta analytic...
- 9
- 367
- 0
performance of robust controller for dfim when the rotor angular speed is treated as a time-varying parameter
... evaluated with other constant values of as well as with a fast variation of the rotor speed along the parameter range VCCA-2011 controller Figure LFT representation of the system The The weighting ... reads as (21) (27) where is the nominal speed, is the variation of the rotor angular speed around its nominal value, and is the normalizing factor that maps the uncertain element into a normalized ... designed for a frozen value of was not completely guaranteed for other rotor angular speeds An important point that is needed to be emphasized in this particular case is that the performance of the controller...
- 10
- 336
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about ... on a shaker at °C, the solutions were withdrawn from each cell The zinc concentration of the solutions was measured by ICP-AES The data were analyzed using prism software (GraphPad Software, San...
- 14
- 442
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA ... Tubulin a6 -for Tubulin a6 -rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC ... in parallel (Br) and revealed with antibodies to each of the MAPs For brain and CAD cells, the volume loaded in each lane was adjusted to contain equivalent amounts of total tubulin, as revealed...
- 14
- 416
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target relies on its role as the main catabolic pathway ... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... enzymes was then evaluated in this parasite by initial rate analysis Using the methylglyoxal glutathione hemithioacetal as substrate, the kinetic parameters for L infantum glyoxalase I, were a Km of...
- 11
- 515
- 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
... of pyruvate kinase, and 2.5 lgámL)1 LDH in a total volume of mL The reaction was initiated by an addition of 50 ng of Na+/K+-ATPase Na+-dependent ATPase activity was also measured using the coupled ... subunits, disassembly of transmembrane a helices, and a separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative ... changes in membrane-bound Na+/K+-ATPase can be summarized as follows Pressure eects at 100 MPa or lower The decreased reaction rate of the Na+/K+-ATPase with an increase in pressure can be rationalized...
- 9
- 432
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... suggested that the basal ganglia, the area of neurological degeneration in those with PD, are specifically involved in the control of dance movements Increased activity in the basal ganglia was observed ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others with PD and their caregivers...
- 19
- 648
- 0
Báo cáo khoa học: Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore doc
... than the activity of the Pfr form, which reached, maximally, 20% of that of the Pr form Taking into account the maximal conversion of Pr into Pfr of 70%, due to the partial overlap of their absorption ... Netherlands), according to the instructions of the manufacturer Generation of the C24S mutant was performed with the following primers: CphBm C24S-sen, 5¢-GAGGTGGACTTGACGAATTCAGATCGCG AACCAATTCAC-3¢, ... (5¢-AAACTCGAGCCGGCCCTCAATTTTGACCTCCTGC AATGTGAAATAGAACG-3¢), and cloned between the NcoI and XhoI sites into pET2 8a( +), providing a His-tag in the C-terminus of the recombinant protein DNA was transferred...
- 11
- 440
- 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
... estimated that only about 5–10% of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the ... receivers that are specifically registered with the repeater This broadcast method tends to increase the latency and jitter of packets, especially as the number of collaborators increases Quality of Service ... the sender sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data For example, a user send their data to a multicast address...
- 10
- 449
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
... relevant covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms of ... variables on the SpREUK P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease and duration of disease Using the method of univariate analyses ... Factor analysis Factor analysis revealed a Kaiser-Mayer-Olkin value of 0.79, which as a measures for the degree of common variance, indicates that the item-pool seems to be suitable for a factorial...
- 11
- 425
- 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
... species of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly ... and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were nesting ... training Therefore, the course of training had already built up trainees’ confidence in using weaver ants as a major component of the cashew IPM program At the end of the training, to examine the...
- 10
- 551
- 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
... include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the use of weaver ants in cashew ... in the TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, ... orchard preparation, controlling of competitive species of ants, identification of weaver ant colonies, transplantation of the ants into cashew orchards, and management and maintenance of the weaver...
- 12
- 531
- 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
... insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that farmers lack extensive ... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 212 cashew farmers were ... (Appendix 1), so that the TOT trainees were aware of the major problems cashew smallholders have in cashew production and what problems the farmers think need to be resolved A total of 212 cashew...
- 7
- 400
- 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
... of ants, identification of weaver ant colonies, transplantation of the ants into cashew orchards, and management and maintenance of the weaver ant colonies Under the supervision of Dr Peng, they ... in cashew orchards, (2) to make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages ... has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive use of pesticides has caused health problems to farmers, their animals...
- 24
- 453
- 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
... because of weaver ant boundary fights, the abundance of weaver ants was < 40% in the IPM plot, which was low The average damage level for each of the main pests was greater in the IPM plot than ... base, and each larva excavated a chamber in which the calcareous pupal cell was formed from the excretions of the larva Pupation took place late in the year The pupa is about 35 mm long, creamy-white, ... the centre of the branch At a regular distance, the larva made a hole to the branch surface to get rid of the waste from the tunnel (Fig 7) The branch borer had only one generation per year Adults...
- 26
- 491
- 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
... methods and skills, and their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers ... successfully passed their examinations Each of them was awarded a graduation certificate in the cashew IPM training Now, we have 112 TOT cashew IPM trainers, and they are distributed in ten cashew growing ... methods, and they were very interested in the field practical All the master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was...
- 10
- 302
- 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
... to manage the main pest assemblage and the importance of keeping weaver ant populations high and stable • Part describes the basic bio-ecology of weaver ants and provides a series of practical ... demonstration orchards and their own orchards, the majority of FFS farmers will use weaver ants in part of their orchards in the next cashew season to have a test and to further familiarise themselves ... Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased since 2002, but the extensive...
- 37
- 394
- 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
... (Helopeltis antonii), that caused the majority of damage on flushing shoots The most important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect ... implementation of the IPM program, for the part of the TOT training and for the field data analyses Dr Pham Van Bien and Mr La Pham Lan are in charge of Vietnamese personnel and expenses of the project ... since the project started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration...
- 10
- 327
- 1
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
... mate-pair library sequencing will mark the end of the data collection phase and the start of assembly and analysis The end of this phase will be marked clearly on the snake genomics website [21], as ... using the python data together with other comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, ... milestones of data analysis and release The maximum time between the end of data collection and submission of the genome paper will be 1 year The Toronto Statement suggests that there be a 1-year period,...
- 8
- 410
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ