Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation C. Gasto ´ n Bisig 1 , Marı ´ a E. Chesta 1 , Guillermo G. Zampar 1 , Silvia A. Purro 1 , Vero ´ nica S. Santander 2 and Carlos A. Arce 1 1 Centro de Investigaciones en Quı ´ mica Biolo ´ gica de Co ´ rdoba (CIQUIBIC), UNC-CONICET, Departamento de Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina 2 Departamento de Biologı ´ a Molecular, Facultad de Ciencias Exactas, Fı ´ sico-Quı ´ micas y Naturales, Universidad Nacional de Rı ´ o Cuarto, Argentina Introduction Correct functioning of the nervous system requires the proper development of neuronal circuits and the estab- lishment of synapses. Although neurons from different regions of the nervous system acquire diverse morpho- Keywords CAD cells; microtubule-associated proteins; microtubule dynamics; microtubules; neurites Correspondence C. A. Arce, Centro de Investigaciones en Quı ´ mica Biolo ´ gica de Co ´ rdoba (CIQUIBIC), UNC-CONICET, Departamento de Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, 5000-Co ´ rdoba, Argentina Fax: +54 0351 4334074 Tel: +54 0351 000000 E-mail: caecra@dqb.fcq.unc.edu.ar (Received 19 May 2009, revised 28 September 2009, accepted 2 October 2009) doi:10.1111/j.1742-4658.2009.07422.x In many laboratories, the requirement of microtubule-associated proteins (MAPs) and the stabilization of microtubules for the elongation of neurites has been intensively investigated, with controversial results being obtained. We have observed that the neurite microtubules of Cath.a-differentiated (CAD) cells, a mouse brain derived cell, are highly dynamic structures, and so we analyzed several aspects of the cytoskeleton to investigate the molecu- lar causes of this phenomenon. Microtubules and microfilaments were pres- ent in proportions similar to those found in brain tissue and were distributed similarly to those in normal neurons in culture. Neurofilaments were also present. Analysis of tubulin isospecies originating from post-trans- lational modifications revealed an increased amount of tyrosinated tubulin, a diminished amount of the detyrosinated form and a lack of the Delta2 form. This tyrosination pattern is in agreement with highly dynamic micro- tubules. Using western blot analyses with specific antibodies, we found that CAD cells do not express several MAPs such as MAP1b, MAP2, Tau, dou- blecortin, and stable-tubule-only-peptide. The presence of the genes corre- sponding to these MAPs was verified. The absence of the corresponding mRNAs confirmed the lack of expression of these proteins. The exception was Tau, whose mRNA was present. Among the several MAPs investigated, LIS1 was the only one to be expressed in CAD cells. In addition, we determined that neurites of CAD cells form and elongate at the same rate as processes in a primary culture of hippocampal neurons. Treatment with nocodazol precluded the formation of neurites, and induced the retraction of previously formed neurites. We conclude that the formation and elon- gation of neurites, at least in CAD cells, are dependent on microtubule integrity but not on their stabilization or the presence of MAPs. Abbreviations CAD, Cath.a-differentiated; dCAD, diffentiated CAD; MAP, microtubule-associated protein; STOP, stable-tubule-only-peptide; TSA, trichostatin A. 7110 FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS logies and abilities, there are certain basic features common to all neurons (e.g. the initiation and elonga- tion of membrane protrusions for neurite formation, and their stabilization and differentiation into dendrites and axons). Other processes, such as the organization of the internal cytoskeleton, migration, guidance, and selective synaptogenesis, differ depend- ing on the type of neuron [1,2]. The cytoskeleton is a critical structure for the elon- gation of neurites and the maintenance of neuronal architecture [3], and the stabilization of microtubules is considered to be essential for neurons to maintain their asymmetry and to transport materials required for neurite elongation [4,5]. The mechanism by which neu- rons regulate microtubule assembly, stability, and interactions with other cell structures is considered to depend on the presence of microtubule-associated pro- teins (MAPs), among which the most prominent are MAP1b, MAP2, Tau, and stable-tubule-only-peptide (STOP) [6–9]. There are also other MAPs that have been studied to a lesser extent (spectraplakins, adeno- matous polyposis coli, doublecortin, dishevelled), as well as other proteins binding to the plus end of micro- tubules that could be involved in this process [10–12]. Transfection analyses have shown that Tau and MAP2 induce the elongation of processes of non-neu- ronal cells [13,14]. Suppressed expression of MAP1b, MAP2, and Tau using antisense and siRNA technol- ogy in several studies [15–17] caused a reduction of neurite outgrowth. The microinjection of anti-Tau antibodies into cultured neurons did not inhibit axonal extension [18]. Tau knockout mice showed a decreased number of microtubules in small-diameter axons, but extended axons were indistinguishable from those of wild-type controls [19]. MAP1b deficient mice show an abnormal brain architecture, whereas, in MAP2 defi- cient mice, the cytoarchitecture was normal, suggesting an overlapping function of MAP2 with MAP1b [20]. Lack of functional alteration in cases when only one gene for MAP was silenced was generally attributed to other proteins that provide additional redundancy with MAP functions [21–25]. The conflicting conclusions made in different studies may be related to the use of different technologies or different cell or tissue systems, or the presence of MAPs with redundant functions. In any case, a requirement of MAPs and stabilized micro- tubules for neurite formation has not yet been clearly demonstrated. In the present study, we characterized cytoskeleton and neurite formation in Cath.a-differen- tiated (CAD) cells, adding new information regarding this particular subject. CAD originated as a subclone of the cathecolamin- ergic cell line CATH.a, which was derived from a neuronal brain tumor in a transgenic mouse expressing SV40 large T antigen under the control of the tyrosine hydroxylase promoter [26]. CAD cells proliferate with a rounded or polygonal shape in the presence of serum. When serum is removed, they stop proliferating and differentiate, acquiring a neuron-like morphology, and, when serum is re-added, a rapid shortening of neurites is observed, such that most cells present a rounded morphology within approximately 40 min [27]. Studies from several laboratories have shown that these cells contain synaptic vesicle proteins and express neuron-specific proteins such as b-tubulin III, GAP-43, SNAP-25, synaptostagmin, and other neuropeptides [27,28]. The intracellular traffic powered by kinesins and dynein in these cells functions similarly to other neuronal systems [29–31]. After differentiation, cell processes contain numerous varicosities similar to those of neurons [27,32]. Single-cell electrophysiologi- cal studies have demonstrated that CAD cells can be induced to fire action potentials, and that voltage- dependent sodium and potassium currents can be elicited [33]. The rapid retraction of neurites after the addition of serum led us to consider the possibility that the cyto- skeleton of CAD cells should have peculiar properties. Thus, in the present study, we investigated the main constituents of this structure and found that neurites have highly dynamic microtubules and lack stabilized microtubules because major MAPs are not expressed in these cells. However, neurites elongate at the same rate as those of normal neurons in culture. Results Cytoskeletal proteins As noted in the Introduction, the stabilization of microtubules is recognized as an essential process dur- ing the elongation of neurites, presumably to assure cell asymetry and the transport of materials to the growth cone. Consistently, this process of stabilization has been described in several types of neurons in cul- ture [10]. The rapid shortening of CAD cell neurites after the addition of serum led us to presume that there are alterations in the cytoskeleton. Accordingly, we investigated the presence, amount, and distribution of the main components of this structure. Immunofluo- rescence using specific antibodies revealed that actin microfilaments (Fig. 1A) are present in CAD cells dis- playing the typical localization, positioned along the shaft and in the apical region of the growth cone pre- ceding the microtubules (Fig. 1A). The three major cytoplasmic growth cone domains [i.e. central (C), C. G. Bisig et al. Neurite formation in CAD cells FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS 7111 transition (T) and peripheral (P) zones] can be clearly distinguished (Fig. 1A). The localization of these pro- teins is the same as that previously reported in cultured hyppocampal cells [10]. Western blot and subsequent determination of optical density confirmed the presence of actin in CAD cells (Fig. 1B, lanes 1 and 2) in an actin ⁄ tubulin proportion slightly higher than that determined in mouse brain [0.16 ± 0.05 and 0.12 ± 0.03 for diffentiated CAD (dCAD) cells and brain, respectively, n = 3]. We found no significant difference in the amount of the neurofilament 100 kDa constituent in relation to tubulin in CAD cells com- pared to mouse brain (Fig. 1B, lanes 3 and 4). Acetylation and tyrosination states of tubulin The tubulin molecule is subject to a variety of post- translational modifications [14,34]. One of them com- prises the reversible acetylation of its a-chain at the e-amino group of Lys40 [35]. Although its physiological role is unclear, we have previously presented evidence demonstrating that acetylation is necessary for tubulin to interact with Na,K-ATPase [36]. In living cells, acet- ylated and deacetylated tubulin coexist in variable pro- portions depending on the cell type [37]. Microtubules containing a high degree of acetylated tubulin were found to be more stable [35]. In addition, microtubules DE C AB Fig. 1. Tubulin, actin, and neurofilament protein expression in CAD cells. (A) CAD cells differentiated for 5 days were stained for double immunofluorescence using rhoda- mine-conjugated phalloidin to detect actin microfilaments (Actin) and anti-total tubulin (Tubulin) to detect microtubules. The merged image shows that actin microfila- ments invades the growth cone, whereas microtubules remain behind. The central (C), transition (T) and peripheral (P) zones are also indicated. Scale bar = 5 lm. (B) CAD cells (80% confluence) were differentiated for 5 days, collected, and dissolved in Laemmli’s sample buffer for immunoblot in parallel with samples of mouse brain tissue. Blots were stained simultaneously with anti- tubulin (DM1A) and anti-actin (lanes 1 and 2). Other samples were stained with anti- neurofilament protein (lanes 3 and 4). The volume of each sample was adjusted to load a similar amount of tubulin. (C) CAD cells differentiated for 5 days were treated with 5 l M TSA for 0, 3, and 6 h, and imme- diately processed for immunofluorescence with anti-acetylated tubulin (clone 6-11B-1). (D) CAD cells differentiated for 5 days were treated with TSA for the indicated times and immunoblotted with anti-acetylated- and anti-total-tubulin. (E) CAD cells differentiated for 5 days were treated for 12 h with 10 l M Taxol. A control without Taxol was also run. Cells were collected and processed for wes- tern blotting using antibodies against acety- lated and total tubulin. The lane labeled +Taxol was overloaded to highlight the absence of acetylated tubulin. Neurite formation in CAD cells C. G. Bisig et al. 7112 FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS were shown to be the preferred substrate for the acety- lating enzyme [35]. We found that the acetylated form of tubulin was essentially absent in CAD cells (Fig. 1C, t = 0; Fig. 1D, lane 0). This could be a result of the predominance of highly dynamic microtubules versus stable microtubules, to the predominance of tubulin- deacetylase activity (histone deacetylase 6) versus tubu- lin-acetyltransferase activity, or to absence or inhibition of the latter enzyme. Treatment of cells with the non- specific deacetylase inhibitor trichostatin A (TSA) resulted in the appearance of a significant amount of acetylated tubulin (Fig. 1C, 3 and 6 h; Fig. 1D), indi- cating that both acetylase and deacetylase were present in CAD cells. Treatment of cells with Taxol induces an increment in acetylated microtubules because the acetyl transferase acts preferentially on these structures [35]. Stabilization of microtubules by treating CAD cells with 10 lm Taxol did not cause increase of acetylated tubulin (Fig. 1E), indicating that the acetylation state of tubulin depends mainly on the relative activities of the acetylating and deacetylating enzymes rather than on microtubule dynamics. Tyrosination ⁄ detyrosination at the COOH-terminus of a-tubulin is another post-translational modification that has been extensively studied, although its physio- logical role also remains unclear [38–40]. As a result of this cyclic modification, different isotypes of tubulin exist: tyrosinated (Tyr-tubulin), detyrosinated (Glu- tubulin), and Delta2 (a-tubulin lacking the two COOH-terminal amino acids). Glu-tubulin and Delta2- tubulin have been used as markers of stable micro- tubules [41]. Immunofluorescence images of CAD cells using an antibody against total tubulin (which does not discriminate different states of tubulin tyrosina- tion) showed a bright, typical microtubule network in the cell body and neurites (Fig. 2A). A similar pattern was observed using an antibody specific to tyrosinated tubulin. Antibody against Glu-tubulin revealed scarce, curly microtubules, whereas antibody against Delta2- tubulin revealed no microtubules. These results were confirmed by immunoblots using the same antibodies (Fig. 2B). Mouse brain tissue was used as a positive control. The reduced amount of Glu-tubulin in CAD cells was not a result of a lack of (or inhibition of) the putative detyrosinating enzyme (tubulin carboxypepti- dase) because a significant increase of Glu-tubulin was observed in differentiated and nondifferentiated cells treated with Taxol (Fig. 2C). Microtubule dynamics The rapid shortening of neurites found in CAD cells, along with the absence of markers of stable micro- tubules (Glu-tubulin, and Delta2-tubulin), led us to consider the possibility that microtubules are highly dynamic structures in these cells. By measuring the rate of microtubule depolymerization after nocodazole treatment [4,5], microtubule dynamics in CAD cells was compared with that of other cell types. Micro- tubules of CAD cells were as dynamic as those of Chinese hamster ovary and PC12 cells in active prolif- eration. The time required for 50% depolymerization was 1–2 min (Fig. 3A, B, empty circles). On the other hand, the depolymerization curve for 7-day-old chicken embryo brain cells showed a two-phase behav- ior, suggesting the presence of two microtubule popu- lations: one with a half-life of 1–2 min and the other being more stable (Fig. 3A, B, solid triangle). As a negative control of microtubule disassembly by noco- dazole treatment, CAD cells were pre-treated with sodium azide, which stabilizes microtubules by deplet- ing cells of ATP [42]. Under these conditions, microtu- bules were not disassembled by nocodazole treatment (Fig. 3A, bottom; Fig. 3B, solid circles). Several MAPs are not expressed in CAD cells From a mechanistic point of view, there is a general consensus that MAPs are the proteins responsible of microtubule stabilization [10,22,43,44]. Thus, we investigated whether the occurrence of highly dynamic microtubules in CAD cells is the result of some alter- ation in one or more MAPs. The presence of neuro- nal structural MAPs (i.e. MAP1b, MAP2, Tau, and STOP) was investigated in 10-day-differentiated CAD cells by immunoblotting using appropriate antibodies. In the case of Tau, immunoblots were revealed with antibodies that recognize dephosphorylated and phos- phorylated epitopes and a nonphosphorylable region of the protein (Tau-1, Tau-2 and 134d). For compari- son, soluble fractions from 30-day-old mouse brain were simultaneously run. All the MAPs investigated were present in brain samples, but not in samples from CAD cells (Fig. 4). Brain and CAD samples run in each lane contained similar amounts of a-tubulin (Fig. 4, lower panels). The experiment was repeated, running overloaded samples of CAD cells and using a more sensitive chemiluminescent method (Femtomolar detection system), with similar results being obtained (i.e. no band was observed in lanes corresponding to CAD cells). This is exemplified by an overloaded dCAD cell sample being revealed with 134d antibody (Fig. 4, lane dCAD ⁄ Overload). More- over, treatment of nitrocellulose membrane with alka- line phosphatase prior to incubation with anti- Tau-1, aiming to increase the epitopes that can be C. G. Bisig et al. Neurite formation in CAD cells FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS 7113 recognized, produced a significant increase in Tau bands in the Br lane, but no band appeared in the dCAD lane (Fig. S1). To concentrate MAPs eventually diluted in the cell extract, we performed immunoprecipitation with Sepharose beads linked to antibodies specific to each MAP. As a control, mouse brain samples were also analyzed in parallel. The amount of the brain soluble fraction and dCAD cell extract used in these experi- ments as input material was 30-fold higher than those loaded on each lane shown in Fig. 4. For each MAP, most of the protein in brain samples was found in the pellet, whereas, in dCAD cells samples, no MAP band was observed (not shown). Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and STOP proteins was surprising. This led us to investigate the presence of their respective genes and messenger RNAs, using a PCR technique with specifically designed primers (Table 1). In every case, the PCR products A C B Fig. 2. Tyrosination state of tubulin. (A) Cells differentiated for 5 days (dCAD) and nondifferentiated cells (CAD) were visual- ized by immunofluorescence using antibod- ies specific to a-tubulin (total tubulin), Tyr-, Glu-, and Delta2-tubulin. The inset shows embryonic chicken brain cells differentiated for 6 days in culture and revealed with anti- body to Delta2-tubulin. Scale bar = 10 lm. (B) Cells obtained as in (A) were subjected to western blotting and stained with the same antibodies as in (C). For staining with each antibody, identical volumes of CAD cell samples were run. As positive controls, samples of mouse brain (Br) were included. (C) Nondifferentiated CAD cells and cells differentiated for 7 days were treated (+) or not ()) with 10 l M Taxol for 12 h and then subjected to western blotting using antibody to detyrosinated tubulin (Glu- tubulin). All lanes were loaded with samples containing the same amount of total tubulin. Neurite formation in CAD cells C. G. Bisig et al. 7114 FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS AB Fig. 3. Nocodazole sensitivity of microtubules of CAD and different cell types. CAD cells differentiated for 7 days, PC12 cells (80% conflu- ence), Chinese hamster ovary cells (80% confluence), a primary culture of 7-day-old chicken brain cells, and differentiated CAD cells treated with 20 m M sodium azide (in culture medium without glucose) for 1 h, were incubated in the presence of 10 lM nocodazole for the indicated times and immediately processed to isolate the cytoskeletal fraction, which remained bound to the plastic dish (see Experimental proce- dures). The cytoskeletal fraction remaining after nocodazole treatment was processed for western blotting and stained with antibodies to total tubulin (DM1A) and actin (as a loading control). (A) Immunoblots from a typical experiment. (B) Optical density values for total tubulin corresponding to bands from three independent experiments (mean ± SD). For each type of cell, the attenuance of the tubulin band at time zero of nocodazole treatment is considered to be 100%. Fig. 4. Analysis of microtubule-associated proteins in differentiated CAD cells. CAD cells were grown on 10 cm dishes (to 80% confluence) and differentiated over 10 days in fetal bovine serum-free culture medium. Cells were collected, dissolved in a small volume of Laemli’s sample buffer, and subjected to SDS ⁄ PAGE (6% acrylamide for MAP1B, MAP2 and STOP; and 10% for Tau) and immunoblotting using anti- bodies to various MAPs as indicated. As positive controls, samples of supernatant fractions from mouse brain homogenates centrifuged at 100 000 g were processed in parallel (Br) and revealed with antibodies to each of the MAPs. For brain and CAD cells, the volume loaded in each lane was adjusted to contain equivalent amounts of total tubulin, as revealed with DM1A antibody (bottom panel), except for the lane on the right, which was revealed with 134d (dCAD ⁄ Overload) in which a triple amount of total tubulin was loaded. The positions of mole- cular mass markers are indicated. C. G. Bisig et al. Neurite formation in CAD cells FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS 7115 obtained represent approximately 30% of the complete genes. At least these portions of the genes corresponding to each of the MAPs were present in CAD cells (Fig. 5A). We consider it most likely that the complete sequences of the respective genes are present in the cell genome because it would be an extreme coincidence that the rest of each gene had been missed. Analysis of the respective mRNAs by RT-PCR, using the same primers, indicated that the mRNAs of MAP1b, MAP2, and STOP were absent in nondifferentiated cells, whereas, in differentiated cells, a weak band was observed for MAP1b and STOP. On the other hand, the quantity of RT-PCR product corresponding to Tau in both differ- entiated and nondifferentiated CAD cells was similar to that in brain tissue (Fig. 5B). LIS1 but not doublecortin is expressed in CAD cells Other proteins, such as a-Lis 1 and doublecortin, have been shown to interact, directly or indirectly, with microtubules and to stabilize them in vitro [11,12,45]. Investigations on the biochemical basis of lissencephaly, a human neurological disease characterized by an abnormal layering of brain cortex, led to the discovery of these two proteins, which are lacking or mutated in patients [46]. Although they are not major MAPs of neurons (based on their quantity in total brain), we investigated their presence in CAD cells. Immunoblots using the corresponding antibodies revealed the presence of a-Lis 1 and the absence of doublecortin in these cells (Fig. 6A). Similarly, RT-PCR using specifi- cally designed primers (Table 1) revealed the absence of mRNA corresponding to doublecortin and the presence of a-Lis 1 mRNA (Fig. 6B). Neurite formation in CAD cells CAD cells were grown under differentiating conditions as described previously [27], microphotographs were taken on various days, and neurite length was mea- sured. On day 0, cells were rounded, with only minor membrane protrusions. Numerous processes subse- quently appeared, and grew rapidly to form a dense meshwork (Fig. 7A, 15 days). Varicosities, similar to those of neurons in primary culture, were observed in all of the processes (not shown). On day 15, cells were changed to culture medium containing 10% fetal bovine serum, and photographed 24 h later (Fig. 7A, +FBS 24 h). As reported previously [27], fetal bovine serum treatment induces the retraction of processes, and cells assume a rounded or polygonal form with scarce, short processes and resume proliferation (not shown). Neurite length was quantified as a function of days in culture under differentiating conditions (Fig. 7B). During days 1–8, neurites elongated at an average rate of approximately 40 lm per day. This rate is very similar to that of axons in central nervous system cells in culture [47,48]. For statistical measure- ment of neurite retraction, at day 7 under differentiat- ing conditions, cells were changed to culture medium containing 10% fetal bovine serum, and cultured for an additional 24 h. Neurite length determination demonstrated that the processes retracted almost completely (Fig. 7B, open square). The peculiar properties of the CAD cell cytoskeleton compelled us to investigate to what extent neurite for- mation is a microtubule-dependent process. We found that treatment of nondifferentiated cells with nocodaz- ole precluded neurite outgrowth, and a similar treat- ment after differentiation led to the retraction of Table 1. PCR primer sequences used for screening expression of different MAPs genes by CAD cells. Primers Sequence (5¢-to3¢) Location GenBank accession number MAP1b-for MAP1b-rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG 82898–82923 83581–83552 NC_000076 Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6-for Tubulin a6-rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081 Idem Neurite formation in CAD cells C. G. Bisig et al. 7116 FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS neurites (results not shown), indicating that micro- tubule integrity is necessary for both elongation and sustaining neurites. Discussion Our understanding of neurogenesis, neuronal plasticity, and the establishment of correct synapses and circuits in the central and peripheral nervous systems has advanced greatly over the past decade. The most stud- ied MAPs (i.e. MAP1b, MAP2, Tau, and STOP) have been shown to promote the polymerization and stabil- ization of microtubules, and therefore these proteins and microtubules are involved in the elongation of neural processes (i.e. the establishment of neuronal polarity) [10,22,43,44]. We found that MAP1b, MAP2, Tau, STOP, and doublecortin are not expressed in CAD cells (Fig. 4). This was observed by an immunoblot using specific antibodies against each MAP. Complementary experi- ments [immunoprecipitation, overloaded gels, highly sensitive chemiluminescent method (Femtomolar detection system) and the use of different antibodies against Tau] confirmed the absence of these proteins. Molecular biology techniques showed the presence of the genes corresponding to each MAP and the absence of their mRNAs (with the exception of that of Tau) (Fig. 5). mRNA corresponding to Tau was detected in CAD cells in amounts similar to that in brain tissue (Fig. 5), suggesting that Tau expression is inhibited at the translational level, whereas other MAPs are down- regulated at the transcriptional level. A study showing the expression of MAP1b in CAD cells using a polyclonal antibody was recently published [32]. However, when we tested the same antibody (a gift from I. Fisher, Drexel University, Philadelphia, PA, USA) on either mouse brain or CAD cells samples, we obtained a complex and con- fusing pattern of bands (not shown). Thus, we were unable to draw any conclusions regarding this anti- body. This observation, in addition to the absence of any band on the immunoblot stained with a com- mercial anti-MAP1b (Fig. 4) and the strong evidence about the absence of MAP1b mRNA (Fig. 5), leads us to conclude that MAP1b is not expressed in CAD cells. Even if this protein were expressed at a very low level, as suggested by the trace amount of MAP1b mRNA shown in Fig. 5B, it is evident (from the results provided in Fig. 3) that the amount of this MAP is insufficient to stabilize microtubules. Tubulin, actin, neurofilament protein (Fig. 1), LIS1 (Fig. 6), and the other proteins tested (not shown) are present in CAD cells in normal amounts and with nor- mal cellular distribution, suggesting that these proteins are not involved in the mechanism that leads to the peculiar behaviour of CAD cells. It is a remarkable coincidence that only those proteins having the ability to associate directly with microtubules (structural AB Fig. 5. Analysis of genes and mRNAs corresponding to MAP1b, MAP2, Tau, and STOP in CAD cells. (A) Genomic DNA from CAD cells dif- ferentiated for 10 days, and from mouse brain, was purified and subjected to PCR using primers specifically designed to detect each of the MAPs (see Experimental procedures and Table 1). Products were electrophoretically separated on agarose gels and stained with ethidium bromide. For each MAP, single bands were obtained in each lane. Standard molecular masses are shown on the right. (B) Total RNA from mouse brain and 10 day-differentiated (dCAD) and nondifferentiated (CAD) cells were purified and subjected to RT-PCR with the same prim- ers used in (A). As a positive control of expression, primers designed to detect the presence of a-tubulin 6 mRNA (a protein of constitutive expression) were also used (Table 1). C. G. Bisig et al. Neurite formation in CAD cells FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS 7117 MAPs) and stabilize them are absent in CAD cells. A possible explanation is that the expression of all these MAPs is under a common regulatory mechanism. Alternatively, the expression of each MAP could be sequential, so that the expression of each MAP would depend on the regulation of the previous one in the sequence. Dynamic and stable microtubules coexist in neu- rons. For example, Baas et al. [49] reported a half-life of 3.5 and 130 min for dynamic and stable subpopu- lations, respectively. Proximal microtubules in axons are more stable than distal ones [50], suggesting that microtubules become stabilized as the process elon- gates. On the basis of sensitivity to nocodazol treat- ment, microtubules in CAD cells were shown to be highly dynamic (half-life = 2 min) (Fig. 3). Similarly, these microtubules contain a very low level of detyro- sinated tubulin and no Delta2 tubulin, which are markers of stable microtubules (Fig. 1C, D). Further- more, the level of tyrosinated tubulin (a marker of dynamic microtubules) was high (Fig. 1C, D). Taken together, these results clearly indicate that microtu- bules in CAD cells are highly dynamic structures. This is consistent with the lack of microtubule-stabi- lizing MAPs in these cells. The hypothesis underlying most of the numerous experiments that have been performed to elucidate the physiological role of MAPs assumes that these proteins stabilize microtubules, and thus are therefore required for the extension of membrane protrusions such as axons and dendrites. We found that apparently normal neurites in CAD cells elongate similarly to neurites in primary culture (Fig. 7), even though the microtubules lack most MAPs (Figs 4 and 5), and are highly dynamic structures (Fig. 3). With regard to neurite elongation, MAPs could theoretically be ‘substituted’ by other yet-undescribed proteins having redundant functions. However, the finding in the present study that microtubules in CAD cells are highly dynamic indicates that no mechanism is operating to compen- sate for the absence of the microtubule-stabilizing function of MAPs. The results obtained in the present study are consis- tent with the idea that even though intact microtubules are necessary for neurite elongation, neither stabiliza- tion of these structures nor the presence of MAPs is required. The only MAP that we found to be expressed in CAD cells is LIS1 (Fig. 6). This protein belongs to a unique class of microtubule-binding pro- teins termed +TIPS (for plus-end tracking proteins) [51] and is a regulated adapter between CLIP-170 and cytoplasmic dynein. In addition, LIS1 forming a com- plex with other proteins (e.g. dynein ⁄ dynactin and Clip170) was suggested to be necessary for the elonga- tion of the growth cone, cell migration, prevention of catastrophe events, docking of the growing microtu- bule to specific cortical sites, tethering microtubules to the cell cortex, etc. [45,52,53]. In this scenario, we can imagine that the +TIPs complex is responsible for the elongation of the neural processes without the need for microtubule stabilization or the expression of struc- tural MAPs. In normal neurons, MAPs may regulate B A Fig. 6. LIS1 but not doublecortin is expressed in CAD cells. (A) Dif- ferentiated (dCAD) and nondifferentiated (CAD) cells were sub- jected to SDS ⁄ PAGE and immunoblot with antibodies to doublecortin (A, left) and to LIS1 (A, right). As positive controls, samples of cytosolic fractions from adult or newborn mouse brain (for LIS1 or doublecortin, respectively) were included (Br). For com- parison, total tubulin (as revealed with the monoclonal DM1A anti- body) contained in each sample was also determined (A, bottom panel). (B) Total RNA from mouse brain (Br) and 10 day-dCAD cells were purified and subjected to RT-PCR with primers specifically designed to detect doublecortin or a-Lis 1 (Table 1). After 46 cycles of PCR, samples were loaded in an agarose gel, and stained with ethidium bromide. Neurite formation in CAD cells C. G. Bisig et al. 7118 FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS microtubule dynamics not for the purpose of initiating or sustaining neurite elongation, but to modulate other more subtle functions (e.g. spatial organization of microtubules, interaction with other structures, growth cone guidance, synaptogenesis, etc.). Because five major MAPs are absent in CAD cells, these cells provide a useful model for studying the roles of other cytoskeletal proteins in neurite formation at the molecular level. Experimental procedures Chemicals Nocodazole, paclitaxel (Taxol), TSA, rhodamine-conju- gated phalloidin, sodium butyrate, and culture media were obtained from Sigma-Aldrich (St Louis, MO, USA). Fetal bovine serum was obtained from Natocor (Co ´ rdoba, Argentina). Soluble mouse brain extract preparation Brains from 15- to 30-day-old mice were homogenized in 1 vol (w ⁄ v) of cold MEM buffer (100 mm Mes adjusted with NaOH to pH 6.7, containing 1 mm EGTA and 1mm MgCl 2 ). The homogenate was centrifuged at 100 000 g for 1 h, and the supernatant fraction was col- lected. Cell culture Brain cells from 7-day-old chicken embryos were isolated and cultured as described previously [54]. Chinese hamster ovary and PC12 cells were grown in DMEM containing 10% fetal bovine serum (fetal bovine serum) at 37 °Cinan air ⁄ CO 2 (19 : 1) incubator. CAD cells were grown on 35 mm dishes in DMEM ⁄ F12 (50 : 50, v ⁄ v) with 10% fetal bovine serum and 2 mm glutamine. The differentiation of these cells was accomplished by replacing the medium with the same medium lacking fetal bovine serum. Under these conditions, neurites longer than five soma diameters are visualized after 24–48 h. In all experiments, the differen- tiation status of cells was confirmed by microscopic exami- nation. Antibodies Rabbit polyclonal antibodies specific to Glu-tubulin (anti- Glu) and to Delta2-tubulin were prepared in our laboratory as described previously [55]. Mouse monoclonal antibodies against Tyr-tubulin (Tub 1A2, 1 : 1000), total a-tubulin (DM1A, 1 : 1000), b-actin (Clone AC-15; 1 : 500), acety- lated tubulin (6-11B-1, 1 : 1000), peroxidase-conjugated rabbit anti-(mouse IgG) (1 : 800), rhodamine-conjugated goat anti-(rabbit IgG) (1 : 600) and fluorescein-conjugated goat anti-(mouse IgG) (1 : 600) were obtained from Sigma-Aldrich. Mouse monoclonal antibody mainly specific B A 0 day 1 day 8 days3 days 15 days +FBS 24hs Fig. 7. Elongation and retraction of neurites in CAD cells. CAD cells were grown under proliferating conditions on coverslips, up to approximately 40% confluence, and transferred to culture medium without fetal bovine serum (FBS). (A) Images were taken from 0–15 days of differentiation. At day 15, fetal bovine serum was added (10% final concentration), and cells were photographed 24 h later. Scale bar = 100 lm. (B) At the indicated days of culture, five different areas from three different plates were analyzed to mea- sure the length of the processes. The sum of the lengths of all the measured processes was divided by the number of cells. Cells with no process were excluded from the analysis. At day 7 under differ- entiating conditions, cells were changed to culture medium contain- ing 10% fetal bovine serum and, after 24 h, neurite length was measured as described above (open square). Values are the mean ± SD of three independent experiments. C. G. Bisig et al. Neurite formation in CAD cells FEBS Journal 276 (2009) 7110–7123 ª 2009 The Authors Journal compilation ª 2009 FEBS 7119 [...]... 43–52 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 Bisig CG, Purro SA, Contin MA, Barra HS & Arce CA (2002) Incorporation of 3-nitrotyrosine into the C-terminus of alpha-tubulin is reversible and not detrimental to dividing cells Eur J Biochem 269, 5037–5045 Neurite formation in CAD cells 59 Maya R & Oren M (2000) Unmasking of. .. 48–65 18 Tint I, Slaughter T, Fischer I & Black MM (1998) Acute inactivation of tau has no effect on dynamics of microtubules in growing axons of cultured sympathetic neurons J Neurosci 18, 8660–8673 19 Harada A, Oguchi K, Okabe S, Kuno J, Terada S, Ohshima T, Sato-Yoshitake R, Takei Y, Noda T & Hirokawa N (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein Nature... Tubulin must be acetylated in order to form a complex with membrane Na(+),K (+)-ATPase and to inhibit its enzyme activity Mol Cell Biochem 291, 167–174 Arce CA, Casale CH & Barra HS (2008) Submembraneous microtubule cytoskeleton: regulation of ATPases by interaction with acetylated tubulin Febs J 275, 4664–4674 7122 38 Barra HS, Arce CA & Argarana CE (1988) Posttranslational tyrosination ⁄ detyrosination... phosphatase prior to staining with anti-Tau-1 This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting.. .Neurite formation in CAD cells C G Bisig et al to dephosphorylated Tau protein (Tau-1, 1 : 1000) was obtained from Chemicon (Temecula, CA, USA) Mouse monoclonal antibody to phosphorylated Tau protein (Tau2, 1 : 1000) was obtained from Sigma-Aldrich A polyclonal antibody (134d, 1 : 800) (a gift from Dr A Alonso, New York State Institute for Basic Research in Developmental Disabilities, New... corresponding to each of the microtubule-associated proteins was detected by RT-PCR Total mRNA from CAD cells (nondifferentiated or differentiated for 10 days) was purified using Trizol (Invitrogen, Carlsbad, CA, USA) cDNA was synthesized from 2 lg of total RNA using the Superscript III first-strand synthesis system, followed by RNase H step (Invitrogen) according to the manufacturer’s instructions, and subjected... oligonucleotides in primary cerebellar neurons Nature 343, 461–463 16 Gonzalez-Billault C, Engelke M, Jimenez-Mateos EM, Wandosell F, Caceres A & Avila J (2002) Participation of structural microtubule-associated proteins (MAPs) in the development of neuronal polarity J Neurosci Res 67, 713–719 17 Tint I, Fischer I & Black M (2005) Acute inactivation of MAP1b in growing sympathetic neurons destabilizes axonal microtubules. .. Disabilities, New York, NY, USA) that recognizes Tau independently of its phosphorylation state was also used [56] Mouse monoclonal antibodies against MAP2 ( 2a + 2b, clone AP20) (anti-MAP2, 1 : 1000), and against MAP1b, clone AA6 (anti-MAP1b, 1 : 500), were obtained from Sigma-Aldrich For some experiments, we also used a rabbit polyclonal antibody to MAP1b (1 : 5000) produced in the laboratory of I Fischer (Drexel... for intraneuronal transport studies? J Neurosci Res 85, 2601–2609 Muresan Z & Muresan V (2005) Coordinated transport of phosphorylated amyloid-beta precursor protein and c-Jun NH2-terminal kinase-interacting protein-1 J Cell Biol 171, 615–625 Verhey KJ, Meyer D, Deehan R, Blenis J, Schnapp BJ, Rapoport TA & Margolis B (2001) Cargo of kinesin identified as JIP scaffolding proteins and associated signaling... remained attached to the dishes, were rapidly washed twice with 5 or 12 mL (for 6 or 10 cm dishes respectively) of pre-warmed microtubule-stabilizing buffer, and subjected to SDS ⁄ PAGE 7120 Phosphatase alkaline treatment When indicated, prior to incubation with anti-TAU 1 antibody, the nitrocellulose membrane was treated with phosphatase alkaline as described previously [59] Immunoprecipitation Samples . Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation C. Gasto ´ n Bisig 1 , Marı ´ a. Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077