the main purpose of a psychology paper is the presentation of facts whether newly established as in reports of experiments or well established as in literature reviews
Tài liệu PSYCHOSYNTHESIS: A Psychology of the Spirit pdf
... candidate to develop psychoanalysis in Italy Jung wrote of Assagioli as a very pleasant and perhaps valuable acquaintance, our first Italian, a Dr Assagioli from the psychiatric clinic in Florence ... theory These three areas are revealed as intimately connected, illuminating and supporting Self-realization in all practical applications of psychosynthesis DEVELOPMENTAL THEORY Here is elaborated ... “psychosynthesis,” emphasizing how the human being integrated or synthesized the many aspects of the personality into increasing wholeness An early student of psychoanalysis, Assagioli respected and valued...
- 235
- 958
- 2
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... for the remainder of the protein is: large AAA subdomain, pink; small AAA subdomain, beige; b domain, orange; non-mutated region of C-terminal a helix, cyan (B) Close-up of part of the C-terminal ... contains the b domain (b strands and 8), the final helix of the AAA domain (a helix 10) and the C-terminal helix (a helix 11) This C-terminal region of Vps4 has been defined in the PFAM database as...
- 23
- 490
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... promoters indicate the a- F1-ATPase GAF/Adf-1 binding cassette has enhancer properties (A) The basal promoter activity of b-F1-ATPase is greatly increased when the a- F1-ATPase GAF/Adf-1 binding cassette ... plasmid pSV-bGAL and the quantification of luciferase was normalized to b-galactosidase activity Luciferase activity was determined using the Luciferase Assay System (Promega) according to manufacturer’s ... processing of the a- F1-ATPase mRNA (A) Northern blots of mRNA from different stages of D melanogaster embryogenesis and in adults using the a- F1-ATPase cDNA as a probe Two different types of mRNAs are...
- 11
- 532
- 0
Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt
... transformed to a mass scale using an algorithm in the masslynx software (Waters ⁄ Micromass) Chaperone activity of R120G aB-crystallin Reduction assay Bovine pancreas insulin (45 lm) was incubated ... [22] Furthermore, the different conformational states of reduced a- lactalbumin and the B chain of insulin may be important factors in this variation in affinity The small insulin B chain is likely ... state of a- lactalbumin a- lactalbumin in the absence of aB-crystallin arises from aggregation of the molten globule state of this protein In the presence of aB-crystallin, the resonance decay is...
- 14
- 366
- 0
A POSITION PAPER FROM THE CENTER FOR INQUIRY OFFICE OF PUBLIC POLICY doc
... physical effects School-age [youth] should abstain from any kind of arousal, including passionate kissing Center for Inquiry, June 2007 Evangelical or born-again Christians agree 81% Other Americans ... pregnancy rate among 18-19 year olds is attributable solely to contraceptive use, the increased rate of contraceptive use in that age group is not as dramatic as the increase among the younger age ... Medical Association, The American Psychological Association, The American Public Health Association, The Institute of Medicine, The Society for Adolescent Medicine, The National Education Association...
- 23
- 364
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... Bonferroni correction was applied for single marker analysis Statistical significance was assumed at p < 0.05 Statistical power (1-β) was calculated using binominal power calculation The power calculation ... sepsis when analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal and non-pulmonary sepsis focus the association ... publications reported about the association of the -173 C allele with inflammatory diseases such as rheumatoid arthritis [17,24], inflammatory bowel diseases [25], and its clinical course [26] The...
- 8
- 554
- 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... say) Working as a nurse A career chart was used to determine whether or not a respondent was working in a nursing post or as an agency or bank nurse at a particular time-point On the chart the ... nursing) A factor analysis was conducted in SPSS version 15 on job satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain ... two factors were identified Analysis of Variance (ANOVA) and Multivariate Analysis of Variance (MANOVA) were used to test for statistical difference in first-order job satisfaction factors between...
- 12
- 530
- 0
Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc
... crossings in D is within a constant factor ∆2 /(8cg ) of crg (G) Remark 4.2 In the planar case of Theorem 1.2, the described approximation algorithm yields a drawing of G within a factor 4.5∆2 of ... suitable preprocessing and then algorithm of Klein [9] (for planar distances) • Let F be the set of edges of G intersected by the (dual) edges of C ∗ Then G − F is actually a plane embedding, and ... last statement is proved in Section Finding a large diamond projective grid Randby [11] gave, for each integer r > 0, a full characterization of those projective graphs that are minor–minimal...
- 8
- 336
- 0
A position paper of the EPS Energy for the Future phần 1 ppt
... out the analysis Climate change Since the beginning of industrialisation the world has experienced a rise in average temperature which is almost certainly due to the man-made amplification of the ... and Latin American countries, and the just aspirations of developing countries for reasonable standards of living all point inescapably to the need for sustainable energy sources The authors of ... recommendations, and a scientific/technical part The scientific/technical part is essential to the Position Paper as it contains all facts and arguments that form the basis of the EPS position (i) The...
- 10
- 575
- 0
A position paper of the EPS Energy for the Future phần 2 ppt
... phenomenon of spontaneous disintegration or transformation of an atomic nucleus into another, accompanied by the emission of alpha, beta or gamma radiation, referred to collectively as ionising radiation ... spent fuel in the long-run is a major concern In the short-run, the handling of spent fuel has been practiced safely since the earliest days of nuclear reactors After discharging a reactor, the spent ... This inherent safety regarding proliferation is the major advantage of the once-through fuel cycle Further advantages of this mode of operation can be found in [47] The major disadvantage of...
- 10
- 434
- 0
A position paper of the EPS Energy for the Future phần 3 potx
... an important step towards its realisation was taken by the decision to build the International Thermonuclear Experimental Reactor, ITER, [55] in Cadarache, France In this reactor deuterium and ... functioning demonstration system, for instance, one based on a Generation IV reactor • Waste transmutation using the promising accelerator-driven (ADS) or GenIV reactors should be pursued; again, the ... of years It is too early to finally judge the relative merits of ADS and GenIV reactors as energy producing and waste incinerating/transmuting systems, but the overall favourable properties of...
- 10
- 611
- 0
Báo cáo y học: "Is a purpose of REM sleep atonia to help regenerate intervertebral disc volumetric loss" pdf
... significant on IVDs – showing their deformation with daily variations Therefore, there are two combined forces working against the task of maintaining hydraulic vertebral spacing: 1) stabilizing ... Journal of Circadian Rhythms 2009, 7:1 stand clearly the gravitational influences on all adjacently associated mammalian structural tissues related to these muscles across day and night The spine ... cartilage In other words, it is physically impossible to have a muscle that contracts against the forces of gravity Using the term "anti-gravity muscles" may have been misleading terminology The...
- 5
- 226
- 0
Báo cáo khoa học: "Pro/con debate: In patients who are potential candidates for organ donation after cardiac death, starting medications and/or interventions for the sole purpose of making the organs more viable is an acceptable practice" doc
... and heparin poses more than a theoretical risk of precipitating or exacerbating intracranial haemorrhage and hastening death Phentolamine, a potent vasodilator, may precariously decrease blood ... certain medications and interventions such as inotropes, vasopressors, heparin and phentolamine in potential donors for the sole purpose of making the organs in DCD more viable is an acceptable ... Donation after Cardiocirculatory Death: A Canadian Forum: Donation after Cardiocirculatory Death: A Canadian Forum: Report and Recommendations Edmonton: The Canadian Council for Donation and Transplantation;...
- 4
- 301
- 0
a tax advantage contrary to the purpose of vat provisions
... Justice established in the Halifax case the basic outline of two requisites for determining the existence of abusive practice in the area of VAT.1 One condition was that a tax advantage is gained ... Contrary to the purpose of an article - the principle of fiscal neutrality Based on the Halifax case an overarching principle can be invoked to claim there has been abuse of law in the area of VAT.29 ... meaning of a tax advantage contrary to the purpose of an article in a VAT directive? What a tax advantage is may not be clear at all times The meaning of the word purpose is not clear either A purpose...
- 81
- 287
- 0
a tax advantage contrary to the purpose of vat provisions
... Justice established in the Halifax case the basic outline of two requisites for determining the existence of abusive practice in the area of VAT.1 One condition was that a tax advantage is gained ... meaning of a tax advantage contrary to the purpose of an article in a VAT directive? What a tax advantage is may not be clear at all times The meaning of the word purpose is not clear either A purpose ... by analogy that since abuse is a matter of acting against the purpose of a provision while being in 32 C-103/09 Weald Leasing, para 43-44 C-103/09 Weald Leasing, para 43 34 C-103/09 Weald Leasing,...
- 81
- 311
- 0
Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?
... learn and develop further 5)wise in the handling of document • A good manager must know how in the processing data Maybe managers are afraid of cumbersome paperwork but the manager also very intoxicated ... an environment where new ideas can flow and flourish, follow some of these basic leadership and management practices 7)Information processing and thinking capacity • The power of your brain is ... Cor, meaning heart It means to give courage, confidence or hope Having courage is having the ability to disregard fear and to be brave The easiest way to be brave and fearless is to listen to and...
- 16
- 1,351
- 1
a study on the main features of short jokes and implications for teaching speaking to students of grade 12 at ngoc tao upper secondary school
... peasants are revolting”, this is a pun because it can be interpreted as meaning either that the peasants are fighting against authority, or that they are disgusting Puns surprise and entertain, ... as an extra material to enhance students‟ speaking skill as well as to create a relaxed learning environment Maintaining a friendly, relaxing and harmonious classroom atmosphere is as necessary ... ambivalence, a mingling of attraction and repulsion is of minor importance Each theory has its own definition of that humour is and is generalized mainly based on 11 Alison Ross‟s framework These three theories...
- 57
- 672
- 0
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
... In the Group A, laparotomy was performed, and the pancreas was ablated directly through the surface of the pancreas with an HIFU transducer In the Group B and Group C, extracorporeal HIFU ablation ... procedure The pigs were fasted for 72 h and then administered folium sennae tea to clean the intestinal tract The skin covering the HIFU target area was shaved, washed with degassed water, and defatted ... structures The gas-containing organs such as the gastrointestinal (GI) tracts are poor transmitters of US beam which affects HIFU targeting and ablation [13] In our pilot study, damage to the adjacent...
- 7
- 481
- 0
A STUDY OF THE RELATIONSHIP BETWEEN CEO COMPENSATION AND FIRM PERFORMANCE IN THE US AIRLINE INDUSTRY 2002 2006
... in the airline industry is the passenger load factor because this factor is comparable across airline firms This factor is an operational efficiency indicator of how much of an airline's passenger ... to the forefront of the media as well as academia Enron, Tyco and WorldCom are just a few of the more infamous cases involving corporate scandal that has brought about an evolution of research ... performance although it is not a comprehensive indicator of CEO performance The authors argue that this indicator is a more precise measure of CEO performance than accounting performance measures...
- 132
- 640
- 0
Computer illiteracy as one of the main problem of business student
... that to call to more advanced friend and ask him for help is more easy, than try itself to understand it Waste time - is the main problem of student who spend a lot of time and force for solving ... something on computer for them, instead of learning how to it themselves The third cause is lack of access to computer The fourth cause is dissatisfactory school base The fifth cause is insufficient ... problem of computer illiteracy is the lack of useful information in the course of information science The second cause is unwillingness to learning - many people think that easier to ask someone...
- 4
- 351
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008