the feature similarity gain model of attention unifying multiplicative effects of spatial and feature based attention pages 300 304 julio c martinez trujillo and stefan treue pdf
Báo cáo " MODEL OF CONDUCTIVITY FOR PEROVSKITES BASED ON THE SCALING PROPERTY OF GRAIN BOUNDARY " ppt
... the drop of the activation energy when the temperature decreases This argues for the change in conduction mechanism away from the bandwidth-controlled conduction to the possible boundary-controlled ... Model of conductivity for perovskites based on 53 Table summarizes the measurement details and results (D, f, L and L ) For the calculation of f , the percolation threshold concentration xc ... only if excluding the case x = 0.00 Conclusions This work is the first of its kind to apply the fractal analysis to study the boundary conduction in perovskites The use of the fractal technique...
- 8
- 324
- 0
Báo cáo hóa học: " On the stability of the exact solutions of the dual-phase lagging model of heat conduction" docx
... Authors’ contributions JOM carried out the mathematical calculations, participated in the interpretations of the results and drafted the manuscript JJAG conceived of the study, participated in the ... physically unacceptable This divergent behavior of the temperature, in the DPL model at long times, is the direct consequence of having introduced the phase lags Even though the effects of these ... the grains and their interface thermal resistance The thermal conductivity is an intrinsic property of each material which measures its ability for the transfer of heat and is determined by the...
- 6
- 299
- 0
Báo cáo y học: "β Treatment with recombinant interferon-β reduces inflammation and slows cartilage destruction in the collagen-induced arthritis model of rheumatoid arthritis" ppt
... Switzerland) was performed and the percentage of pyknotic nuclei was calculated by microscopic analysis to represent the amount of apoptosis This technique is comparable to the Pappenheim technique ... Immunohistochemical analysis of the number of cells positive for RANKL (receptor activator of NF-κB ligand) and c- Fos after days of IFN-β treatment in CIA mice Sections were scored on a 4-point scale ... to determine the effect of IFN-β on the total numbers of T cells, B cells, macrophages, and granulocytes We found no clear differences in the total numbers of T cells and B cells in the animals...
- 11
- 345
- 0
Báo cáo y học: " Protective effect of vasoactive intestinal peptide on bone destruction in the collagen-induced arthritis model of rheumatoid arthritis" pptx
... 5'-CCTCAAAGCTCAGCGTGTCC-3' 5'-GAGCTCACTTTTGCGCCAAG-3' COX-2 NM011198 854–954 COX-2.for COX-2.rev 5'-GGTGGAGAGGTGTATCCCCC-3' 5'-ACTTCCTGCCCCACAGCA-3' iNOS NM010927 872–972 iNOS.for iNOS.rev 5'-AACAATGGCAACATCAGGTCG-3' ... 5'-AACAATGGCAACATCAGGTCG-3' 5'-CCAGCGTACCGGATGAGCT-3' OPG U94331 831–931 OPG.for OPG.rev 5'-AGAGCAAACCTTCCAGCTGC-3' 5'-CGCTGCTTTCACAGAGGTCA-3' RANK AF19046 1422–1440 RANK.for RANK.rev 5'-TGCCTACAGCATGGGCTTT-3' ... 5'-AGAGGGAAATCGTGCGTGAC-3' 5'-CAATAGTGATGACCTGGCCGT-3' IL-11 NM008350 350–450 IL-11.for IL-11.rev 5'-TGATGTCCTACCTCCGGCAT-3' 5'-TTCCAGTCGGGCTTGCAG-3' IL-17 NM010552 146–246 IL-17.for IL-17.rev 5'-CCTCAAAGCTCAGCGTGTCC-3'...
- 12
- 418
- 0
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc
... that of β-actin The primer sequences used were as follows: IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC TGF-β1, TGGACCGCAACAACGCCATCTATGAGAAAACC and TGGAGCTGAAGCAATAGTTGGTATCCAGGGCT ... TGGAGCTGAAGCAATAGTTGGTATCCAGGGCT β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Mixed lymphocyte reaction (MLR) and in-vitro cytokine production CD4+ T cells and CD1 1c+ dendritic cells (DCs) were ... Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan (No 15591071) References LeRoy EC: A brief overview of the pathogenesis of scleroderma (systemic sclerosis)...
- 7
- 399
- 0
Retrovirology Commentary BioMed Central Open Access The co-receptor signaling model of HIV-1 ppt
... cells This cofilin activation increases cortical actin treadmilling and actin dynamics, permitting viral migration across the cortical actin barrier [5] Given the critical role that CXCR4 signaling ... of infected cells co-exist, and some of these cells, such as infected monocytes and memory T cells, have a slow decay rate [48] These cells may serve as the seeds for the development of the R5X4-signaling ... target of gp120CXCR4 interaction, and its activation facilitates viral infection Nevertheless, clinical studies are required to determine whether activation of cofilin or any other CXCR4 downstream...
- 6
- 192
- 0
Báo cáo y học: " Mathematical model of blunt injury to the vascular wall via formation of rouleaux and changes in local hemodynamic and rheological factors. Implications for the mechanism of traumatic myocardial infarction" pot
... the particles and their collisions with each other and with the solid walls have substantial effects on the effective viscosity and other rheological characteristics of the mixture [8,9] The problems ... buoyancy force, p- pressure difference, χ(m)- coefficient of constraint, ρ- density of the first phase, K(µ) – coefficient of phase interaction, µ1 and µ2 – viscosi- ties of the first and second ... velocities (slippage) u1 - u2, the particle size a, the quantities and shapes of inclusions, and the physical properties of the phases (see equation 1) (The effects of the shape and multiplicity...
- 10
- 345
- 0
Role of SPHK2S1P signalling in regulating mitochondrial function in the MPTP induced mouse model of parkinsons disease and in the MPP treated MN9D cells
... Excitotoxicity Inspite of the specific ultrastructural findings connected with dynamic excitotoxicdegeneration; there are no speci c pathological characteristics of excitotoxicity However, there ... pathological characteristic that is classic of PD is the occurrence of intraneuronalproteinacious cytoplasmic inclusions, termed “Lewy Bodies” (LBs) which accumulates mainly in the cell bodies of surviving ... pathological characteristic of PD involves the loss of the dopaminergic (DA) neurons The DA neurons of the substantia nigra contains conspicuous amount of neuromelanin (Zucca et al., 2014) The loss of...
- 178
- 359
- 0
Tài liệu The Financial Crisis: A Timeline of Events and Policy Actions ppt
... company, to a commercial bank GMAC Bank is a direct subsidiary of IBFHC and an indirect subsidiary of GMAC LLC, a $211 billion company The Board cites “unusual and exigent circumstances affecting ... securities The Board also expands the list of collateral accepted by TSLF to include all investment-grade debt securities and increases the frequency of Schedule TSLF auctions and total offering ... insurance in the event of a bank failure December 11, 2008 | NBER Press Release The Business Cycle Dating Committee of the National Bureau of Economic Research announces that a peak in U.S economic...
- 32
- 427
- 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf
... clinics Martin ACH and Blanchfield ACH have numerous primary care/family practice clinics and troop medical clinics (TMCs) Sites vary widely in their access to and sophistication of computer support ... best practices for the management and treatment of the health condition it addresses, and it takes into account the strength of relevant scientific evidence, which is documented in the practice guideline ... Implementation of the Asthma Practice Guideline in AMEDD actions to introduce and sustain improved clinical practices, as well as effects on clinical practice indicators Other Lessons from the Demonstration...
- 212
- 442
- 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc
... Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA TAGGCAGACTGACCCGGGAGCTGCTCGTAC Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC ... TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA AGAAGCTCCATGTAGCAAGGCTAG CTAGCCTTGCTAGGACATCTTCCG CGGAAGATGTCCATCTGTTGTAGG Bio-AAAAAACCTACAACAGATCATGGAGCTTCT previous values ... Oligodeoxynucleotides Name Sequence (5¢-3¢) ASP1 ASP2 DU1 DU2 HJ5 HJ6 HJ7 HJ8 HJ1 HJ2 HJ3 HJ4 Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA...
- 10
- 672
- 0
REINCARNATION AND THE LAW OF KARMA A STUDY OF THE OLD-NEW WORLD-DOCTRINE OF REBIRTH, AND SPIRITUAL CAUSE AND EFFECT potx
... land of mystery the home of the mystics and occultists of the past the land of Isis the home of the builders of the Pyramids the people of the Sphinx Whether these people were the direct descendants ... Personal Conscious Experience Demanded by Science—Such Proofs Possible and Have Occurred to Many of the Race The Remembrance of the Details of Past Existence Common to the Race—Interesting Cases ... that the Purusha, or Spirit, not the Mind, is the Real Self, and the source of consciousness and the real intelligence The practical teachings of the school of Patanjali is a system by which the...
- 125
- 648
- 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx
... Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC ... where they activate the caspase cascade and subsequently cause cell death HSP70 can inhibit the release of cytochrome c and AIF from mitochondria and prevent subsequent cell death [21,23] In the ... h, and then stained with Hoechst 33258 Under a fluorescence microscope, apoptotic cells, which contained condensed chromatin fragments, were scored and expressed as a percentage of the total cell...
- 10
- 726
- 0
Báo cáo khoa học: "Bootstrapping a Unified Model of Lexical and Phonetic Acquisition" potx
... would then need to recompute most of the other scores, since merging u and v ∗ (u) affects other words for which u and v ∗ (u) are candidates, and also words for which they appear in the context ... corpus, while still maintaining the lexical characteristics of infant-directed speech (as compared to the Buckeye corpus, with its much larger vocabulary and more complex language model) We conduct ... a lexicon In Proceedings of the 31st Annual Conference of the Cognitive Science Society (CogSci) Naomi Feldman 2011 Interactions between word and speech sound categorization in language acquisition...
- 10
- 498
- 0
The Facts on File Encyclopedia of Health and Medicine
... hours Doctors believe calcifications called otoconia, small “stones” of calcium carbonate, cause BPPV Otoconia occur naturally in the utricle and saccule, two of the structures within the inner ... interpretations The functions of breathing and swallowing share the structures of the throat The chamber at the back of the mouth and the top of the throat is the pharynx; it receives both air and food ... square inch of pressure as the TEETH come together to bite and in excess of 3,500 pounds per square inch of force at the back teeth (molars) with chewing The hyoid bone helps anchor the back of the...
- 1,829
- 4,948
- 0
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx
... the character unigram and bigram for each word type and part of speech, f(ci) and f(cilci_l) are the relative frequencies of the character unigram and bigram V is the number of characters (not ... Automatic construction of a Chinese electronic dictionary In Proceedings of the Third Workshop on Very Large Corpora, pages 107-120 EDR 1991 EDR electronic dictionary version technical guide Technical ... for modeling the morphology of Japanese words 4.3 P a r t of Speech P r e d i c t i o n A c c u r a c y without Context Figure shows the part of speech prediction accuracy of two unknown word model...
- 8
- 397
- 0
Báo cáo khoa học: "Towards a model of formal and informal address in English" pdf
... 10 Context size (n) Figure 2: Accuracy vs number of sentences in context (empty circles: sentence context; solid circles: direct speech context) together utterances by different speakers and can ... indeed a major challenge, and context can become large before the effects mentioned in Section 5.3 counteract the positive effect of more data Direct speech context outperforms sentence context throughout, ... another in terms of their occurrences in the document and are useful in Named Entity Recognition (Finkel and Manning, 2009) As features in the T/V classification of a given sentence, we simply count...
- 11
- 562
- 0
Báo cáo khoa học: "A Ranking Model of Proximal and Structural Text Retrieval Based on Region Algebra" ppt
... of the query A op B is: scAopB = C( A) + C( B) C( A op B) C( A) + C( B) and when the operator op is Ê or Ă, the structure coefcient of the query A op B is: scAopB = C( A) C( A op B) C( A) where A and ... combination of the measure of the query itself and the measure of the subqueries Although we calculate the score of extents by subqueries instead of using only the whole query, the score of subqueries can ... at model and the results of the exact model depending on the value of 4.2 OHSUMED test collection The OHSUMED test collection is a document set composed of paper abstracts in the eld of biomed-...
- 8
- 419
- 0
Báo cáo khoa học: "A Probabilistic Model of Syntactic and Semantic Acquisition from Child-Directed Utterances and their Meanings" pot
... set of category splits Each category split is a pair of CCG categories (Cl : ml , Cr : mr ) that can be recombined to give X : h using one of the CCG combinators in Section 2.2 The CCG category ... procedure has two parts: logical splitting of the category semantics h; and syntactic splitting of the syntactic category X Each logical split of h is a pair of lambda expressions (f, g) in the ... semantic-type to basic CCG syntactic category As an example, the logical split in (9) supports two CCG category splits, one for each of the CCG application rules (NP/N:λy.a(x, y(x)), N:λx.cookie(x))...
- 11
- 403
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25