ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells Bimei Jiang 1 , Kangkai Wang 1 , Pengfei Liang 2 , Weimin Xiao 1 , Haiyun Wang 1 and Xianzhong Xiao 1 1 Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha, Hunan, China 2 Department of Burns and plastic surgery, Xiangya Hospital, Central South University, Changsha, Hunan, China Apoptosis is characterized by specific morphological and biochemical hallmarks, including cell shrinkage, membrane blebbing, nuclear breakdown and DNA fragmentation. As a form of programmed cell death, it is indispensable for many normal cellular functions, such as embryo development, tissue homeostasis and regulation of the immune system [1]. Malfunctions of apoptosis have been implicated in human diseases, including myocardial infarction, neurodegenerative dis- eases, cancer and ischemic stroke [2–4]. Several factors, including ATP depletion, calcium fluxes and reactive oxygen species, have been proposed to cause apoptosis and ⁄ or cytochrome c release in myocytes [5,6]. Caspases, a family of cysteine proteases, are key components in mammalian apoptosis. They are present in cells as inactive precursors and are activated by proteolytic cleavage [7]. In mammals, mitochondrial damage induced by diverse extracellular stress causes the release of cytochrome c from the mitochondria into the cytoplasm [8]. In the cytosol, cytochrome c associates with apoptosis protease-activating factor-1 (Apaf-1) and then binds to and activates caspase-9 in the presence of dATP ⁄ ATP [9]. This leads to proteo- lytic activation of a common set of downstream prote- ases, including caspases-3 and -7, and subsequent cell death. It has recently been shown that a novel Keywords apoptosis; heat shock protein 70; hydrogen peroxide; mitochondria; Smac Correspondence X. Xiao, Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha, Hunan 410008, China Fax ⁄ Tel: +86 731 2355019 E-mail: xianzhongxiao@126.com (Received 8 December 2008, revised 14 February 2009, accepted 2 March 2009) doi:10.1111/j.1742-4658.2009.06989.x Hydrogen peroxide (H 2 O 2 ) is a well known oxidative stress inducer causing apoptosis of many cells. Previously, we have shown that heat shock pre- treatment blocked the release of the second mitochondria-derived activator of caspase (Smac) to the cytosol and inhibited apoptosis of C2C12 myo- blast cells in response to H 2 O 2 . The present study aimed to elucidate the underlying mechanism by over-expressing a major stress-inducible protein, heat shock protein (HSP) 70, and characterizing the resulting cellular changes. We demonstrate that HSP70 over-expression markedly inhibited the release of Smac and prevented the activation of caspases-9 and -3 and apoptosis in C2C12 cells under H 2 O 2 treatment. However, no direct inter- action between HSP70 and Smac was observed by co-immunoprecipitation. Mutational analysis demonstrated that the ATP-binding domain of HSP70, rather than the peptide-binding domain, was essential for these observed HSP functions. Taken together, our results provide evidence supporting the role of HSP70 in the protection of C2C12 cells from H 2 O 2 -induced and Smac-promoted apoptosis by preventing the release of Smac from mito- chondria, thereby inhibiting activation of caspases-9 and -3. This mecha- nism of HSP70 action is dependent on its ATP-binding domain but independent of its interaction with Smac protein. Abbreviations AIF, apoptosis-inducing factor; Apaf-1, apoptotic protease activating factor-1; FITC, fluorescein isothiocyanate; HSP, heat shock protein; IAP, inhibitor of apoptosis protein; JNK, Jun kinase; PI, pyridine iodination; Smac, second mitochondria-derived activator of caspase. FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS 2615 mitochondrial protein, second mitochondria-derived activator of caspase (Smac, also known as DIABLO), is released into the cytosol in response to apoptotic stimuli, such as UVB irradiation, etoposide and gluco- corticoids [10,11]. Smac promotes caspase activation by eliminating inhibition of caspases by inhibitor of apoptosis protein (IAP) and is known to be a new and important regulator of apoptosis in a variety of cancer cells. The evidence obtained in our previous study also revealed a vital role for Smac in the apoptosis of myo- cytes induced by oxidative stress [12,13]. As a major stress-inducible heat shock protein, heat shock protein (HSP) 70 has been shown to protect cells from a number of apoptotic stimuli, including heat shock, tumor necrosis factor, growth factor with- drawal, oxidative stress and radiation [14,15]. Over- expression of HSP70, which is known to comprise a major self-preservation protein in the heart, has been reported to enhance myocardial tolerance to ischemia– reperfusion injury in transgenic animals [16]. Furthermore, HSP70 has been shown to exert its anti- apoptotic function downstream of cytochrome c release but upstream of caspase-3 activation along the stress- induced apoptosis pathway [17]. It prevents caspase-3 and stress-activated protein kinase ⁄ Jun kinase (JNK) activation [18] and mitochondrial depolarization [19], blocks apoptosome formation and activation of caspase-9 [20], and inhibits the release of apoptosis- inducing factor (AIF) from mitochondria [21]. In our previous study using mouse myogenic C2C12 cells, heat shock pretreatment also prevented apoptosis induced by oxidative stress [13]. However, whether the protective effects of HSP70 are mediated by a mecha- nism involving the release of Smac from mitochondria remains to be elucidated. To this end, in the present study, we over-expressed HSP70 and characterized the subsequent cellular changes using C2C12 as an in vitro system. Results Over-expression of HSP70 inhibits oxidative stress-induced release of Smac from mitochondria in C2C12 myogenic cells To explore the effect of the change in HSP70 protein expression on hydrogen peroxide (H 2 O 2 )-induced apoptosis, C2C12 myogenic cells were transfected with an expression vector with cDNA encoding the full- length HSP70 protein or the empty vector. After selection with G418, stably-transfected C2C12 cell lines that constitutively expressed human HSP70 were isolated. Two clones, termed HSP70-1 and HSP70-2, showing different levels of HSP70 proteins by immunoblot analysis were selected for further study (Fig. 1A). The levels of HSP70 expression in both C2C12 lines were similar or even below the elevated endogenous HSP70 expression induced by heat stress (Fig. 1A). The levels of Smac in the soluble cytoplasm and mitochondria were analyzed by western blot before and after exposure to 0.5 mm H 2 O 2 for 2 h. In the nontransfected control cells before heat shock, Smac was detected in the motichondrial fraction but not in the cytosolic fraction, consistent with its known subcel- lular location. After exposure of cells to H 2 O 2 for 2 h, Smac accumulated in the cytosol and the protein level dramatically increased by  30-fold compared to the control, as estimated by densitometry (Fig. 1B), indi- cating the release of Smac from mitochondria into the cytoplasm. Concordantly, the protein level in the mito- chondria was significantly decreased. In the transfected cells, HSP70 over-expression inhibited the release of Smac from mitochondria into the cytosol in a dose- dependent manner. Under the same conditions, the absence of another mitochondrial marker cytochrome oxidase subunit II in the cytosolic fractions indicated that mitochondrial integrity was preserved and translo- cation of Smac from mitochondria to the cytosol was not due to mitochondrial breakdown. Over-expression of HSP70 inhibits oxidative stress-induced apoptosis in C2C12 myogenic cells We next examined the effects of HSP70 over-expres- sion on oxidative stress-induced apoptosis in C2C12 myogenic cells. As shown in Fig. 2, after treatment with H 2 O 2 (0.5 mm) for different times, the vector- transfected control cells underwent apoptosis, as indi- cated by an apoptotic cell population in the flow cytometry analysis. The percentages of apoptotic cells were decreased in both of the HSP70 over-expressed lines, indicating that HSP70 over-expression protected cells from H 2 O 2 -induced cytotoxicity. The protective effects of HSP70 were correlated with the level of HSP70 expression because the clone with higher HSP70 expression demonstrated a more significant reduction of the apoptotic cell population (Fig. 2B). Furthermore, over-expression of HSP70 displayed an inhibitory effect on the activation of caspases-9 and -3 induced by H 2 O 2 , and such inhibition was also corre- lated with the level of HSP70 expression (Fig. 2A). The protective effect of HSP70 against H 2 O 2 -induced apoptosis was further verified by the decrease in DNA laddering in HSP70 over-expressed cells after H 2 O 2 treatment (Fig. 2C). ATP-binding domain of HSP70 inhibits Smac release B. Jiang et al. 2616 FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS No direct interaction between HSP70 and Smac Because HSP70 inhibited the release of Smac and apoptosis induced by H 2 O 2 in C2C12 myogenic cells, we tested whether HSP70 inhibited the release of Smac through direct interaction. As shown in Fig. 3, no direct interaction between HSP70 and Smac was detected in cell-free extracts prepared either from untreated control cells or H 2 O 2 -treated (0.5 mm for 2 h) cells, indicating that interaction with Smac is not required with respect to the role of HSP70 in the inhi- bition of the release of Smac and apoptosis. The role of the ATP-binding domain of HSP70 in the prevention of the release of Smac and apoptosis after exposure to H 2 O 2 To determine which region of HSP70 is responsible for its anti-apoptotic effects, C2C12 myogenic cells were transiently transfected with expressing plasmids pcDNA3.1-HSP70 WT , and pcDNA3.1-HSP70 DATP-BD or pcDNA3.1-HSP70 DPBD . First, correct protein expression from all cell lysates was confirmed by western blot analysis with HSP70 antibody, showing immunoreactive bands of the expected sizes (Fig. 4B). Next, whether the protective potency of HSP70 would be annulled by deletion of the ATP-binding domain or the peptide-binding domain was investigated. As shown in Fig. 5, over-expression of both mutant HSP70 DPDB and full-length HSP70 WT similarly inhib- ited the release of Smac from mitochondria, but mutant HSP70 DATP-BD lost its ability to inhibit the release of Smac. These results suggest that the ATP- binding domain is required for prevention of the release of Smac from mitochondria. Similarly, over-expression of HSP70 DPDB behaved similarly to full-length HSP70 (HSP70 WT ) in other functional assays, including the inhibition of the acti- vation of caspases-9 and -3 (Fig. 6A) after exposure to H 2 O 2 for 8 h, as well as the inhibition of H 2 O 2 - induced apoptosis as assessed by the percentage of apoptotic cells (P < 0.05) (Fig. 6B) and cell viability (Fig. 6C). By contrast, in these experiments conducted under the same treatment conditions, HSP70 DATP-BD over-expression abolished the function of full-length HSP70 (P < 0.05). No toxic effects were observed after transfection with the vectors described above. Discussion Our previous study demonstrated that heat shock pre- treatment led to the up-regulation of HSP70 expression and the inhibition of H 2 O 2 -mediated Smac release and pcDNA3.1 A B HSP70-1 HSP70-2 HS HSP70 GAPDH * ## HSP70-1 HSP70-2 pcDNA3.1 pcDNA3.1 0 pcDNA3.1 HSP70-1 HSP70-2 HS Ratio of HSP70 to GAPDH 2 4 6 8 10 12 14 H 2 O 2 Smac COXII Loading control * # # Cyto 60 pcDNA3.1 pcDNA3.1 + H 2 O 2 HSP70-1 + H 2 O 2 HSP70-2 + H 2 O 2 50 40 30 20 10 0 C y to Mit Ratio of Smac to loading control Mit Cyto Mit Cyto Mit Cyto Mit Fig. 1. Over-expression of HSP70 inhibited H 2 O 2 -induced Smac release in C2C12 cells. (A) Cell lysates from C2C12 clones over-expressing HSP70 or vector control plasmid (pcDNA3.1) were immunoblotted with monoclonal anti-HSP70 serum. Immunoblot analysis of b-actin was used as the loading control. A representative experiment is shown. Hybridization signals were quantified and nor- malized to GAPDH signals and are presented as the fold increase over the respective controls. HS, Heat stress. (B) Vector control (pcDNA3.1) and HSP70-over-expressing (HSP70-1, HSP70-2) C2C12 cells were either kept untreated or treated with 0.5 m M of H 2 O 2 for 2 h, then harvested, lysed under conditions that kept mitochondria intact, and centrifuged to obtain a supernatant (Cyto) and a pellet fraction (Mit) as described in the Experimental procedures. The presence of Smac in the different fractions was determined by immunoblot analysis. Mitochondrial protein cytochrome oxidase subunit II was used as a marker of mitochondrial protein and Ponceau S staining was used as the loading control. Hybridization signals were quantified and normalized to GAPDH signals and are presented as the fold increase over the respective controls. *Signifi- cant difference (P < 0.05) compared to the pcDNA3.1 control group. B. Jiang et al. ATP-binding domain of HSP70 inhibits Smac release FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS 2617 apoptosis in C2C12 myogenic cells [12], although the correlation between the two events remains unknown. In the present follow-up study, we engineered two C2C12 cell lines with constitutive HSP70 expression at a level similar to that of the endogenous proteins induced by heat shock. This system mimics the anti- apoptotic effects of heat shock and is very instrumen- tal with respect to our investigation of the role of HSP70. The results demonstrate that H 2 O 2 treatment induced C2C12 cell apoptosis; however, HSP70 over- expression significantly prevented such stress-induced apoptosis. Because these effects were similar to those of our previous observations for the same cells under- going heat-shock, HSP70 is most likely to be the key 0 Caspase-3 pcDNA3.1 PI pcDNA3.1 + H 2 O 2 10 1 10 2 10 3 10 4 10 1 10 2 10 3 10 4 10 1 10 0 45 Annexin V-FITC 40 35 30 25 20 15 10 5 0 * # # pcDNA3.1 HSP70-1 HSP70-2 pcDNA3.1 + H 2 O 2 HSP70-1 + H 2 O 2 HSP70-2 + H 2 O 2 % Apoptotic cells 10 2 10 3 10 4 10 1 10 0 10 2 10 3 10 4 10 1 10 0 10 2 10 3 10 4 Q1 Q2 Q4 Q3 Q1 Q2 Q4 Q3 Q1 Q2 Q4 Q3 Q1 Q2 Q4 Q3 Q1 Q2 Q4 Q3 Q1 Q2 Q4 Q3 HSP70-1 HSP70-1 + H 2 O 2 HSP70-2 HSP70-2 + H 2 O 2 Caspase-9 pcDNA3.1 MpcDNA3.1 1 2 pcDNA3.1 HSP70 HSP70 0.5m M H 2 O 2 1 2 pcDNA3.1 + H 2 O 2 HSP70-1 + H 2 O 2 HSP70-2 + H 2 O 2 500 bp 300 bp 100 bp HSP70-1 HSP70-2 Caspases activity (folds) 0.5 1 1.5 2 2.5 3 3.5 A B C * * # # # # Fig. 2. Over-expression of HSP70 inhibited H 2 O 2 -induced apoptosis in C2C12 cells. (A) Cells over-expressing HSP70 and its deletion mutants were treated with or without 0.5 m M of H 2 O 2 for 8 h. Cells were harvested and cell lysates were assayed for protease activity of caspases-9 or -3 using caspase fluorescent assay kits, and apoptotic cells were identified by elevated activation of caspases-9 and -3. The experiment was repeated three times, with similar results being obtained in each case. Data are the mean ± SEM of triplicate samples. (B) Cells were exposed to 0.5 m M H 2 O 2 for 24 h. Cells were then processed for annexin V-FITC and pyridine iodination (PI) co-staining and ana- lyzed by flow cytometry. Q3 cells were regarded as control cells, whereas Q4 cells were considered as a measure of early apoptosis, Q2 cells were considered as cells at late apoptosis and Q1 cells were considered as being under necrosis. Next, quantitation of apoptotic cells was determined. Results are representative of three independent experiments. Data are the mean ± SEM of triplicate samples. *Significant difference (P < 0.05) compared to the pcDNA3.1 control group; #Significant difference (P < 0.05) compared to the group (*) that was signifi- cantly different from the pcDNA3.1 control group. (C) Cytosolic DNA was extracted from control and H 2 O 2 -exposed (24 h) C2C12 cells. DNA samples (4 lg) were electrophoresed on agarose gels to visualize DNA laddering. M, DNA marker. ATP-binding domain of HSP70 inhibits Smac release B. Jiang et al. 2618 FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS player mediating the anti-apoptotic effects, which is consistent with the general functional role of the chap- erone protein. Our previous studies demonstrated that H 2 O 2 at 0.5 mmolÆL )1 induced apoptosis significantly, but only affected a minimal number of cells (approxi- mately 10%). In the present study, we demonstrated that the levels of HSP70 protein expression in C2C12 myogenic cells stably transfected with the gene for HSP70 were as high as those in cells pretreated with heat shock, and that the ectopic expression of wild- type HSP70 inhibited not only H 2 O 2 -mediated Smac release, but also H 2 O 2 -induced apoptosis in transfected C2C12 cells. Furthermore, there was no direct interac- tion between HSP70 and Smac proteins, and the ATP-binding domain of HSP70, rather than the pep- tide-binding domain, was essential for this specific function of the protein. Recent studies have revealed that HSP70-mediated protection is essential for cells aiming to combat stress and avoid cell death [14,22]. As three key modulators responsible for apoptosis, cytochrome c, AIF and Smac are released into the cytosol during stress, where they activate the caspase cascade and subsequently cause cell death. HSP70 can inhibit the release of cytochrome c and AIF from mitochondria and prevent subsequent cell death [21,23]. In the present study, we demonstrated that HSP70 inhibited Smac release and the activation of caspases-9 and -3, thereby preventing DNA fragmenta- tion and apoptosis in cells under H 2 O 2 -induced oxida- tive stress. This is similar to the protective effects of another heat-shock protein, HSP27, against apoptosis, as previously reported [24]. The molecular chaperone HSP70 has been shown to inhibit stress-induced apoptosis by interacting with apoptotic-associated factors. For example, HSP70 directly interacts with JNK, resulting in the suppression of JNK-mediated apoptosis [25]. HSP70 physically interacts with Apaf-1, blocking Apaf-1 ⁄ cytochrome c-mediated caspase activation [20]. HSP70 also binds to and antagonizes AIF, thereby inhibiting HSP70 H S P7 0 + H 2 O 2 IB: HSP70 IB: Smac IgG Serum Lysate HSP70 Smac HSP70 Smac IP IP IP Fig. 3. No interaction was found between HSP70 and Smac. Vec- tor control (C2C12-C) and HSP70-over-expressing (C2C12-HSP70) cells were either kept untreated or treated with 0.5 m M of H 2 O 2 for 2 h. Cells were harvested and lysed. Next, whole-cell lysates were immunoprecipitated with polyclonal anti-HSP70 or polyclonal anti- Smac sera. Immunoprecipitations were further analyzed by immu- noblots probed with Smac antibody or polyclonal HSP70 antibody, respectively. HSP70 WT A B N ATP-BD ATP-BD EEVD C C C EEVD EEVD 1 383 542 646 N N HSP70 ΔAPBD HSP70 ΔATP-BD HSP70 WT 70 kDa IB: Hsp70 52 kDa 28 kDa IB: Actin HSP70 ’ΔPBD HSP70 ’ΔATP-BD PBD PBD Fig. 4. Deletion mutants of HSP70 were constructed and transf- ected. A schematic drawing is shown of the HSP70 deletion mutants employed in the present study. (A) Deleted amino acids are indicated by the dotted lines. ATP-BD, 1-383AA, 42 kDa; PBD, 384-542AA, 18 kDa. (B) Western blot analysis demonstrated the levels of expression of the HSP70 proteins after deletion mutants of HSP70 were transfected. Cyto Mit Cyto Mit Cyto Mit Cyto Mit pcDNA3.1 HSP70 WT HSP70 ΔPBD HSP70 ΔATP-BD H 2 O 2 2 h Smac COX II Loading control Fig. 5. The ATP-binding domain of HSP70 is the essential region for inhibition of Smac release. Cells over-expressing HSP70 or its deletion mutants were treated with 0.5 m M of H 2 O 2 for 2 h, har- vested, lysed under conditions that kept mitochondria intact, and then centrifuged to obtain a supernatant (Cyto) and a pellet fraction (Mit) as described in the Experimental procedures. Protein protein contents were determined by the Bradford assay (Bio-Rad, Hercules, CA, USA), and equal amounts of proteins (10–20 lg) were loaded in each lane and separated by SDS-PAGE. Levels of Smac in the different fractions were determined by immunoblot analysis. Cytochrome oxidase subunit II (COX II) was used as a marker of mitochondrial protein and Ponceau S staining was used to visulize equal protein loadings. B. Jiang et al. ATP-binding domain of HSP70 inhibits Smac release FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS 2619 caspase-independent apoptosis [23]. However, the results obtained in the present study suggest that the inhibitory effect of HSP70 on the release of Smac and H 2 O 2 -mediated and Smac-promoted apoptosis is not attributable to a direct physical interaction between HSP70 and Smac. HSP70 contains three functional regions: the ATP- binding domain, the peptide-binding domain, and the EEVD motif. Although the EEVD motif is considered to be involved in the chaperone function of HSP70, and was assumed to mediate cytoprotection by restor- ing damaged or unfolded proteins under stress, the roles of other domains of HSP70 in anti-apoptosis remain highly controversial. Some studies have pro- posed that the ATP-binding domain of human HSP70 is not required in HSP70-mediated JNK suppression, inhibition of cytochrome c release and caspase activa- tion, and protection of cells from injury [26]. By con- trast, other studies have shown that the ATP-binding domain of HSP70 is essential for its anti-apoptotic role. For example, deletional analysis demonstrated that the ATP-binding domain is essential for inhibiting the release of cytochrome c from mitochondria [27]. 3 A * * # # # # 2 2.5 1 1.5 0.5 Caspases activity (folds) 0 Caspase-3 70 60 50 40 * * # # # # pcDNA3.1 pcDNA3.1 + H 2 O 2 HSP70 + H 2 O 2 HSP70 ΔATP-BD + H 2 O 2 HSP70 ΔPBD + H 2 O 2 30 20 10 0 12 h 24 h Time (h) % Apoptotic cells B a cd e b pcDNA3.1 HSP70 + H 2 O 2 HSP70 ΔATP-BD + H 2 O 2 HSP70 ΔPBD + H 2 O 2 pcDNA3.1 + H 2 O 2 Caspase-9 pcDNA3.1 pcDNA3.1 + H 2 O 2 HSP70 + H 2 O 2 HSP70 ΔATP-BD + H 2 O 2 C 1.2 * # # 1 0.8 0.6 0.4 0.2 0 pcDNA3.1 pcDNA3.1 + H 2 O 2 Hsp70 + H 2 O 2 Hsp70 ΔATP-BD + H 2 O 2 Hsp70 Δ PBD + H 2 O 2 Cell viability HSP70 ΔPBD + H 2 O 2 Fig. 6. ATP-binding domain of HSP70 is essential for the inhibition of H 2 O 2 -induced activation of caspases-9 and -3 and apoptosis. (A) The effects of HSP70 and its deletion mutant proteins on the acti- vation of caspases-9 and -3 were analyzed. Cells over-expressing HSP70 and its deletion mutants were treated with or without 0.5 m M of H 2 O 2 for 8 h. Cells were harvested and cell lysates were assayed for protease activity of caspases-9 or -3 using caspase fluorescent assay kits. Data of caspase fluorescent assay were obtained from four independent experiments. *Significant differ- ence (P < 0.05) compared to the pcDNA3.1 control group; #Signifi- cant difference (P < 0.05) compared to the group (*) that was significantly different from the pcDNA3.1 control group (n = 8). (B) Measurement of percentages of apoptotic cells. Twenty-four hours after transfer, cells were treated with 0.5 m M H 2 O 2 for 12 or 24 h, and then stained with Hoechst 33258. Under a fluorescence micro- scope, apoptotic cells, which contained condensed chromatin frag- ments, were scored and expressed as a percentage of the total cell number counted. Data are the mean ± SEM. *Significant differ- ence (P < 0.05) compared to the pcDNA3.1 control group; #Signifi- cant difference (P < 0.05) compared to the group (*) that was significantly different from the pcDNA3.1 control group (n = 5). (a–f) Cells incubated with H 2 O 2 for 24 h. (C) Determination of cell viability. Approximately 2000 cells were plated in each well of 96-well plates. After 24 h of incubation, 0.5 m M of H 2 O 2 was added and cell viability was measured by an 3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyl-tetrazolium bromide assay after exposure to H 2 O 2 for 24 h. The experiment was repeated three times, with essentially the same results being obtained in each case. Data are the mean ± SEM of triplicate samples. *Significant difference (P < 0.05) compared to the pcDNA3.1 control group; #Significant difference (P < 0.05) compared to the group (*) that was signifi- cantly different from the pcDNA3.1 control group (n = 5). ATP-binding domain of HSP70 inhibits Smac release B. Jiang et al. 2620 FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS The ATP-binding domain of HSP70 is important for the interaction of HSP70 with apoptosis signal- regulating kinase 1 (ASK1) and the inhibition of ASK1-induced apoptosis in vitro [28]. Furthermore, the ATP-binding domain of HSP70 is critical for sequester- ing AIF in the cytosol [29]. In the present study, we demonstrated that the ATP-binding domain of HSP70 was indispensable for inhibition of Smac release from mitochondria as well as apoptotic events in C2C12 myogenic cells. The molecular mechanism by which HSP70 and HSP70 DPBD interfere with Smac release and apoptosis induced by oxidative-stress is still not fully understood. The mitochondrial pathway of cell death is controlled by Bcl-2 family proteins, a group of anti-apoptotic and pro-apoptotic proteins that regulate the passage of small molecules such as cytochrome c, Smac ⁄ DIABLO and apoptosis-inducing factor (which activate caspase cascades) through the mitochondrial transition pore [30]. Bcl-2 is the prototype of the bcl-2 family of proteins and is distributed in the mitochondria, endoplasmic reticulum and nuclear envelope. With a well-established role with respect to protecting cells against a variety of apoptotic stimuli, it mainly acts at the mitochondrial level [31]. A previous study [32] demonstrated that HSP70 inhibits heat-induced apop- tosis by preventing Bax translocation. Furthermore, over-expression of HSP70 was associated with reduced apoptotic cell death and an increased expression of the anti-apoptotic protein, Bcl-2 [33]. On the basis of the available evidence, HSP70 and HSP70 DPBD may also suppress Smac release and apoptosis by regulating the expression of these pro-apoptotic or anti-apoptotic bcl-2 family proteins. In summary, using the H 2 O 2 -induced oxidative stress model, the present study has revealed an important anti-apoptotic role of HSP70, which comprises a mechanism that involves the inhibition of Smac release from mitochondria, and the suppression of caspase activation. Such a mechanism is independent of the interaction of HSP70 with Smac but requires the ATP-binding domain of the protein. However, it remains to be determined how these findings are connected with the known functions of many other cellular molecules. Experimental procedures Cell culture and treatment C2C12 myogenic cells were cultured in DMEM supple- mented with 10% heat-inactivated fetal bovine serum at 37 °C in the presence of 5% CO 2 under a humidified atmo- sphere. H 2 O 2 diluted in NaCl ⁄ P i (137 mm NaCl, 2.68 mm KCl, 10 mm Na 2 HPO 4 , 1.76 mm KH 2 PO 4 , pH = 7.4) was used in the medium at a final concentration of 0.5 mm. Heat shock treatment Subconfluent cultured cells in 50-mm dishes were subjected to hyperthermia of 42 ± 0.3 °C for 1 h in a water bath before being allowed to recover for 12 h at 37 °Cina humidified atmosphere containing 5% CO 2 . As a control, cells were cultured under normal conditions without hyper- thermia. Construction of HSP70 and its truncated mutants Full-length human HSP70 cDNA was obtained as a gener- ous gift from I. Benjemin (University of Utah Health Sciences Center, Salt Lake City, UT, USA) It was direc- tionally cloned between KpnI and BamHI sites into the mammalian expression vector pcDNA3.1(-)-His-myc. At the same time, this cDNA was used as the template for PCR amplification of two HSP70 truncated mutants with deletion of the ATP-binding domain (HSP70 DATP-BD )or the peptide-binding domain (HSP70 DPBD ) using primer pairs (Table 1). All DNA digested fragments were purified using a gel purification kit (Invitrogen, Carlsbad, CA, USA), and subsequently ligated into pcDNA3.1(-)-His-myc vector overnight at 4 °C with T4 DNA polymerase (Pro- mega, Madison, WI, USA). The correct insets were verified by sequencing and digestion. The final constructs were named pcDNA3.1-HSP70 WT , pcDNA3.1-HSP70 DATP-BD or pcDNA3.1-HSP70 DPBD (Fig. 4A). Table 1. Sequences of primers used to construct pcDNA3.1-HSP70WT, pcDNA3.1-HSP70 DATP-BD or pcDNA3.1-HSP70 DPBD plasmids. Primers Sequence (5¢-to3¢) Sense of pcDNA3.1-HSP70 WT AAAAGGATCCAAATGGCCAAAGCCGCGGCG Antisense of pcDNA3.1-HSP70 WT TCGGGTACCGGATCTACCTCCTCAATGGTG Sense of pcDNA3.1-HSP70 DPBD CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC Antisense of pcDNA3.1-HSP70 DPBD GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG Sense of pcDNA3.1-HSP70 DATP-BD AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC Antisense of pcDNA3.1-HSP70 DATP-BD TCGGGTACCGGATCTACCTCCTCAATGGTG B. Jiang et al. ATP-binding domain of HSP70 inhibits Smac release FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS 2621 Lipofectamine-mediated gene transfection C2C12 myogenic cells were cultured to sub-confluence and transfected with each of the expression plasmids manufac- tured as described in the above steps, or the empty vector without the cDNA (control) with a Lipofectamine-mediated method (Lipofectamine 2000, Invitrogen), as described previously [13]. Preparation of mitochondrial and cytosolic fractions The subcellular fractions of C2C12 myogenic cells treated with or without H 2 O 2 were isolated as described previously [13]. Western blot analysis Western blotting with anti-HSP70 and anti-Smac sera was performed as described previously [34]. Caspase activity assay Caspase activation was determined according to the method described previously [13]. Flow cytometric analysis Both adherent and floating cells were collected after treat- ment, washed with ice-cold NaCl ⁄ P i , and stained with fluorescein isothiocyanate (FITC)-conjugated annexin V (BD Biosciences, Franklin Lakes, NJ, USA) and pyridine iodination (PI) for 20 min at room temperature in the dark. The stained cells were then analyzed by a flow cytometer (Beckman Coulter, Fullerton, CA, USA). FITC-conjugated annexin V binds to phosphatidylserine molecules present only at the surface of apoptotic cells but not non-apoptotic cells due to the loss of plasma membrane asymmetry early in apoptosis. Cells were simultaneously stained with PI to discriminate membrane-permeable necrotic cells from FITC- labeled apoptotic cells. Apoptotic cells were identified as those with positive staining only to annexin V-FITC and not to PI, and the results were expressed as the proportion of these cells among the total number of cells analyzed. Hoechst 33258 staining Hoechst 33258 staining was performed as described previ- ously [12,13]. Detection of DNA fragmentation Floating and adherent cells (5 · 10 7 ) were combined and pelleted by centrifugation at 400 g for 5 min, and washed twice with NaCl ⁄ P i . Cell pellets were resuspended in 200 lL of lysis buffer [10 mm Tris–HCl (pH 8.0), 10 mm EDTA, 0.5% Triton X-100 and 0.1 mgÆmL )1 RNase A] and incu- bated at 37 °C for 1 h. Cell lysates were then treated with protease K (0.2 mgÆmL )1 )at54°C for 30 min. The genomic DNA was isolated by two with two rounds of phenol–chlo- roform extraction followed by an additional chloroform extraction. DNA pellet was then washed in 70% ethanol and resuspended in 1 mm EDTA and 10 mm Tris–HCl (pH 8.0) at a final concentration of 20 lgÆmL )1 . Aliquots were electrophoresed on a 1.5% agarose gel containing ethi- dium bromide, and photographed under UV illumination. A GeneRuler 100 bp DNA ladder (MBI Fermentas, Hanover, MD, USA) was utilized as DNA size marker. Co-immunoprecipitation assay For co-immunoprecipitation, transiently transfected C2C12 cells were lyzed with pre-cold RIPA buffer (150 mmolÆL )1 NaCl, 1% NP40, 0.5% deoxycholic acid sodium salt, 0.1% SDS, 50 mmolÆL )1 Tris pH 8.0, 1 mm phenylmethanesulfo- nyl fluoride and complete protease inhibitor tablet) at 4 °C for 5 min. To reduce nonspecific combination, lysates con- taining 500 lg of total protein were pre-immunized with 25 lL of a slurry of protein A ⁄ G coupled to agarose beads (Invitrogen) overnight at 4 °C on a rotating wheel. Aliquots of the pre-cleared supernatants were then each incubated with 2 lg of appropriate mouse monoclonal anti-HSP70 serum, polyclonal rabbit anti-Smac serum (R&D Systems, Minneapolis, MN, USA), normal mouse immunoglobu- lin G (control for anti-HSP70) or normal rabbit serum (control for anti-Smac) added into 25 lL of protein A ⁄ G slurry coupled to agarose beads (Invitrogen) for 5 h at 4 °C on a rotating wheel. Protein A ⁄ G beads were collected by centrifugation at 4 °C followed by a total of four additional washes lysis buffer containing 200 mm NaCl. Immune com- plexes were eluted by twice by sample buffer (2% SDS, 2 m 2-mercaptoethanol) after boiling at 100 ° C for 10 min. Proteins were separated by electrophoresis on SDS-PAGE followed by immunoblotting with polyclonal anti-HSP70 and anti-Smac sera, as described previously [24]. As the controls of total antigens in the lysates before co-immuno- precipitation, portions of lysates (1 : 20) were also resolved on SDS-PAGE and immunoblotted with anti-HSP70 or anti-Smac sera. Cell viability assay To determine cell viability, 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyl-tetrazolium bromide (0.5 mg) was added to 1 mL of cell suspension (1 · 10 6 cellsÆmL )1 in 24-well plates). After 4 h of incubation, cells were washed three times with NaCl ⁄ P i (pH 7.4). The insoluble formazan product was dissolved in dimethylsulfoxide and D 490 of each culture well was then measured using a microplate reader (Titertek Multiskan Plus, Flow Laboratories, ATP-binding domain of HSP70 inhibits Smac release B. Jiang et al. 2622 FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS McClean, VA, USA). The attenuance of formazan formed in control cells was considered as 100% viability. Statistical analysis Data are expressed as the mean ± SEM of the indicated number of separate experiments. Differences between two groups were analyzed using an unpaired Student’s t-test. Differences among three or more groups were analyzed by one-way analysis of variance followed by the Student–New- man–Keuls post-hoc test. P < 0.05 was considered statisti- cally significant. Acknowledgements This study was supported by the grants from the National Basic Research Program of China (2007CB512007), the National Natural Science Foun- dation of China (30700290) and Special Funds for PhD Training from the Ministry of Education of China (20060533009). References 1 Steller H (1995) Mechanisms and genes of cellular suicide. Science 267, 1445–1449. 2 Shishido T, Woo CH, Ding B, McClain C, Molina CA, Yan C, Yang J & Abe J (2008) Effects of MEK5 ⁄ ERK5 association on small ubiquitin-related modification of ERK5: implications for diabetic ventric- ular dysfunction after myocardial infarction. Circ Res 102, 1416–1425. 3 Burke RE (2008) Programmed cell death and new dis- coveries in the genetics of parkinsonism. J Neurochem 104, 875–890. 4 Engel T, Kannenberg F, Fobker M, Nofer JR, Bode G, Lueken A, Assmann G & Seedorf U (2007) Expression of ATP binding cassette-transporter ABCG1 prevents cell death by transporting cytotoxic 7beta-hydroxycholesterol. FEBS Lett 581, 1673–1680. 5 Yaglom JA, Ekhterae D, Gabai VL & Sherman MY (2003) Regulation of necrosis of H9c2 myogenic cells upon transient energy deprivation. Rapid deenergization of mitochondria precedes necrosis and is controlled by reactive oxygen species, stress kinase JNK, HSP72 and ARC. J Biol Chem 278, 50483–50496. 6 Dougherty CJ, Kubasiak LA, Frazier DP, Li H, Xiong WC, Bishopric NH & Webster KA (2004) Mitochon- drial signals initiate the activation of c-Jun N-terminal kinase (JNK) by hypoxia-reoxygenation. FASEB J 18, 1060–1070. 7 Thornberry NA & Lazebnik Y (1998) Caspases: enemies within. Science 281, 1312–1316. 8 Sun XM, MacFarlane M, Zhuang J, Wolf BB, Green DR & Cohen GM (1999) Distinct caspase cascades are initiated in receptor-mediated and chemical-induced apoptosis. J Biol Chem 274, 5053–5060. 9 Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES & Wang X (1997) Cytochrome c and dATP-dependent formation of Apaf-1 ⁄ caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489. 10 Du C, Fang M, Li Y, Li L & Wang X (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102, 33–42. 11 Verhagen AM, Ekert PG, Pakusch M, Silke J, Connolly LM, Reid GE, Moritz RL, Simpson RJ & Vaux DL (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102, 43–53. 12 Jiang B, Xiao W, Shi Y, Liu M & Xiao X (2005) Role of Smac ⁄ DIABLO in hydrogen peroxide-induced apop- tosis in C2C12 myogenic cells. Free Radic Biol Med 39, 658–667. 13 Jiang B, Xiao W, Shi Y, Liu M & Xiao X (2005) Heat shock pretreatment inhibited the release of Smac ⁄ DIA- BLO from mitochondria and apoptosis induced by hydrogen peroxide in cardiomyocytes and C2C12 myogenic cells. Cell Stress Chaperones 10, 252–262. 14 Lui JC & Kong SK (2007) Heat shock protein 70 inhib- its the nuclear import of apoptosis-inducing factor to avoid DNA fragmentation in TF-1 cells during erythro- poiesis. FEBS Lett 581, 109–117. 15 Zhao Y, Wang W & Qian L (2007) Hsp70 may protect cardiomyocytes from stress-induced injury by inhibiting Fas-mediated apoptosis. Cell Stress Chaperones 12, 83– 95. 16 Jayakumar J, Suzuki K, Khan M, Smolenski RT, Farrell A, Latif N, Raisky O, Abunasra H, Sammut IA, Mur- tuza B et al. (2000) Gene therapy for myocardial protec- tion: transfection of donor hearts with heat shock protein 70 gene protects cardiac function against ischemia-reper- fusion injury. Circulation 102, III302–III306. 17 Li CY, Lee JS, Ko YG, Kim JI & Seo JS (2000) Heat shock protein 70 inhibits apoptosis downstream of cyto- chrome c release and upstream of caspase-3 activation. J Biol Chem 275, 25665–25671. 18 Lee JS, Lee JJ & Seo JS (2005) HSP70 deficiency results in activation of c-Jun N-terminal kinase, extracellular signal-regulated kinase, and caspase-3 in hyperosmolarity-induced apoptosis. J Biol Chem 280, 6634–6641. 19 Creagh EM, Carmody RJ & Cotter TG (2000) Heat shock protein 70 inhibits caspase-dependent and -inde- pendent apoptosis in Jurkat T cells. Exp Cell Res 257, 58–66. B. Jiang et al. ATP-binding domain of HSP70 inhibits Smac release FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS 2623 20 Saleh A, Srinivasula SM, Balkir L, Robbins PD & Alnemri ES (2000) Negative regulation of the Apaf-1 apoptosome by Hsp70. Nat Cell Biol 2, 476–483. 21 Ravagnan L, Gurbuxani S, Susin SA, Maisse C, Daugas E, Zamzami N, Mak T, Ja ¨ a ¨ ttela ¨ M, Penninger JM, Garri- do C et al. (2001) Heat-shock protein 70 antagonizes apoptosis-inducing factor. Nat Cell Biol 3, 839–843. 22 Feng X, Bonni S & Riabowol K (2006) HSP70 induc- tion by ING proteins sensitizes cells to tumor necrosis factor alpha receptor-mediated apoptosis. Mol Cell Biol 26, 9244–9255. 23 Didelot C, Schmitt E, Brunet M, Maingret L, Parcellier A & Garrido C (2006) Heat shock proteins: endogenous modulators of apoptotic cell death. Handb. Exp. Phar- macol. 26, 171–198. 24 Chauhan D, Li G, Hideshima T, Podar K, Mitsiades C, Mitsiades N, Catley L, Tai YT, Hayashi T, Shringarpure R et al. (2003) Hsp27 inhibits release of mitochondrial protein Smac in multiple myeloma cells and confers dexa- methasone resistance. Blood 102, 3379–3386. 25 Park HS, Lee JS, Huh SH, Seo JS & Choi EJ (2001) Hsp72 functions as a natural inhibitory protein of c-Jun N-terminal kinase. EMBO J 20, 446–456. 26 Mayer MP & Bukau B (2005) Hsp70 chaperones: cellu- lar functions and molecular mechanism. Cell Mol Life Sci 62, 670–684. 27 Mosser DD, Caron AW, Bourget L, Meriin AB, Sher- man MY, Morimoto RI & Massie B (2000) The chaper- one function of hsp70 is required for protection against stress-induced apoptosis. Mol Cell Biol 20, 7146–7159. 28 Park HS, Cho SG, Kim CK, Hwang HS, Noh KT, Kim MS, Huh SH, Kim MJ, Ryoo K, Kim EK et al. (2002) Heat shock protein hsp72 is a negative regulator of apoptosis signal-regulating kinase 1. Mol Cell Biol 22, 7721–7730. 29 Ruchalski K, Mao H, Li Z, Wang Z, Gillers S, Wang Y, Mosser DD, Gabai V, Schwartz JH & Borkan SC (2006) Distinct hsp70 domains mediate apoptosis-induc- ing factor release and nuclear accumulation. J Biol Chem 281, 7873–7880. 30 Kim R (2005) Recent advances in understanding the cell death pathways activated by anticancer therapy. Cancer 103, 1551–1560. 31 Scorrano L & Korsmeyer SJ (2003) Mechanisms of cytochrome c release by proapoptotic BCL-2 family members. Biochem Biophys Res Commun 304, 437– 444. 32 Stankiewicz AR, Lachapelle G, Foo CP, Radicioni SM & Mosser DD (2005) Hsp70 inhibits heat-induced apop- tosis upstream of mitochondria by preventing Bax translocation. J Biol Chem 280, 38729–38739. 33 Yenari MA, Liu J, Zheng Z, Vexler ZS, Lee JE & Giff- ard RG (2005) Antiapoptotic and anti-inflammatory mechanisms of heat-shock protein protection. Ann N Y Acad Sci 1053, 74–83. 34 Liang P, Jiang B, Yang X, Xiao X, Huang X, Long J, Zhang P, Zhang M, Xiao M, Xie T et al. (2008) The role of peroxisome proliferator-activated receptor- beta ⁄ delta in epidermal growth factor-induced HaCaT cell proliferation. Exp Cell Res 314, 3142–3151. ATP-binding domain of HSP70 inhibits Smac release B. Jiang et al. 2624 FEBS Journal 276 (2009) 2615–2624 ª 2009 The Authors Journal compilation ª 2009 FEBS . ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator. role of HSP70 in the inhi- bition of the release of Smac and apoptosis. The role of the ATP-binding domain of HSP70 in the prevention of the release of Smac