teaching learning pronunciation and a paradox
The reality of teaching and learning pronunciaton at Quynh Coi high school in Thai Binh problems and solutions = Thực trạng dạy và học ngữ âm tại trường PTTH Q
... pronunciation and a paradox 2.3.1.1 The importance of teaching and learning pronunciation Pronunciation is as important as any other aspects of language like syntax and vocabulary Some people may argue ... teaching/ learning pronunciation and a paradox 2.3.1.1 The importance of teaching and learning pronunciation 2.3.1.2 A paradox 2.3.2 Teachers’ roles in teaching pronunciation 2.3.3 Approaches, ... Teachers’ and students’ attitudes towards teaching and learning pronunciation Assuming that the consideration of the teachers’ and students’ attitude towards teaching and learning pronunciation...
- 54
- 775
- 1
Saudi College Students'''' Perception of Their Errors in Written English pot
... Scott, M S and G R Tucker (1974) Error analysis and English language strategies of Arab students Language Learning 24(1) 69-98 Senders, J W and N P Moray (1991) Human Error: Cause, Prediction and Reduction ... contrastive analysis should be revised and made less dependent on that analysis It looks more advantageous to employ authentic materials and when need be, teachers can draw their students’ attention ... Michigan Press Larsen-Freeman, D and M Long (1991) An Introduction to Second Language Acquisition Research New York: Longman Macnamara, J (1971) The cognitive strategies of language learning Paper...
- 20
- 596
- 1
Using dialogue and drama activities in teaching speaking skill to the 11th form students at nghen high scholl in ha tinh province
... and it can serve as an instrument for teaching skills and facts As all drama teachers and practitioners know, drama games are an invaluable resource for teachers, they fundamental for team building, ... Th Tho K4 8A1 English v Graduation thesis Abstract Aware of the importance of using dialogue and drama in communication and English speaking teaching and learning, the author has carried out ... learning and teaching English Speaking and using Dialogue and Drama at Nghen High School in Ha Tinh province Chapter named as Suggested Dialogue and Drama Activities for Speaking Classes at High Schools...
- 70
- 904
- 3
Comparison between students’ academic performance and their abilities in written English language skills: A Tanzanian perspective ppt
... Desai, Z and Qorro, M (Eds.), Language of instruction in Tanzania and South Africa, E&D Limited, Dar es Salaam, pp.14-34 Rajan, R., & Sumra, S (2010), “Are our children learning? ” Twaweza annual ... Tanzania and South Africa, E&D Limited, Dar es Salaam, pp 102-11 324 ISDS www.isdsnet.com International Journal of Development and Sustainability Vol.1 No.2 (2012): 306–326 Maleki, A and Zangani, ... co-official language and it was supposed to be taught as a compulsory subject in all primary schools (Mlama and Materu, 1978) In addition, English was also declared a language of instruction at post...
- 21
- 669
- 0
The Failure Report What Most People Do Wrong In Internet Marketing And How To Avoid Their Mistakes pdf
... less I am a master at creating a high quality product in to days I am a master at using free content through video and article marketing to drive traffic to my site And I'm a master at managing ... seminar, I'd already have an action plan on using that information, and have already completed several steps in it That means no more attending any other presentations I'd only break at night to ... Create at least two new product a month Advertise cheaply on certain websites, and with video and article marketing Push my affiliate program on the back end, and cross-sell my products Repeat...
- 6
- 398
- 0
difficulties encountered by second year students at thai nguyen university of agriculture and forestry in producing some english consonants
... 1.2.1 The native language The native language plays a very important role in learning a foreign language It affects a great deal of aspects, such as the way to achieve the ideas and the way of using ... irritation and misunderstanding for the hearer 1.2.5 Teaching and learning environment It can be undeniable for the important of teaching and learning environment to the second language learning As ... of pronunciation in language teaching, factors affecting pronunciation learning such as the native language, the learner background, pronunciation ability, motivation to learning English, teaching...
- 48
- 819
- 1
A study on the teachers' application of task-based method and the 10th form students' use of learning strategies in their listening lessons at Tran Phu High Sch
... communicative purpose and characteristically attempts to integrate such activities into a wider program of language teaching The latter, on the other hand, advances the claim that language is acquired ... use language In this case, the assumption is that learners will be able to analyze grammatical and lexical usage during the process of using the target language to communicate Grammar-Translation ... Grammar-Translation Method, we can see a clear relevance between how to teach (teaching method) and what to teach (syllabus) Theoretically, all the grammar rules, lists of vocabulary as well as...
- 69
- 833
- 0
Common Errors and their Causes in Paragraph Writing Tasks by E.F.L. Second- year Students at Ha Hoa Tien University Các lỗi thường gặp và nguyên nhân mắc lỗi kh
... that develop a point on an idea Further he explains that the important feature of paragraph is that it has unity when all of its sentences are related to the main point So, a paragraph is a group ... interference “was commonly believed until fairly recently that learning a language (a mother tongue or a foreign language) was a matter of habit formation Beside forms, meanings and cultural aspects ... their native language and culture to the foreign language and culture" Generally there are four major factors that may enable FL learners to use their native language in second language acquisition...
- 55
- 625
- 1
Using short activities and game in the post speaking stage to increase grade 11 A4 students interets at Chan Mong hight school, Phu Tho Province
... Communicative Language Teaching (CLT) is an approach to the teaching of second and foreign languages that emphasizes interaction as both the means and the ultimate goal of learning a language It ... communicative activities) really play an important part in language teaching and learning Their role in language teaching and learning has been confirmed by many researchers Rodgers (2001) holds that “communicative ... communicative activities are a necessary part in language teaching and learning because they have a lot of advantages Firstly, short activities and games encourage students’ interest because they...
- 69
- 1,978
- 4
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan
... Hiroshima, and others Therefore, it is considered that a large amount of pollutants runs into the sea from the urban as well as industrial areas As the area around the Seto Inland Sea has a small amount ... 9, No.2, 2011 Watanabe M F., Harada K-I., Carmichael W W and Fujiki H., pp.35-56, CRC Press, Boca Raton Yagi O., Okada M., Sudo R., Hagiwara T and Takamura Y (1981) Growth characteristics of ... Association (AWWA)/Water Environment Federation (WEF) (1998) Standard Methods for the Examination of Water and Wastewater, 20th edn, APHA/AWWA/WEF, Washington DC, USA Eisentraeger A. , Klag P., Vansbotter...
- 10
- 717
- 0
A study on english food related idioms and proversbs and their equivalents in vietnamese
... idioms and proverbs relating to food: Idiom and proverb meaning Example sentence 1.As easy as apple pie very easy The test that I wrote yesterday was as easy as apple pie As flat as a pancake very ... very flat The child's toy was as flat as a pancake after the car drove over it silly, crazy The man in the super As nutty as a fruitcake market was as nutty as a fruit cake As red as a cherry ... cultural values and physical environment from which they arise For example, island cultures such as Hawaii have proverbs about the sea Eastern cultures have proverbs about elephants, and American...
- 55
- 834
- 4
A study on possessive determiners in english and their equivalents in vietnamese
... pre-modification can be temporary or permanent Generally speaking, nouns and adjectives are stative and verbs are dynamic It follows that, as modifiers, most adjectives and nouns describe permanent characteristics ... automatic and habitual; and habit comes from practice Drill cannot be avoided if the teacher avoids it, the student must accumulate examples on his own account and try them over mentally in a ... determiners” as grammar books, web pages and dictionaries Analyzing data and giving a lot of examples to help the learners develop further understandings about this study Pointing out various mistakes...
- 59
- 748
- 0
using pair work and group work techniques to increase students' participation and interest in communicative english classes at hanoi university of industry
... techniques in teaching and learning English and it can help other teachers of English be aware of these advantages and apply pair work and group work activities in their teaching 2 II Aims of the ... task practice, improve students’ motivation, allow natural learning and create a context supporting learning as well “In communicative activities the teacher creates a situation and sets an activity ... so that the other students can hear or read The Post small group work stage teacher assigns a related task to reinforce learning, and self- evaluates what has been done, and amendments makes...
- 43
- 1,562
- 5
Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx
... Centraalbureau voor Schimmelcultures, the Netherlands; DAOM, Eastern Cereal and Oilseed Research Centre, Canada; ATTC, American Type Strain Culture Collection, USA The identity of all strains was ... bacteria, spores, viruses and fungi [4–12] It has the advantages of being very rapid, using small samples (subcolony amounts) and requiring minimal sample preparation Bacterial intact-cell MALDI-TOF ... other strains of H jecorina, as well as strains of other Trichoderma spp., were cultivated on malt extract agar (3%) at 25 °C Extraction and preparation of mycelia for MALDI-TOF analysis A few micrograms...
- 12
- 632
- 0
Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx
... disease For example, sHSPs defend against ischemia, oxidative damage and apoptosis, but post-translational modifications and gene mutations cause cataract and desminrelated myopathies Disease ... human aA-crystallin from normal aged and cataractous lenses Biochim Biophys Acta 1549, 179–187 Shridas P, Sharma Y & Balasubramanian D (2001) Transglutaminase-mediated cross-linking of a- crystallin: ... a- crystallin deamidation involves the nonenzymatic conversion of asparagine to either aspartate or isoaspartate, and glutamine becomes glutamic acid, prevalent changes during cataract formation and aging...
- 15
- 573
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... the manufacturer’s procedures, and used as templates for PCR, with 70b F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) ... mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b (Fig 1A) The T-DNA insertion in AtRPA7 0a (atrpa7 0a) was lethal, ... AACCGAGATGGTCGGCAAC) and AtRPA7 0a- 3¢ (AA CAGTCATCTTCACTCTTTGT); AtRPA70b-5¢ (TTCAA CTTTGTACCCATTGAT) and AtRPA70b-3¢ (TTCACCG CCATTATATACCTTA) These primers were used to obtain a fragment of 722...
- 12
- 588
- 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx
... R&R Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial ... in invertebrates J Mol Evol 48, 341– 347 Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular component ... cDNA variants were isolated and designated basic QH 4A (Pro36 and His83) and QH4B (Leu36 and Tyr8) (AB201766 and AB201767) The cDNA of basic QH10 encoded a 110-residue protein with a 16-amino acid...
- 13
- 582
- 0
Báo cáo khoa học: "Towards Finding and Fixing Fragments: Using ML to Identify Non-Sentential Utterances and their Antecedents in Multi-Party Dialogue" ppt
... the annotation scheme, we had a subset of the data annotated by two annotators and found a satisfactory κ-agreement (Carletta, 1996) of κ = 0.81 The tagger is available free for academic research ... rule learner In Proceedings of the Sixteenth National Conference on Artificial Intelligence (AAAI-99), Orlando, Florida, July AAAI Walter Daelemans, Jakub Zavrel, Ko van der Sloot, and Antal van den ... Discourse and Dialogue, pages 15–26, Philadelphia, USA, July ACL Special Interest Group on Dialog Raquel Fern´ ndez, Jonathan Ginzburg, Howard Gregory, and a Shalom Lappin 200 4a Shards: Fragment...
- 8
- 348
- 0
Báo cáo Y học: Fluorescent analogs of UDP-glucose and their use in characterizing substrate binding by toxin A from Clostridium difficile pdf
... K & Acharya, K.R (2001) Structure of UDP complex of UDP-galactose: beta-galactoside-alpha-1,3-galactosyltransferase ˚ at 1.53 -A resolution reveals a conformational change in the catalytically ... particular These substrate analogs are related to the commercially available methylanthraniloyl (mant) derivatives of ATP and GTP commonly used in mechanistic studies of ATPases and GTPases Here, we report ... the manufacturer’s protocol standardized against BSA Typically, greater than 90% of the toxin was recovered after buffer exchange and concentration Fluorescence measurements All fluorescence measurements...
- 8
- 516
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008