... reducing hMS and returning it to the catalytic cycle The turnover of hMS increases as MSR is reduced to the one-electron, two-electron and fourelectron reduced states, reflecting a higher concentration ... S Scrutton Formation of holo-methionine synthase Co Homocysteine Methionine Cob(I)alamin Methylcob(III)alamin Primary turnover cycle AdoHyc AdoMet H4folate CH3H4folate Co Cob(I)alamin e– Cob(II)alamin ... of reducing equivalents needed to return hMS to the catalytic cycle MSR was shown previously to reduce AqCbl to cob(II)alamin, and this activity is thought to facilitate the uptake of cobalamin...
... the complicated relationship between ECs and non-ECs such as mural, hematopoietic and mesenchymal fibroblast cells, even though a conditional genetic modification such as endothelium -speci c knockouts ... same Tie2–Cre transgenic mouse line, which showed that recombination occurred in hematopoietic cells as well as ECs [27], and that cardiac valvular cells were derived from endothelial cells through ... (MACS) columns and MACS goat anti-rat IgG microbeads (Miltenyi Biotec, Bergisch Galdbach, Germany) were used according to the manufacturer’s protocol Attached cells were trypsinized, collected...
... annealed oligonucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGTTCGCGACCGCCCTGACGGCGATTA TCGGAGTTCGGACA-3¢ into the unique SpeI restriction site p13R4-DP ... constructing p13R4-P, except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGATCCTAGCA GAAGC-3¢ were used for the PCR amplification of the C- terminal ... primers 5¢-GTCTGGCGGAA AACCTCAGTGTGACGC-3¢ and 5¢-GACACCAGACCA ACTGGTAATGGTAGCGACCG-3¢ were used for the amplification of the 3¢ end of the b-gal gene The presence of similar amounts of genomic DNA in...
... Tanaka S (1990) Methods of successive multiparametric cytochemistry and microfluorometry on identical cells with special reference to cell cycle phases in a chick embryo Exp Cell Res 186, 6–14 32 Tanaka ... bottle by shaking were collected and named mitotic (M) cells Residual cells were collected and named G2 cells These cells and logarithmically growing cells were separated into Triton-soluble (S) ... transitions in the cell cycle are also required to prevent re-replication of DNA in a single cell cycle Inactivation of CDK1 leads to re-replication of DNA in eukaryotic cells including human cells [7]...
... product was detected in the anterior pituitary cells This cell -speci c induction of GFP–PrPC expression occurs because when the frog is adapted to a black background the POMC promoter becomes ... transgenic for GFP–PrPC showed fluorescence specic in the melanotrope cells of the intermediate pituitary and in these cases we never observed nonspeci c anterior pituitary or brain fluorescence GFP–PrPC ... melanotrope cells constitute a homogeneous population of strictly regulated neuroendocrine secretory cells and their biosynthetic and secretory activity can be physiologically manipulated by simply placing...
... EGFP fluorescence was speci cally observed in human hepatocellular carcinoma HepG2 cells and NuE cells, whereas no EGFP fluorescence was observed from either human colon adenocarcinoma WiDr cells or ... nontransfected Cos7 cells (a), ng of L-FLAG-EGFP particles from the extracts of transfected Cos7 cells (b) and ng L(n45)FLAG-EGFP particles from the extracts of transfected Cos7 cells (c) were ... procedures Cell cultures Human hepatoma HepG2 cells, human squamous cell carcinoma A431 cells and human colon adenocarcinoma WiDr cells were cultured in Dulbecco’s modified Eagle medium (DMEM), supplemented...
... 2B tttttccag ⁄ TGCATC Exon tttttccag ⁄ TGCATC Exon tttttccag ⁄ TGCATC Exon tcttcacag ⁄ GATCTG Exon we exposed mIMCD3 cells to either of those stimuli alone and to a combination ... splice variants are indicated by arrows below the schematic representation of genomic DNA (B) Products of PCR amplification using splice variant -speci c TSC22D2 PCR primers (C) Nucleotide sequence ... GAAATGTTGTCCACAAGAGTGTC (forward; initiation codon in bold-type) and TGCTGAGGAGACATTCGG CTG (reverse) and the correct sequence of the PCR product was confirmed by double-pass sequencing pcDNA5 ⁄...
... evidence for the in vivo speci city of bacitracin (or potential products) for PDI inhibition Our results clearly show that bacitracin in vitro is not a specic inhibitor of PDI, but that it interacts ... the presence of bacitracin First, there is a net increase in fluorescence due to the bacitracin However, with excitation at 280 nm and emission at 350 nm, bacitracin is much less fluorescent on a ... Pages N, Bac P, Bordet R & Vamecq J (2009) Experimental stroke protection induced by 4-hydroxybenzyl alcohol is cancelled by bacitracin Neurosci Res 64, 137–142 25 Cho J, Furie BC, Coughlin SR...
... 5¢-GAGGCCAGCGAAGA ATAGTG-3¢, and Sox9_1prom_rev, 5¢-GTTCTCTC CCTTTTCCCCAGC-3¢ (234 bp fragment); Sox9_2prom_ for, 5¢-CAGTCACTCAACAGTCTCTGG-3¢, and Sox9_2 prom_rev, 5¢-CACTTCGCTCTCAGGCTTC-3¢ (213 ... oligomeric binding sites for Sox9, specic for the AP-2e promoter (Sox9_1, 5¢-GCGG CTCTGATCAATGTGGGCTGAATTC-3¢; and Sox9_2, 5¢-CATGCCCACACTCAATCAGCCCAGGACCC-3¢) were generated The fragments correspond ... mutSox9-447_for, 5¢-CCAGAAGGCGGCTCT GATTGCTGTGGGCTGAATTCACGC-3¢; and mutSox9447_rev, 5¢-GCGTGAATTCAGCCCACAGCAATCAGAG CCGCCTTCTGG-3¢ FEBS Journal 276 (2009) 2494–2504 ª 2009 The Authors Journal compilation...
... Metabolic role, purication, specicity, and kinetic mechanism J Biol Chem 266, 20658 20665 Parkin DW (1996) Purine-specic nucleoside N-ribohydrolase from Trypanosoma brucei brucei Purication, specicity, ... Ile Leu a Calculated using the program DSSP b Calculated according to Facchiano et al [48] c Calculated according to Facchiano et al [48] d Calculated using the program AVP sequence identity, ... from Crithidia fasciculata (CfIU-NH) [26] and Leishmania major (LmIU-NH) [9], the pyrimidine-specic NHs from E coli such as YeiK (Ec-YeiK) [29] and YbeK (Ec-YbeK) [30], and with the purine-specic...
... accessibility of the p53 CTDBS is critical for (sequence-nonspeci c) cisPtDNA recognition [34] On the other hand, sequencespeci c binding of p53 to the synthetic p53DBS PGM1 was inhibited in cisplatin-treated ... interaction that are mediated by the protein C- terminus, particularly the sequence-nonspeci c binding of p53 preferentially to cisPt-DNA [33,34] Another CTDBS-lacking tetrameric p53 construct, p53CT ... that speci cally recognize cisplatin-damaged DNA: a clue to anticancer activity of cisplatin FASEB J 12, 791–799 30 Kasparkova J & Brabec V (1995) Recognition of DNA interstrand cross-links of cis-diamminedichloroplatinum(Ii)...
... detectable Proteins Liposomes ka (102 d1–7IC PE ⁄ PC PC PS ⁄ PC PtdIns ⁄ PC PG ⁄ PC PtdIns(3)P ⁄ PC PtdIns(3,4)P2 ⁄ PC PtdIns(3,4,5)P3 ⁄ PC PE ⁄ PC PC PS ⁄ PC PtdIns ⁄ PC PG ⁄ PC PtdIns(3)P ⁄ PC ... for IC and IC–CPY IC (A) or IC–CPY (B), the final concentration of which was lM, was added to PCbased liposomes (0.5 mgÆmL)1 of PE ⁄ PC, PC, PS ⁄ PC, and PtdIns ⁄ PC) in 20 mM Hepes (pH 7.2) containing ... cytoplasmic localization of IC in the logarithmic-phase cells Previous work on the inhibitory properties of IC in vitro, in which IC was shown to inactivate and interact with CPY under acidic...
... 5¢-GGACTCAAGAGAGGAACCTG-3¢; F1b, 5¢-CT GCCTTGCTCCACACCTG-3¢; F 1c, 5¢-CTGCCGTCTCC GCCGCCACT-3¢; FU, 5¢-TCAAGCCCCGCTACATAG TT-3¢; and R3, 5¢-AGGAACCAAACACCAAGTGG-3¢ (Fig 2A) Luciferase promoter ... prostate cancer cells express only isoform 1, but not isoform [14], promoter is possibly inactivated in cancer cells There may be silencer sequence specic for cancer cells at the promoter region Such ... 5¢-ATGGTGTCTGTGATGTTGCCG-3¢ and R2, 5¢-TTCTCACACTTCTGGTGCTC-3¢ DNA sequences of the PCR products were determined using an automatic DNA sequencer (DSQ-1000, Shimadzu, Kyoto, Japan) after cloning into...
... in infectivity 80 9x increase in infectivity 0 4x increase in infectivity Fluorescence Fluorescence Fluorescence Fluorescence Fluorescence Fluorescence Fluorescence Fluorescence Fluorescence Fluorescence ... also facilitated binding of HCV clinical isolates to cells and their subsequent uptakeinto the endocytic compartment SR-BI-transfected CHO cells bound twice as many virions as parental CHO cells, ... DC-SIGN enhances infection of T -cells by capturing HIV on dendritic cells and transferring the virus to T -cells ASGPR is most commonly found on liver cells It facilitates the clearance of glycoproteins...
... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... individual chains resulting from decrease in chain length, as evidenced by decreased molecular mass of LMWC The DA calculated using 13 C- NMR spectra was in accordance with the one calculated by IR-spectra ... detected using an RI detector Chito-oligomers and GlcNAc were used as standards Circular Dichroism (CD) CD spectra for native chitosan and LMWC (5 mgÆmL)1 in 0.1 M perchloric acid; path length, cm)...
... containing the Ó FEBS 2004 Interaction between CSFV NS5B and the genome (Eur J Biochem 271) 3893 A A 600 +RNA0 +RNA1 +RNA2 +RNA3 +RNA4 +RNA5 ACCTCGTATAC –RNA0 ACCTCGTATA –RNA1 ACCTC –RNA2 ACC ... ACCTC –RNA2 ACC –RNA3 AC –RNA4 –RNA5 B 600 CGGCCC CGGCC CGGC CGG C +RNA1 B +RNA2 +RNA3 +RNA4 +RNA5 – 1 C –RNA1 –RNA2 10 11 12 13 14 15 16 –RNA3 –RNA4 –RNA5 5 Fig RdRp assays containing various RNA ... respectively, the RNA templates containing the plus-strand 3¢ UTR with deletion of C , ÔCCÕ, ÔCCCÕ, ÔCCCGGÕ and the 21 nucleotide fragment at the 3¢ terminal –RNA1 to –RNA5 represent, respectively,...
... inhibited by actinomycin C1 [22] Actinomycin C1 , a polypeptide containing the properties of an antibiotic, intercalates into dsDNA and thereby inhibits nucleic acid synthesis [23] Nogalamycin and daunorubicin ... inhibit cellular function Although many helicases have been characterized biochemically, it is often difficult to determine the in vivo role of a specic helicase However, the biological roles ... DNA-interacting compounds on DNA unwinding activity of PDH120 The chemical structures of the compounds used have been described previously [16] Initially, each compound was used at a final concentration...