Specific TSC22 domain transcripts are hypertonically induced and alternatively spliced to protect mouse kidney cells during osmotic stress Diego F Fiol, Sally K Mak* and Dietmar Kultz ă Physiological Genomics Group, Department of Animal Science, University of California, Davis, CA, USA Keywords aldosterone; hyperosmotic stress; hypertonicity; kidney; mIMCD3 cells Correspondence D Kultz, Physiological Genomics Group, ă Department of Animal Science, University of California, Davis, One Shields Avenue, Davis, CA 95616, USA Fax: +1 530 752 0175 Tel: +1 530 752 2991 E-mail: dkueltz@ucdavis.edu *Present address The Parkinson’s Institute, Sunnyvale, CA, USA (Received 28 July 2006, revised 23 October 2006, accepted November 2006) doi:10.1111/j.1742-4658.2006.05569.x We recently cloned a novel osmotic stress transcription factor (OSTF1) from gills of euryhaline tilapia (Oreochromis mossambicus) and demonstrated that acute hyperosmotic stress transiently increases OSTF1 mRNA and protein abundance [Fiol DF, Kultz D (2005) Proc Natl Acad Sci USA ă 102, 927932] In this study, a genome-wide search was conducted to identify nine distinct mouse transforming growth factor (TGF)-b-stimulated clone 22 domain (TSC22D) transcripts, including glucocorticoid-induced leucine zipper (GILZ), that are orthologs of OSTF1 These nine TSC22D transcripts are encoded at four loci on chromosomes 14 (TSC22D1, two splice variants), (TSC22D2, four splice variants), X (TSC22D3, two splice variants), and (TSC22D4) All nine mouse TSC22D transcripts are expressed in renal cortex, medulla and papilla, and in the mIMCD3 cell line The two TSC22D3 transcripts (including GILZ) are upregulated by aldosterone but not by hyperosmolality in mIMCD3 cells In contrast, TSC22D4 is stably upregulated by hyperosmolality in mIMCD3 cells and increased in renal papilla compared with cortex Moreover, all four TSC22D2 transcripts are transiently upregulated by hyperosmolality and resemble tilapia OSTF1 in this regard All TSC22D2 transcripts depend on hypertonicity as the signal for their upregulation and are unresponsive to increases in cell-permeable osmolytes mRNA stabilization is the mechanism for TSC22D2 upregulation by hyperosmolality Overexpression of TSC22D2–4 in mIMCD3 cells confers protection towards osmotic stress, as evidenced by a 2.7-fold increase in cell survival after days at 600 mOsmolỈkg)1 Based on variable responsiveness to aldosterone and hyperosmolality in kidney cells we conclude that mouse TSC22D genes have diverse physiological functions TSC22D2 and TSC22D4 are involved in adaptation of renal cells to hypertonicity suggesting that they represent important elements of osmosensory signal transduction in mouse kidney cells In the mammalian kidney, the papilla is routinely exposed to severe hyperosmolality and to large changes in interstitial osmolality These stressful conditions are a prerequisite for operation of the urinary concentrating mechanism and maintenance of systemic salt and water balance Thus, renal papillary (and outer medullary) cells have special mechanisms to adapt to variable and severe hyperosmolality Cellular adaptation to hyperosmotic stress is controlled via a complex array of cellular signaling mechanisms that modify gene and protein expression and protein function to promote osmoprotection [1] Such signaling Abbreviations GILZ, glucocorticoid-induced leucine zipper; OSTF1, osmotic stress transcription factor 1; TGF, transforming growth factor; TonEBP, tonicityresponse element binding protein FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 109 Osmotic regulation of TSC22D in kidney cells D F Fiol et al mechanisms stimulate accumulation of the compatible organic osmolytes glycine-betaine, myo-inositol, taurine, sorbitol, and glycerophosphorylcholine [2–4] Accumulation of glycine-betaine, inositol, and sorbitol is transcriptionally regulated and depends, at least in part, on the transcription factor tonicity-response element binding protein (TonEBP) [5] TonEBP also activates additional genes that are important for osmotic stress adaptation, including HSP70 and UT-A urea transporter [6,7] In addition to the TonEBP pathway, hyperosmolality activates a very complex network of intracellular signaling pathways in renal medullary cells, including MAP kinase pathways [8], the p53 pathway [9], DNA-dependent protein kinases [10], and protein kinase A-dependent pathways [11] Thus, the response of mammalian kidney cells to hyperosmotic stress is highly complex and involves many different pathways and elements Proper understanding of the cellular hyperosmotic stress response enabling computational modeling of this response is highly desirable because it would open avenues for manipulating stressresistance networks of cells in states of renal disease and disorders of water and electrolyte balance However, better knowledge about key elements of osmosensory signal transduction pathways and their interactions within osmotic stress signaling networks is required before in silico models that correctly reflect and predict cellular responses to osmotic stress can be devised We recently cloned a novel immediate early gene osmotic stress transcription factor (OSTF1) that is involved in the cellular osmotic stress response of gill cells of euryhaline tilapia [12] In this fish, OSTF1 mRNA and protein levels rapidly and transiently increase in response to hyperosmotic stress, peaking at and h, respectively The rapid and transient activation kinetics is characteristic of immediate early genes OSTF1 belongs to the TSC22D family of leucine zipper proteins that are thought to be transcription factors in mammalian cells In mouse tissues, TSC22D genes are regulated by glucocorticoids and transforming growth factor b (TGF-b) [13,14] However, nothing is known about the osmotic regulation of any mouse TSC22D isoform In addition, a systematic genomewide analysis of mouse TSC22D gene products, identifying all family members, is lacking In this study, we identified nine murine TSC22D transcripts and investigated their regulation by hyperosmolality and aldosterone, which is a mineralocorticoid hormone important for modulation of the urinary concentrating mechanism Moreover, TSC22D2 was identified as the closest functional mouse ortholog of tilapia OSTF1 and the mechanism and physiological significance of hyperosmotic upregulation of this gene was analyzed Results Identification of TSC22D family members in the mouse genome We recently cloned tilapia OSTF1 and showed that it is a rapidly induced osmotic stress transcription factor [12] To identify possible functional homologs of tilapia OSTF1 in mammals, we carried out an exhaustive search of the complete annotated mouse genome using the ENSEMBL database (http://www.ensembl.org) [15] This search yielded six gene products with expectation values ranging from 6.1e-69 to 3.2e-21 These proteins are the products of transcripts encoded at four different loci (Table 1) In order to avoid ambiguity, we follow the recently updated and unified MGD nomenclature guidelines for TSC22D proteins in this study (Mouse Genome Informatics) [16] TSC22D1-1 and TSC22D1-2 are splice variants that are located on chromosome 14, TSC22D2 is located on chromosome 3, TSC22D3-1 and TSC22D3-2 are splice variants that are located on chromosome X, and TSC22D4 is located on chromosome (Table 1) Although two of these proteins have been previously described as TSC-22 (TSC22D1-2) and glucocorticoidinduced leucine zipper (GILZ) (TSC22D3-2), the other four have not been characterized or only referred to as TSC22-like or GILZ-like proteins Multiple sequence Table Mouse OSTF1-like predicted transcripts aa, amino acid; nt, nucleotide Transcript TSC22D1-1 TSC22D1-2 TSC22D2 TSC22D3-1 TSC22D3-2 TSC22D4 110 Name TSC-22 GILZ THG1 Chromosome location Accession EMBL ENSEMBL Length (aa) (nt) OSTF1 homology Score E-value 14 band D3 14 band D3 band D X band F1 X band F1 band G1 AF201285 L25785 BC058221 AF201289 AF024519 AF315352 ENSMUST00000048371 ENSMUST00000022587 ENSMUST00000029383 ENSMUST00000033807 ENSMUST00000055738 ENSMUST00000049554 1057 143 167 201 137 387 4581 1670 2002 1377 1972 2672 298 299 256 688 324 240 2.5e-26 1.0e-27 3.7e-23 6.1e-69 2.3e-30 3.2e-21 FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS D F Fiol et al Osmotic regulation of TSC22D in kidney cells A B Fig Schematic structure (A) and multiple sequence alignment of the TSC22D motif (B) of tilapia OSTF1 and mouse TSC22D family members identified by a genome-wide search Large gray cylinders correspond to the conserved TSC22 ⁄ leucine zipper motif Smaller white cylinders represent local regions of high homology Residues shaded in darker tones correspond to higher level of homology in the alignment alignment shows that the six mouse proteins and tilapia OSTF1 share a conserved region of  70 amino acids, which comprises the TSC22D family signature motif and a leucine-zipper domain The N- and C-termini are least conserved in all proteins In particular, N-termini are highly heterogeneous, accounting for variability in total protein lengths ranging from 124 to 1057 amino acids (Table 1, Fig 1) The protein with the highest overall sequence similarity to tilapia OSTF1 is TSC22D3-1, based on highest degree of conservation of the N-terminus (Fig 1) suggest that hyperosmolality could potentially be responsible for altering the expression of four TSC22D transcripts The level of expression of all six transcripts was also determined in mIMCD3 cells All six transcripts are expressed in mIMCD3 cells and expression levels are similar to those in mouse kidney medulla in vivo (data not shown) Therefore, mIMCD3 cells are a good model for evaluating mechanisms of regulation of the mouse TSC22D transcripts Expression of TSC22D family members in kidney mouse and mIMCD3 cells We analyzed the expression of the six mouse TSC22D transcripts in kidney to learn whether any of them functionally resembles tilapia OSTF1 Levels of expression of the six transcripts were determined by quantitative PCR in three regions of the kidney that are characterized by increasing interstitial osmolality in the order from cortex (lowest) to medulla (intermediate) to papilla (highest) All six transcripts are expressed in all three regions of the kidney Renal TSC22D2 is most abundant being expressed at levels that are between one and two orders of magnitude lower than that of the highly abundant ribosomal protein L32 (Fig 2) The level of expression of TSC22D1-2 and TSC22D2 is similar in cortex, medulla, and papilla (Fig 2) However, TSC22D3-1, TSC22D3-2, and TSC22D4 are significantly more abundant in papilla, whereas TSC22D1-1 is more abundant in cortex The data Fig Relative expression levels of mouse TSC22D transcripts in kidney papilla, medulla and cortex Expression levels of TSC22D transcripts were determined by quantitative PCR C, cortex; M, medulla; P, papilla Results are depicted as means ± SEM of three independent experiments Significant differences between kidney regions are indicated by asterisks (P < 0.05) FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 111 Osmotic regulation of TSC22D in kidney cells D F Fiol et al Regulation of TSC22D transcripts in mIMCD3 cells by hyperosmotic stress and aldosterone The responsiveness of TSC22D transcripts to hyperosmotic stress and ⁄ or aldosterone treatment was determined in mIMCD3 cells in 24-h time course experiments Acute hypertonicity increases the expression of TSC22D2, TSC22D4 and TSC22D3-2 Of interest, TSC22D2 is elevated early and transiently, showing increases of 2.6- and 3.1-fold at and h of treatment, respectively, and returning to baseline levels within 12 h In contrast, TSC22D3-2 and TSC22D4 show a slower but more stable upregulation, increasing three- and sixfold, respectively, after 24 h of treatment (Fig 3) These results are in agreement with higher levels of TSC22D3-2 and TSC22D4 in renal papilla in vivo (see previous paragraph, Fig 2) Aldosterone induces a rapid increase in TSC22D3-2 (4-fold at h, A B C D E F Fig Response of TSC22D transcripts to hyperosmotic stress and aldosterone in mIMCD3 cells Cells were exposed to hyperosmolality by increasing medium osmolality from 300 to 550 mOsm by addition of NaCl (filled circles), to lM aldosterone (triangles), or to both hyperosmolality and aldosterone simultaneously (open circles) Each panel shows the time course response for a particular transcript determined by quantitative PCR Results are depicted as means ± SEM for three independent experiments Asterisks indicate significantly differences with respect to the value at time zero (P < 0.05) 112 FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS D F Fiol et al 33-fold at 12 h, 10-fold at 24 h) and TSC22D3-1 (fivefold at 4–6 h hours) (Fig 3) Of interest, a combination of hyperosmotic stress and aldosterone does not potentiate the transient increase in TSC22D3-2 (Fig 3) By contrast, hyperosmotic stress and aldosterone in combination prevent transient short-term effects and offset each other Taken together, the data on osmotic regulation of TSC22D transcripts implicate TSC22D2 as the closest functional homolog of tilapia OSTF1 Identification of alternative TSC22D2 transcripts Because of its similar osmotic regulation compared with tilapia OSTF1 we investigated mouse TSC22D2 in more depth Two additional alternative transcripts encoding splice variants of TSC22D2 protein were identified that differed from the original cDNA ENSMUST00000029383 (TSC22D2-1; Fig 1, Table 1) These two additional cDNAs (GENSCAN000000732 55 ¼ TSC22D2-2 and ENSMUSESTG00000010047 ¼ TSC22D2-3) were predicted using the Ensembl database and gene prediction software genscan and genomewise ⁄ genewise genscan is a bioinformatic tool that predicts gene loci and their exon ⁄ intron composition based on the genomic DNA sequence [17] genomewise ⁄ genewise gene-prediction software assembles cDNA sequences based on the analysis and integration of EST data [18] Taking advantage of information provided by these two complementary approaches we thoroughly examined the TSC22D2 gene for alternative splicing events Alignment of the three identified TSC22D2 splice variants against the genomic TSC22D2 sequence revealed differences in exon composition Two splice variants (TSC22D2-1 ⁄ 2) consist of three exons, whereas the third splice variant (TSC22D2-3) has four exons as a result of inclusion of an extra 72 bp exon in the second position (Fig 4A) The length of the first and last exons is also variable in the three splice variants of TSC22D2 (Fig 4A) We then tested for expression of the newly predicted TSC22D2 transcripts (TSC22D2-2 ⁄ 3) in mouse kidney cells Specific PCR primer pairs were designed to amplify TSC22D2-2 (primer pair E–F), TSC22D2-3 (primer pair A–C), and all splice variants (primer pairs A–B and A–D) We had already used primer pair A–B for previous quantification of overall TSC22D2 transcript abundance as it amplifies all possible splice variants (Fig 4A, Table S1) Expression of TSC22D2-2 and TSC22D2-3 was confirmed based on the presence of RT-PCR products having the expected sizes (Fig 4B, lanes A–C and E–F, respectively) In addition, using the primer pair A–D we detected three Osmotic regulation of TSC22D in kidney cells different PCR products of 493, 406 and 334 bp instead of the two products that we expected based on the primer design shown in Fig 4A (amplicon ± exon 2) Therefore, the three PCR products obtained with primers A–D were purified, sequenced, and aligned to each other (Fig 4C) The sequence of two of these PCR products matched the predicted sequence for TSC22D2-1 ⁄ and TSC22D2-3 (Fig 4C) These sequences differed by the presence of the 72-bp exon in TSC22D2-3 as predicted Surprisingly, however, an additional unpredicted fragment was discovered by PCR analysis (TSC22D24, Fig 4) Sequencing of the corresponding PCR product confirmed that TSC22D2-4 represents an entirely novel splice variant that was not predicted by any of the bioinformatics methods used in our study nor reported to exist previously TSC22D2-4 included an alternative second exon of 159 bp but lacked the 72 bp exon Schematic exon ⁄ intron structures of all four TSC22D2 splice variants are compared in Fig 4D with emphasis on the two alternative exons 2A (72 bp) and 2B (159 bp), which are not present simultaneously in any TSC22D2 transcript in mIMCD3 cells (Fig 4B) Next, we analyzed the exon ⁄ intron regions flanking TSC22D2 exons 2A and 2B All of these sequences match splice donor and acceptor consensus sites very well (5¢-AG ⁄ GT AG ⁄ G-3¢) (Table 2) In addition, the homologous intron ⁄ exon regions that flank exons 2A and 2B in human TSC22D2 are 95% identical to mouse sequences indicating a high degree of conservation of these critical areas compared with the overall much lower homology of TSC22D2 genomic sequence (< 50%; data not shown) Taken together, these observations strongly support alternative splicing events that give rise to TSC22D2 transcripts with different exon sequences Protein products for TSC22D2-1 and TSC22D2-2 differ only by variable length of the first and last exons from each other (Fig 4A) In contrast, TSC22D2-3 and TSC22D2-4 differ more substantially from the other TSC22D2 variants because of the presence of an additional exon (exon 2A ⁄ 2B) (Fig 4E) In particular, TSC22D2-4 differs greatly from the other variants because it lacks a large portion of the N-terminus due to the presence of four in-frame stop codons in exon 2B (Fig 4C,E) An ATG codon following immediately after the last of these four stop codons may represent the transcription initiation site for a protein with a much shorter N-terminus (Fig 4E) Each of the four possible TSC22D2 protein products also differs with respect to the presence of consensus phosphorylation sites for a number of stress-responsive protein kinases (Fig 4E) FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 113 Osmotic regulation of TSC22D in kidney cells D F Fiol et al A B C Fig Detection and characterization of alternative TSC22D2 transcripts (A) Alignment of TSC22D2 (ENSMUST00000029383) with TSC22D2 transcripts predicted by GENSCAN and GENOMEWISE ⁄ GENEWISE and genomic DNA (chromosome 3) Positions of PCR primers designed to differentiate between splice variants are indicated by arrows below the schematic representation of genomic DNA (B) Products of PCR amplification using splice variant-specific TSC22D2 PCR primers (C) Nucleotide sequence of the PCR products amplified by the A–D primer pair In-frame stop and start codons are over-lined in gray and black, respectively (D) Schematic representation of the exon–intron structure of all identified TSC22D2 transcripts Positions of PCR primers designed to amplify individual splice variants are indicated by arrowheads (E) Partial deduced amino acid sequence of the exon region of all identified TSC22D2 transcripts The TSC22D domain is boxed Regions encoded by exon 2A and exon 2B are printed in bold Splice variant-specific potential phosphorylation sites are underlined Asterisk indicates the presence of an in-frame stop codon in the corresponding mRNA D E Response of the four TSC22D2 variants to hyperosmolality and aldosterone We quantified abundances of individual TSC22D2 transcripts by quantitative PCR using the PCR primers 114 depicted in Fig 4A and Table All four TSC22D2 variants are expressed at comparable levels in mouse kidney papilla, medulla, and cortex (data not shown) To analyze the regulation of the four TSC22D2 variants in response to hyperosmolality and aldosterone FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS D F Fiol et al Osmotic regulation of TSC22D in kidney cells Table Sequences corresponding to 3¢ acceptor and 5¢ donor exon ⁄ intron boundaries in TSC22D2 transcripts 5¢-Donor EXON ⁄ intron Exon Exon Exon Exon Exon Exon AGACAG ⁄ gtatgtaca AGACAG ⁄ gtatgtaca AGACAG ⁄ gtatgtaca A GGATAG ⁄ gtatgatta 2B AAATTG ⁄ gtaagactt GCAATG ⁄ gtaagtagg 3¢-Acceptor intron ⁄ EXON gtctcacag ⁄ GAATCC Exon A ctttgctag ⁄ AATTTT Exon 2B tttttccag ⁄ TGCATC Exon tttttccag ⁄ TGCATC Exon tttttccag ⁄ TGCATC Exon tcttcacag ⁄ GATCTG Exon we exposed mIMCD3 cells to either of those stimuli alone and to a combination of both All four TSC22D2 variants are transiently upregulated by hyperosmotic stress (Fig 5) The highest degree of hyperosmotic upregulation was observed for TSC22D2-4 Aldosterone with or without hyperosmolality did not significantly affect the abundance of any individual TSC22D2 variant, consistent with the results obtained when all TSC22D2 variants were quantified together (Figs 3, 5) Regulation of TSC22D2 variants by hyperosmolality To identify the signal responsible for hyperosmotic upregulation of TSC22D2 we exposed mIMCD3 cells for h to hyperosmotic media (550 mOsmolỈkg)1) prepared by addition of NaCl, choline chloride, sodium gluconate, mannitol, urea or glycerol TSC22D2-4 was always upregulated by hypertonic media (choline chloride, sodium gluconate, mannitol, NaCl) independent of the presence of Na+ or Cl– in such media (Fig 6) In contrast, hyperosmolality due to nonhypertonic glycerol or urea did not alter TSC22D2-4 levels (Fig 6) Similar results were obtained for the other three TSC22D2 variants (data not shown) These data demonstrate that neither Na+ nor Cl– nor hyperosmolality per se represent the signal for upregulation of A B C D Fig Response of TSC22D2 alternative transcripts to hyperosmotic stress in mIMCD3 cells Cells were exposed to hyperosmolality by increasing medium osmolality from 300 to 550 mOsm by addition of NaCl (filled circles), to lM aldosterone (triangles), or to both hyperosmolality and aldosterone simultaneously (open circles) Each panel shows the time course response for a particular TSC22D2 alternative transcript as determined by quantitative PCR Results are depicted as means ± SEM for three independent experiments Asterisks indicate significantly differences with respect to the value at time zero (P < 0.05) FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 115 Osmotic regulation of TSC22D in kidney cells D F Fiol et al Fig Response of TSC22D2-4 to different hyperosmotic media in mIMCD3 cells Osmolarity was increased from 300 to 550 mOsm with the addition of the indicated compounds After h, cells were collected and TSC22D2-4 mRNA levels were determined by quantitative PCR Results represent means ± SEM for three independent experiments Asterisks indicate significant differences with respect to isosmotic controls (P < 0.05) TSC22D2 Instead, hypertonicity is the stimulus that triggers TSC22D2 upregulation mRNA stabilization of TSC22D2 during hyperosmotic stress Next, we analyzed the mechanism of TSC22D2 upregulation in response to hyperosmotic stress Transcription in mIMCD3 cells was completely blocked by a Fig Stability of TSC22D2-4 transcript mIMCD3 cells were preincubated for h with 10 lgỈmL)1 actinomycin D in isosmotic medium (300 mOsmolỈkg)1) Treatments were initiated at time zero when cells were exposed to hyperosmolality by increasing medium osmolality to 550 mOsmỈkg)1 by addition of NaCl (black circles), to lM aldosterone (black triangles), or isosmotic control conditions (open circles) mRNA levels were determined by quantitative realtime PCR and normalized to L32 mRNA Results are depicted as means ± SEM for three independent experiments Asterisks indicate significantly different values with respect to the value at time zero (P < 0.05) 116 h preincubation in 10 lm actinomycin D Even lm actinomycin was sufficient to effectively block transcription in mIMCD3 cells (Fig S2) Cells were then exposed to hyperosmotic stress, aldosterone, and control conditions (isosmotic medium) The half-life of TSC22D2-4 was 2.8 ± 0.2 h for controls and aldosterone treatment but increased to > 20 h as a consequence of hyperosmolality (Fig 7) TSC22D2-1 ⁄ and TSC22D2-3 responded similarly, with half-lives increasing from 2.8 ± 0.3 to > 10 h and 2.3 ± 0.3 to > 15 h, respectively, in response to hyperosmolality (data not shown) These results indicate that mRNA stabilization is the mechanism responsible for hyperosmotic upregulation of TSC22D2 transcripts Osmoprotection of mIMCD3 cells by overexpression of TSC22D2-4 To evaluate whether TSC22D2 upregulation protects cells from hyperosmotic stress we generated stably transfected mIMCD3 cells that overexpress TSC22D24 We first generated a mIMCD3 cell line with a Flp recombinase target site stably integrated into the genome (mIMCD3FRT cells; Fig S1) to generate a good control for future experiments with stably selected cells We then cotransfected V5-epitope-tagged TSC22D2-4 in pcDNA5FRT vector together with a Flp recombinase expression vector to insert TSC22D24 into the FRT site in exchange for the LacZ gene The transgenic TSC22D2-4 cell line expressed  100fold higher levels of TSC22D2-4 compared with mIMCD3FRT control cells (Fig 8A) A single protein with the expected molecular mass (17 kDa) was detected in TSC22D2-4 cells using V5 antibody (Fig 8B) The transgenic TSC22D2-4 cells showed significantly greater hyperosmotic stress tolerance than mIMCD3FRT control cells We incubated these two cell lines for 24 h under hyperosmotic stress conditions that lead to a high frequency of apoptosis in wild-type mIMC3 cells (600–650 mOsmỈkg)1) [19] Under these conditions, TSC22D2-4 cells had a significantly improved phenotype (Fig 9A) and cell numbers were significantly higher compared with mIMCD3FRT control cells (Fig 9B), indicating that high levels of TSC22D2-4 protect cells during hyperosmotic stress Discussion Mammals have four loci encoding at least nine TSC22D transcripts We have identified four loci in the mouse genome that encode nine homalogs of the tilapia osmotic stress FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS D F Fiol et al A B Osmotic regulation of TSC22D in kidney cells A B Fig Overexpression of TSC22D2-4 in mIMCD3 cells (A) Determination of expression levels of endogenous and transfected TSC22D2-4 by quantitative real-time PCR Abundance is expressed relative to L32 content Error bars are too small to be visible on the logarithmic scale that is depicted Asterisks indicate significant differences (P < 0.05) Results represent means ± SEM for three independent experiments (B) Identification of transfected TSC22D2-4 ⁄ V5-His-tagged fusion protein expression by western blot using V5 antibody Fig TSC22D2-4 confers increased tolerance to hyperosmotic stress in mIMCD3 cells (A) Representative images of transfected and control (FRT) cells after exposure to 600 and 650 mOsm for 24 h (B) Count of viable transfected and control (FRT) cells after exposure to isoosmotic (300 mOsm) or hyperosmotic (600 mOsm) media for 72 h Asterisks indicate significant differences (P < 0.05) Results represent means ± SEM for three independent experiments transcription factor OSTF1 All four genes belong to the TSC22D family of leucine zipper proteins that form homo- and heterodimers with other family members Four TSC22D isoforms have previously been described: TSC22D1-2 (TSC-22), TSC22D3-2 (GILZ), TSC22D3-1 and TSC22D4 TSC22D1-2 was first isolated based on rapid and transient transcriptional induction by TGF-b1 [13] It also increases in response to anticancer drugs, progesterone, and growth inhibitors [20] and has been implied in mechanisms of tumorigensis TSC22D3-2 was identified as a protein that is induced following the treatment of thymocytes with dexamethasone [14] Its mRNA increases threefold as early as 30 and by more than 10-fold within h of aldosterone exposure in principal cells of the renal cortical collecting duct [21] In contrast, it is downregulated by estrogen in MCF-7 human breast cancer cells [22] GILZ interacts with NF-jB and Raf and inhibits AP-1, FoxO3, and Raf-mediated apoptotic pathways [23–25] This protein mediates aldosterone actions by stimulation of trans-epithelial sodium transport in kidney [26] TSC22D3-1 was identified in porcine brain as a 77 kDa protein that shares immunoreactivity with the sequence-unrelated nonamer neuropeptide DSIP [27] It was later found to be the most highly glucocorticoid-induced cDNA among over 9000 tested in a cDNA gene chip array in human peripheral blood mononuclear cells [28] TSC22D4 was identified in humans as a protein capable of forming heterodimers with TSC-22 [20] Its mouse homolog is involved in pituitary organogenesis [29] In this study we identified five additional TSC22D transcripts that are encoded by genes located on chromosomes (TSC22D2-1, TSC22D2-2, TSC22D2-3, TSC22D2-4) and 14 (TSC22D1-1) Although some of these novel transcripts have been previously described in the context of high-throughput cDNA sequencing projects [30,31] their functions are unknown However, based on their sequence similarity to known TSC22D proteins they may be transcription factors that are involved in the regulation of cell proliferation, apoptosis, and stress response pathways FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 117 Osmotic regulation of TSC22D in kidney cells D F Fiol et al All nine TSC22D transcripts are expressed in mouse kidney cells Expression of all nine TSC22D transcripts was confirmed in mouse kidney and in the mIMCD3 cell line The levels of expression of all nine TSC22D transcripts in mIMCD3 cells in vitro were comparable with renal tissue in vivo suggesting that mIMCD3 cells are a useful model for studying mechanisms of regulation and functions of TSC22D isoforms in mammalian kidney cells The lack of previous evidence for expression of several TSC22D transcripts identified in this study suggests that they may be particularly important for specific biological functions that are prevalent in renal cells The multitude of alternatively spliced TSC22D2 gene products could be important for generating functional variability in response to different environmental cues However, in the case of hyperosmolality all four splice variants of TSC22D2 are significantly upregulated even though the magnitude and kinetics of this upregulation was somewhat splice variant specific (see Discussion below) and the structures of the respective protein products are also different Variable exon usage produces proteins with different N-termini adjacent to the conserved TSC22D motif This region is responsible for transactivation suggesting that TSC22D variants with truncated N-termini (in particular the novel TSC22D2-4 variant) may be transcriptional repressors that sequester other TSC22D family members [20] TSC22D2 and TSC22D4 are regulated by hyperosmolality in kidney cells In mIMCD3 cells exposed to hyperosmolality TSC22D2 and TSC22D4 transcripts increase significantly but with different kinetics The increase in TSC22D2 transcripts is transient and closely resembles that observed previously for tilapia OSTF1 [12] Thus, despite the higher degree of structural homology of tilapia OSTF1 with murine TSC22D3-1, the novel murine TSC22D2 transcripts represent the closest functional homologs of tilapia OSTF1 The magnitude and kinetics of hyperosmotic upregulation of TSC22D2 splice variants shows some differences TSC22D2-1 and TSC22D2-4 responded earlier and more robustly than TSC22D2-2 and TSC22D2-3 Splice variants of other genes that respond differentially to osmotic stress have been reported before, e.g for cyclooxygenase in human intestinal epithelial cells [32] In addition such regulation has been observed for other types of stress For instance, Drosophila heat shock transcription factor is regulated by 118 alternative splicing in response to heat ⁄ cold stress [33] The splicing factor hSlu7 was reported to alter its subcellular distribution and thus modulate alternative splicing after UV stress [34] In fact, alternative splicing of pre-mRNA encoding transcription factors represents a common mechanism for generating the complexity and diversity of gene regulation patterns [35–38] This mechanism produces a variety of functionally distinct isoforms from a single gene by use of different combinations of splice junctions For example, alternative splicing within the DNA-binding domain of Pax-6 alters DNA-binding specificity of the resulting proteins [39] Alternative splicing of the transactivation domains in Pax-8 [40], the POU homeodomain family protein Pit-1 [41] and the zinc finger transcription factor GATA-5 [42] also results in protein isoforms with different transactivation properties Deletion by splicing of the transactivation domain in AML1a [43] and CREB [44] produces proteins with dominant negative activity This may also be the case for TSC22D2 splice variants with a truncated transactivation domain, in particular TSC22D2-4 Thus, alternative splicing of TSC22D2 may confer increased complexity of gene regulation in response to hyperosmotic stress Our data indicate that TSC22D2-4 represents a survival factor for renal cells exposed to hyperosmolality suggesting that it promotes osmotic adaptation programs, possibly by acting as a transcriptional repressor of proapoptotic genes The time course of hyperosmotic induction of the murine TSC22D4 transcript is slower than TSC22D2, more stable, and more closely resembles that observed previously for TonEBP [45], although more transient hyperosmotic activation of TonEBP similar to that of TSC22D2 has also been reported recently [46] Moreover, significantly higher levels of TSC22D4 in renal papilla vs cortex raise the possibility that this gene is stably upregulated by hyperosmolality not only in vitro but also in vivo Of interest, AP1 (jun, fos) and NF-jB are transcription factors that are regulated by osmotic stress [47–52] and, intriguingly, they are known to interact with TSC22D3-2 (GILZ) [23–25] TSC22D3 is regulated by aldosterone in kidney cells Aldosterone is the major corticosteroid hormone regulating electrolyte and fluid homeostasis in all vertebrates [53,54] The major action of the hormone on renal Na+ transport is localized to the collecting duct Our results show that both TSC22D3 transcripts increase transiently in response to aldosterone treat- FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS D F Fiol et al ment Upregulation of TSC22D3-2 (GILZ) by a corticosteroid hormone has been observed previously in human lymphocytes [14], rat kidney [55], human peripheral blood mononuclear cells [56] and in a mouse kidney cortical collecting duct cell line [21] Upregulation of TSC22D3-1 by a corticosteroid hormone was observed in human peripheral blood mononuclear cells [28] Thus, TSC22D3 is a gene that is robustly upregulated by corticosteroid hormones in a wide variety of tissues, including kidney Our results indicate an antagonistic effect of aldosterone and hyperosmotic stress on the early responses of TSC22D2 and TSC22D3 transcripts Aldosterone failed to induce TSC22D3 transcripts in the presence of hyperosmotic stress, and reciprocally, hyperosmotic stress failed to induce TSC22D2 transcripts in the presence of lm aldosterone This phenomenon seems restricted to the early responses (1–12 h) as long-term hyperosmotic effects on TSC22D3-2 and TSC22D4 transcripts were not altered by aldosterone Consistent with these data, a hypertonic reduction of aldosteronestimulated Na+ transport was reported in rat IMCD [57] The molecular mechanism of interaction between corticosteroid hormone-induced and hypertonic stressinduced pathways controlling expression of TSC22D isoforms remains unknown, but our results suggests that they involve common elements that are affected antagonistically by these two agents The TSC22D1 gene was unresponsive to either hyperosmolality or aldosterone treatment Overall, our data suggest that the four TSC22D genes are not functionally redundant but involved in different aspects of cellular regulation that are triggered by distinct extracellular signals Hyperosmotic upregulation of TSC22D2 is triggered by hypertonicity and results from mRNA stabilization We tested the effect of different hyperosmotic media to investigate the signal for TSC22D2 upregulation Our results show that TSC22D2 is only elevated when hyperosmotic media are prepared with nonpermeable solutes Hyperosmolality per se (resulting from elevation of cell-permeable solutes) was insufficient to elicit a response Thus, we conclude that hypertonicity is the signal for TSC22D2 upregulation We recently reported that tilapia OSTF1 hyperosmotic induction is also dependant on hypertonicity [58] and in mIMCD3 cells hypertonicity represents the signal for induction of mRNAs encoding the TonEBP transcription factor and multiple genes involved in compatible osmolyte accumulation, protein-, and DNA- stabilization [45,59] Osmotic regulation of TSC22D in kidney cells The molecular nature of the hypertonicity signal is not yet known Hypertonicity is known to cause many secondary effects including cell shrinkage, macro- and micromolecular crowding, changes in the organization of cell membranes, altered water movements across cell membranes (osmosis), and stress on the cytoskeleton [60] Such secondary effects are independent of the particular solutes responsible for hypertonicity and our results illustrate that there is no specific sodium or chloride ion requirement for TSC22D2 upregulation Therefore, we conclude that one or more of the abovementioned secondary effects associated with hypertonicity provide the sensory stimulus that triggers TSC22D2 upregulation Of interest, TSC22D2 isoforms responded to hypertonic stress even in the presence of the transcriptional repressor actinomycin D, indicating that they are regulated by mRNA stabilization In concordance with these results, hyperosmotic upregulation of tilapia OSTF1 is also based on mRNA stabilization [58] In addition, mRNA stabilization was also observed in the regulation of GADD45 genes [59], TonEBP transcription factor [46] and aquaporin [61] in response to hypertonicity mRNA stabilization is a regulatory mechanism involved in rapid responses to various forms of cellular stress, including heat shock [62], UV irradiation [63,64], hypoxia [65] and nutrient deprivation [66] This mechanism permits a rapid increase in steady state mRNA levels by preventing its degradation It is characteristic of inducible transcription factors and other immediate early genes with high rates of mRNA turnover [67] Thus, stabilization of TSC22D2 mRNA during hypertonicity supports a regulatory role of its protein product for osmotic stress adaptation of renal cells Experimental procedures Cell culture Murine inner medullary collecting duct (mIMCD3) cells of passage 18 were used for all experiments [68] Cell culture medium consisted of 45% Ham’s F-12, 45% DMEM, 10% fetal bovine serum, 10 mmL)1 penicillin, and 10 lgỈmL)1 streptomycin (all reagents were from Invitrogen, Carlsbad, CA) Cells were grown at 37 °C and 5% CO2 Final medium osmolality of isosmotic medium was 300 ± mOsmolỈkg)1 of H2O Hyperosmotic media were prepared by the addition of an appropriate amount of NaCl to isosmotic medium to yield the indicated osmolality When specified, choline chloride, sodium gluconate, urea, mannitol or glycerol instead of NaCl were added for hyperosmotic media preparation Final osmolality of all media was FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 119 Osmotic regulation of TSC22D in kidney cells D F Fiol et al verified with a microosmometer (Model 3300, Advanced Instruments, Norwood, MA) Aldosterone (A9477; Sigma, St Louis, MO) was added when indicated to a final concentration of lgỈmL)1 Controls with vehicle (ethanol) were always run in parallel In all experiments, medium was substituted 24 h before treatments with a hormone-free medium, where 10% dextran ⁄ charcoal-treated fetal bovine serum (Biosource, Rockville, MD, USA) replaced the 10% fetal bovine serum Animals and RNA isolation C57 ⁄ BL6 mice were obtained from the Jackson Laboratory (Bar Harbor, ME) and a stock maintained at the ColeB small animal colony at UC Davis Mice were kept on a normal mouse diet with water ad libitum After culling mice using CO2, kidneys were dissected into papilla, medulla, and cortex and these tissues immediately snap-frozen in liquid nitrogen [69] All procedures were approved by the UC Davis Institutional Animal Care and Use Committee (IACUC) Total RNA from mIMCD3 cells or renal tissues was extracted using Trizol reagent (Invitrogen) as specified by the manufacturer RNA was treated with DNase (Turbo DNA free; Ambion, Austin, TX) and purity was confirmed and quantity determined by measuring absorbance of the samples at 260 and 280 nm (340 nm background values were subtracted) with a Beckman DU520 spectrophotometer cDNA synthesis and quantitative real-time PCR RNA (2 lg for mIMCD3 cells and 0.5 lg for renal tissues) was reverse-transcribed using Superscript III first-strand synthesis reagents (Invitrogen) with a random hexamer ⁄ oligo(dT) mix (1 ng ⁄ lL : lm) as primers Abundance of all transcripts was quantified with a PRISM 7500 real-time thermal cycler (Applied Biosystems, Foster City, CA, USA) Reactions were performed in duplicate in 20 lL reaction volume using SYBR Green PCR Master Mix (Applied Biosystems) and 30 pmol of each primer PCR conditions were 50 °C for and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for Data were collected at 60 °C Efficiencies of individual PCR reactions were analyzed using LinRegPCR [70] and were always > 1.9 All data were normalized to abundance of L32 mRNA encoding a ribosomal protein, and expressed as fold change over controls as described previously [71] L32 mRNA was selected as a normalizer gene over 18S rRNA, b-actin mRNA and GAP-3-DH mRNA based on highly constant levels of expression during all conditions as determined in preliminaries assays Gene-specific primer sequences were designed with primer express software (Applied Biosystems) The following sequences were used as templates for primer design: NM_172086.1(L32) from GenBank and AK007760 (TSC22D2), AF315352 (TSC22D4), AF201285 (TSC22D1-1), L25785 (TSC22D1-2), 120 AF024519 (TSC22D3-2), AF201289 (TSC22D3-1) from EMBL The absence of unwanted by-products was confirmed by automated melting curve analysis and agarose gel electrophoresis of PCR products Analysis of mRNA stability After 24 h incubation in hormone-free medium, cells were pretreated for h by adding actinomycin D (Sigma, A9415) to a final concentration of lgỈmL)1 After this h preincubation period cells were dosed with either hyperosmotic medium or aldosterone or both Cells were harvested at the times indicated for measurement of mRNA abundance by quantitative PCR as described above to measure the stability of transcripts in the absence of mRNA synthesis Overexpression of epitope-tagged TSC22D2-4 in mIMCD3 cells TSC22D2-4 ORF was amplified with the primers: GAAATGTTGTCCACAAGAGTGTC (forward; initiation codon in bold-type) and TGCTGAGGAGACATTCGG CTG (reverse) and the correct sequence of the PCR product was confirmed by double-pass sequencing pcDNA5 ⁄ FRT ⁄ Tsc22D2i3 construct was created by cloning the PCR product in the vector pcDNA5 ⁄ FRT ⁄ V5-His ⁄ Topo vector (Invitrogen) The construct was then propagated in Escherichia coli strain DH5 (Invitrogen) Endotoxinfree plasmid Mega-preps were performed using a kit as described by the manufacturer (Qiagen GmbH, Hilden, Germany) Stable cell lines were established by transfecting mIMCD3FRT cells (supplementary Fig S1) with lg of a : mix of pcDNA ⁄ FRT ⁄ Tsc22D2i3 plasmid DNA: pOG44 plasmid DNA and lL of LipofectAMINE 2000 reagent (Invitrogen) Twenty-four hours after transfection cells were selected with medium containing 0.6 lgỈmL)1 hygromycin (Invitrogen) After weeks individual colonies were picked, expanded, and tested for expression of V5-His epitope-tagged TSC22D2-4 using quantitative PCR and western blot analysis Protein extraction and western blot analysis For protein extraction, cells were lyzed in a buffer contained 50 mm TrisỈHCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mm NaCl, mm EDTA, tablet of minicomplete protease inhibitor mixture (Roche Molecular Biochemicals, Indianapolis, IN) per 10 mL, mm activated Na3VO4, and mm NaF Protein concentrations were determined by bicinchoninic acid protein assay according to the manufacturer’s instructions (Pierce, Rockford, IL) Proteins were separated by SDS ⁄ PAGE Equal amounts of protein (20 lg) were loaded in each lane of 12% Tris-glycine SDS ⁄ PAGE gels Samples were electro- FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS D F Fiol et al phoresed at 125 V, gels briefly rinsed in transfer buffer (25 mm Tris, 200 mm glycine, 20% methanol), and proteins blotted onto PDVF membrane (Millipore Corp., Bedford, MA) at mcm)2 for 90 using a TransBlot SD semidry transfer cell (Bio-Rad Laboratories, Hercules, CA) Membranes were blocked for 30 at room temperature in a solution containing 137 mm NaCl, 20 mm Tris, pH 7.6 (HCl), and 3% (w ⁄ v) nonfat dry milk They were then incubated for h in blocking buffer containing V5-HRP antibody (Santa Cruz Biotechnology, Santa Cruz, CA; : 5000) Blots were developed with SuperSignal Femto (Pierce) and imaged with a chemiimager (Alpha Innotech, San Leandro, CA, USA) Cell-viability assay Cells were grown in 12-well plates and harvested after being treated as indicated in the results section Appropriate dilutions of cell suspensions were obtained in 0.2% methylene blue, incubated for min, and viable (unstained) cells and dead (stained cells) were counted in Neubauer hemocytometer chambers Bioinformatics and statistical analysis Multiple sequence alignments and phylogentic trees were constructed with alignx software (Informax, Bethesda, MD, USA) Data analysis was carried out with sigmaplot 9.0 (Systat, San Jose, CA, USA) Differences between pairs of data were analyzed by unpaired t-test Differences in time series data sets were statistically evaluated using ANOVA Significance threshold was set at P < 0.05 and data are presented as mean ± SEM Acknowledgements We would like to thank Dr Devulapalli Chakravarty for assistance with the generation of the mIMCD3FRT cell lines This study was supported by a grant from the National Institute of Diabetes and Digestive and Kidney diseases (NIH R01-DK59470) Its contents are solely the responsibility of the authors and not necessarily represent the official views of the NIH References Burg MB, Kwon ED & Kultz D (1996) Osmotic reguă lation of gene expression FASEB J 10, 1598–1606 Burg MB, Kwon ED & Kultz D (1997) Regulation of ă gene expression by hypertonicity Annu Rev Physiol 59, 437–455 Handler JS & Kwon HM (1997) Kidney cell survival in high tonicity Comp Biochem Physiol Physiol 117, 301–306 Osmotic regulation of TSC22D in kidney cells Somero GN & Yancey P (1997) Osmolytes and cell volume regulation: physiological and evolutionary principles In Handbook of Cell Physiology (Hoffmann JF & Jamieson JD, eds), pp 441–484 Oxford University Press, Oxford Miyakawa H, Woo SK, Chen CP, Dahl SC, Handler JS & Kwon HM (1998) Cis- and trans-acting factors regulating transcription of the BGT1 gene in response to hypertonicity Am J Physiol 274, F753–F761 Woo SK, Lee SD, Na KY, Park WK & Kwon HM (2002) TonEBP ⁄ NFAT5 stimulates transcription of HSP70 in response to hypertonicity Mol Cell Biol 22, 5753–5760 Nakayama Y, Peng T, Sands JM & Bagnasco SM (2000) The TonE ⁄ TonEBP pathway mediates tonicity-responsive regulation of UT-A urea transporter expression J Biol Chem 275, 38275–38280 Kultz D, Garcia-Perez A, Ferraris JD & Burg MB ă (1997) Distinct regulation of osmoprotective genes in yeast and mammals Aldose reductase osmotic response element is induced independent of p38 and stress-activated protein kinase ⁄ Jun N-terminal kinase in rabbit kidney cells J Biol Chem 272, 13165– 13170 Dmitrieva N, Kultz D, Michea L, Ferraris J & Burg M ă (2000) Protection of renal inner medullary epithelial cells from apoptosis by hypertonic stress-induced p53 activation J Biol Chem 275, 18243–18247 10 Kultz D & Chakravarty D (2001) Maintenance of ă genomic integrity in mammalian kidney cells exposed to hyperosmotic stress Comp Biochem Physiol Mol Integr Physiol 130, 421–428 11 Ferraris JD, Persaud P, Williams CK, Chen Y & Burg MB (2002) cAMP-independent role of PKA in tonicityinduced transactivation of tonicity-responsive enhancer ⁄ osmotic response element-binding protein Proc Natl Acad Sci USA 99, 16800–16805 12 Fiol DF & Kultz D (2005) Rapid hyperosmotic coină duction of two tilapia (Oreochromis mossambicus) transcription factors in gill cells Proc Natl Acad Sci USA 102, 927–932 13 Shibanuma M, Kuroki T & Nose K (1992) Isolation of a gene encoding a putative leucine zipper structure that is induced by transforming growth factor beta and other growth factors J Biol Chem 267, 10219–10224 14 D’Adamio F, Zollo O, Moraca R, Ayroldi E, Bruscoli S, Bartoli A, Cannarile L, Migliorati G & Riccardi C (1997) A new dexamethasone-induced gene of the leucine zipper family protects T lymphocytes from TCR ⁄ CD3-activated cell death Immunity 7, 803–812 15 Hubbard T, Barker D, Birney E, Cameron G, Chen Y, Clark L, Cox T, Cuff J, Curwen V, Down T et al (2002) The Ensembl genome database project Nucleic Acids Res 30, 38–41 FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 121 Osmotic regulation of TSC22D in kidney cells D F Fiol et al 16 Blake JA, Richardson JE, Bult CJ, Kadin JA & Eppig JT (2003) MGD: the mouse genome database Nucleic Acids Res 31, 193–195 17 Burge C & Karlin S (1997) Prediction of complete gene structures in human genomic DNA J Mol Biol 268, 78–94 18 Birney E, Clamp M & Durbin R (2004) GeneWise and Genomewise Genome Res 14, 988–995 19 Mak SK & Kultz D (2004) Gadd45 proteins induce ¨ G2 ⁄ M arrest and modulate apoptosis in kidney cells exposed to hyperosmotic stress J Biol Chem 279, 39075–39084 20 Kester HA, Blanchetot C, den Hertog J, van der Saag PT & van der Burg B (1999) Transforming growth factor-beta-stimulated clone-22 is a member of a family of leucine zipper proteins that can homo- and heterodimerize and has transcriptional repressor activity J Biol Chem 274, 27439–27447 21 Robert-Nicoud M, Flahaut M, Elalouf JM, Nicod M, Salinas M, Bens M, Doucet A, Wincker P, Artiguenave F, Horisberger JD et al (2001) Transcriptome of a mouse kidney cortical collecting duct cell line: effects of aldosterone and vasopressin Proc Natl Acad Sci USA 98, 2712–2716 22 Tynan SH, Lundeen SG & Allan GF (2004) Cell typespecific bidirectional regulation of the glucocorticoidinduced leucine zipper (GILZ) gene by estrogen J Steroid Biochem Mol Biol 91, 225–239 23 Mittelstadt PR & Ashwell JD (2001) Inhibition of AP-1 by the glucocorticoid-inducible protein GILZ J Biol Chem 276, 29603–29610 24 Ayroldi E, Zollo O, Macchiarulo A, Di Marco B, Marchetti C & Riccardi C (2002) Glucocorticoidinduced leucine zipper inhibits the Raf-extracellular signal-regulated kinase pathway by binding to Raf-1 Mol Cell Biol 22, 7929–7941 25 Asselin-Labat ML, David M, Biola-Vidamment A, Lecoeuche D, Zennaro MC, Bertoglio J & Pallardy M (2004) GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal-induced apoptosis Blood 104, 215–223 26 Soundararajan R, Zhang TT, Wang J, Vandewalle A & Pearce D (2005) A novel role for glucocorticoidinduced leucine zipper protein in epithelial sodium channel-mediated sodium transport J Biol Chem 280, 39970–39981 27 Sillard R, Schulz-Knappe P, Vogel P, Raida M, Bensch KW, Forssmann WG & Mutt V (1993) A novel 77-residue peptide from porcine brain contains a leucine-zipper motif and is recognized by an antiserum to delta-sleep-inducing peptide Eur J Biochem 216, 429–436 28 Franchimont D, Galon J, Vacchio MS, Fan S, Visconti R, Frucht DM, Geenen V, Chrousos GP, Ashwell JD & O’Shea JJ (2002) Positive effects of glucocorticoids 122 29 30 31 32 33 34 35 36 37 38 39 40 41 on T cell function by up-regulation of IL-7 receptor alpha J Immunol 168, 2212–2218 Fiorenza MT, Mukhopadhyay M & Westphal H (2001) Expression screening for Lhx3 downstream genes identifies Thg-1pit as a novel mouse gene involved in pituitary development Gene 278, 125–130 Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF et al (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences Proc Natl Acad Sci USA 99, 16899–16903 Carninci P & Hayashizaki Y (1999) High-efficiency fulllength cDNA cloning Methods Enzymol 303, 19–44 Nurmi JT, Puolakkainen PA & Rautonen NE (2005) Intron retaining cyclooxygenase splice variant is induced by osmotic stress in human intestinal epithelial cells Prostagland Leukocyt Essent Fatty Acids 73, 343– 350 Fujikake N, Nagai Y, Popiel HA, Kano H, Yamaguchi M & Toda T (2005) Alternative splicing regulates the transcriptional activity of Drosophila heat shock transcription factor in response to heat ⁄ cold stress FEBS Lett 579, 3842–3848 Shomron N, Alberstein M, Reznik M & Ast G (2005) Stress alters the subcellular distribution of hSlu7 and thus modulates alternative splicing J Cell Sci 118, 1151–1159 Hashimoto Y, Zhang C, Kawauchi J, Imoto I, Adachi MT, Inazawa J, Amagasa T, Hai T & Kitajima S (2002) An alternatively spliced isoform of transcriptional repressor ATF3 and its induction by stress stimuli Nucleic Acids Res 30, 2398–2406 Lopez AJ (1995) Developmental role of transcription factor isoforms generated by alternative splicing Dev Biol 172, 396–411 Lopez AJ (1998) Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation Annu Rev Genet 32, 279–305 Cooper TA & Mattox W (1997) The regulation of splice-site selection, and its role in human disease Am J Hum Genet 61, 259–266 Chen CY & Schwartz RJ (1996) Recruitment of the tinman homolog Nkx-2.5 by serum response factor activates cardiac alpha-actin gene transcription Mol Cell Biol 16, 6372–6384 Kozmik Z, Kurzbauer R, Dorfler P & Busslinger M (1993) Alternative splicing of Pax-8 gene transcripts is developmentally regulated and generates isoforms with different transactivation properties Mol Cell Biol 13, 6024–6035 Morris AE, Kloss B, McChesney RE, Bancroft C & Chasin LA (1992) An alternatively spliced Pit-1 isoform altered in its ability to trans-activate Nucleic Acids Res 20, 1355–1361 FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS D F Fiol et al 42 MacNeill C, Ayres B, Laverriere AC & Burch JB (1997) Transcripts for functionally distinct isoforms of chicken GATA-5 are differentially expressed from alternative first exons J Biol Chem 272, 8396– 8401 43 Tanaka T, Tanaka K, Ogawa S, Kurokawa M, Mitani K, Nishida J, Shibata Y, Yazaki Y & Hirai H (1995) An acute myeloid leukemia gene, AML1, regulates hemopoietic myeloid cell differentiation and transcriptional activation antagonistically by two alternative spliced forms EMBO J 14, 341–350 44 Foulkes NS & Sassone-Corsi P (1992) More is better: activators and repressors from the same gene Cell 68, 411–414 45 Woo SK, Dahl SC, Handler JS & Kwon HM (2000) Bidirectional regulation of tonicity-responsive enhancer binding protein in response to changes in tonicity Am J Physiol Renal Physiol 278, F1006–F1012 46 Cai Q, Ferraris JD & Burg MB (2005) High NaCl increases TonEBP ⁄ OREBP mRNA and protein by stabilizing its mRNA Am J Physiol Renal Physiol 289, 803–807 47 Kultz D (1996) Plasticity and stressor specicity of ă osmotic and heat shock responses of Gillichthys mirabilis gill cells Am J Physiol 271, C1181–C1193 48 Ying Z, Reisman D & Buggy J (1996) AP-1 DNA binding activity induced by hyperosmolality in the rat hypothalamic supraoptic and paraventricular nuclei Brain Res Mol Brain Res 39, 109–116 49 Clerk A & Sugden PH (1997) Cell stress-induced phosphorylation of ATF2 and c-Jun transcription factors in rat ventricular myocytes Biochem J 325, 801–810 50 Nemeth ZH, Deitch EA, Szabo C & Hasko G (2002) Hyperosmotic stress induces nuclear factor-kappaB activation and interleukin-8 production in human intestinal epithelial cells Am J Pathol 161, 987–996 51 Pingle SC, Sanchez JF, Hallam DM, Williamson AL, Maggirwar SB & Ramkumar V (2003) Hypertonicity inhibits lipopolysaccharide-induced nitric oxide synthase expression in smooth muscle cells by inhibiting nuclear factor kappaB Mol Pharmacol 63, 1238–1247 52 Rao R, Hao CM & Breyer MD (2004) Hypertonic stress activates glycogen synthase kinase 3betamediated apoptosis of renal medullary interstitial cells, suppressing an NFkappaB-driven cyclooxygenase-2dependent survival pathway J Biol Chem 279, 3949– 3955 53 Horisberger JD & Rossier BC (1992) Aldosterone regulation of gene transcription leading to control of ion transport Hypertension 19, 221–227 54 Verrey F (1995) Transcriptional control of sodium transport in tight epithelial by adrenal steroids J Membr Biol 144, 93–110 55 Muller OG, Parnova RG, Centeno G, Rossier BC, Firsov D & Horisberger JD (2003) Mineralocorticoid Osmotic regulation of TSC22D in kidney cells 56 57 58 59 60 61 62 63 64 65 66 67 68 effects in the kidney: correlation between alphaENaC, GILZ, and Sgk-1 mRNA expression and urinary excretion of Na+ and K+ J Am Soc Nephrol 14, 1107– 1115 Smit P, Russcher H, de Jong FH, Brinkmann AO, Lamberts SW & Koper JW (2005) Differential regulation of synthetic glucocorticoids on gene expression levels of glucocorticoid-induced leucine zipper and interleukin-2 J Clin Endocrinol Metab 90, 2994–3000 Husted RF & Stokes JB (1996) Separate regulation of Na+ and anion transport by IMCD: location, aldosterone, hypertonicity, TGF-beta 1, and cAMP Am J Physiol 271, F433–F439 Fiol DF, Chan SY & Kultz D (2006) Regulation of ă osmotic stress transcription factor (Ostf1) in tilapia (Oreochromis mossambicus) gill epithelium during salinity stress J Exp Biol 209, 3257–3265 Chakravarty D, Cai Q, Ferraris JD, Michea L, Burg MB & Kultz D (2002) Three GADD45 isoforms contriă bute to hypertonic stress phenotype of murine renal inner medullary cells Am J Physiol Renal Physiol 283, F1020–F1029 Kultz D & Burg MB (1998) Intracellular signaling in ă response to osmotic stress Contrib Nephrol 123, 94– 109 Leitch V, Agre P & King LS (2001) Altered ubiquitination and stability of aquaporin-1 in hypertonic stress Proc Natl Acad Sci USA 98, 2894–2898 Andrews GK, Harding MA, Calvet JP & Adamson ED (1987) The heat shock response in HeLa cells is accompanied by elevated expression of the c-fos proto-oncogene Mol Cell Biol 7, 3452–3458 Wang W, Furneaux H, Cheng H, Caldwell MC, Hutter D, Liu Y, Holbrook N & Gorospe M (2000) HuR regulates p21 mRNA stabilization by UV light Mol Cell Biol 20, 760–769 Westmark CJ, Bartleson VB & Malter JS (2005) RhoB mRNA is stabilized by HuR after UV light Oncogene 24, 502–511 Levy NS, Chung S, Furneaux H & Levy AP (1998) Hypoxic stabilization of vascular endothelial growth factor mRNA by the RNA-binding protein HuR J Biol Chem 273, 6417–6423 Yaman I, Fernandez J, Sarkar B, Schneider RJ, Snider MD, Nagy LE & Hatzoglou M (2002) Nutritional control of mRNA stability is mediated by a conserved AU-rich element that binds the cytoplasmic shuttling protein HuR J Biol Chem 277, 41539–41546 Bakheet T, Frevel M, Williams BR, Greer W & Khabar KS (2001) ARED: human AU-rich elementcontaining mRNA database reveals an unexpectedly diverse functional repertoire of encoded proteins Nucleic Acids Res 29, 246–254 Rauchman MI, Nigam SK, Delpire E & Gullans SR (1993) An osmotically tolerant inner medullary FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS 123 Osmotic regulation of TSC22D in kidney cells D F Fiol et al collecting duct cell line from an SV40 transgenic mouse Am J Physiol 265, F416–F424 69 Valkova N, Yunis R, Mak SK, Kang K & Kultz D ă (2005) Nek8 mutation causes overexpression of galectin-1, sorcin, and vimentin and accumulation of the major urinary protein in renal cysts of jck mice Mol Cell Proteomics 4, 1009–1018 70 Ramakers C, Ruijter JM, Deprez RH & Moorman AF (2003) Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data Neurosci Lett 339, 62–66 71 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR Nucleic Acids Res 29, 45 Supplementary material The following supplementary material is available online: Fig S1 Three new isogenic cell lines of mIMCD3 cells (mIMCD3–FRT1 mIMCD3–FRT2, mIMCD3–FRT3) were constructed using the Flp-In system (Invitrogen) To create the new mIMCD3-FRT cell lines, mIMCD3 cells were first stably transfected with pFRT lacZeo)1 using lipofectamine 2000 (Invitrogen) and then selected for 14 days in 600 lgỈmL)1 Zeocin (A) Three neigh- 124 boring cell colonies with high levels of b-galactosidase activity were expanded and stained with X-Gal (blue color; mIMCD3-FRT1 mIMCD3-FRT2, mIMCD3FRT3) (B) A Southern blot developed with a probe that is specific for the incorporated FRT site shows that all three new isogenic cell lines originated from the same clone and have a single FRT site stably integrated into the genome Fig S2 mIMCD3 cells were preincubated for h with lgỈmL)1 actinomycin D (gray bars) or left untreated (controls, black bars) Aldosterone was added to a final concentration of lm and at the indicated times RNA levels were determined by quantitative real-time PCR and normalized to L32 Data represent the mean and error bars for three independent experiments Table S1 Sequences for all PCR primers used in this study, listed in 5¢- to 3¢ direction This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 274 (2007) 109–124 ª 2006 University of California Journal compilation ª 2006 FEBS ... 117 Osmotic regulation of TSC22D in kidney cells D F Fiol et al All nine TSC22D transcripts are expressed in mouse kidney cells Expression of all nine TSC22D transcripts was confirmed in mouse kidney. .. in kidney cells D F Fiol et al Regulation of TSC22D transcripts in mIMCD3 cells by hyperosmotic stress and aldosterone The responsiveness of TSC22D transcripts to hyperosmotic stress and ⁄ or... sequester other TSC22D family members [20] TSC22D2 and TSC22D4 are regulated by hyperosmolality in kidney cells In mIMCD3 cells exposed to hyperosmolality TSC22D2 and TSC22D4 transcripts increase