read the following passage then fill in each blank with a suitable word from the box 2ps
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... protein and in vitro solubility data was assessed (Fig 2) Data providing information about the amount of soluble produced protein was obtained from the SDS ⁄ PAGE and western blotting analyses and ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and...
- 11
- 445
- 0
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... obtained by centrifugation and 500-lL aliquots were placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according ... randomly chosen mice for cytokine analysis (MCP-1, TNF -a, IL-6, IL-10, IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data ... (Fig 5) These domains are distinct from the RCL (amino acids 324–340) involved in the antihemostatic action of Iris [21] and are not affected by the structural rearrangement during protease inhibition...
- 12
- 499
- 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... allosterically activate the serpin by displacing the acidic amino terminus from an intramolecular interaction with the basic GAG binding site and freeing it for binding to the thrombin anion-binding ... Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin – Heparin Heparin ⁄ calcium 4 2 4 1 3 Factor Xa HCII Thrombin PCI Thrombin fXa aPC · · · ... reported in a range of publications cited in this article) Serpin Enzyme Glycosaminoglycan kass (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin...
- 10
- 668
- 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... treating in ation as a random process, we are able to model expected in ation and the cost of the uncertainty associated with in ation separately In ation expectations and in ation risk premia ... value In an in ation-indexed bond, the coupons are indexed to in ation so that the real value of the coupons and principal is preserved In Australia, in ation-indexed bonds are indexed with a lag ... falling sharply with the onset of the global financial crisis, and then rising again as markets reassessed the likelihood of a severe downturn in Australia (figure 3) The main qualitative point...
- 32
- 347
- 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... both the instantaneous in ation rate and the market price of in ation risk as affine functions of three latent factors The instantaneous in ation rate is i At time t, the in ation forward rate at ... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Office: rbainfo@rba.gov.au Abstract We estimate in ation ... high in ation in Australia Interestingly, there appears to have been a sustained general rise in inflation expectations between 2004 and 2008 at all horizons Again this was a time of rising domestic...
- 39
- 395
- 0
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc
... eliminated due to the noise present in the automatically generated training data We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance for our maxent model, and ... combined with automatic and manual feature selection to eliminate the skewed nature of the data obtained, is a good way of building hedge classifier modules with an acceptable performance The analysis ... Computational Natural Language Learning Conference, pages 25–32, Edmonton, Canada, May-June Association for Computational Linguistics James G Shanahan, Yan Qu, and Janyce Wiebe 2005 Computing Attitude...
- 9
- 407
- 0
Báo cáo toán học: " Transient noise reduction in speech signal with a modified long-term predictor" ppt
... Time-domain waveforms of (a) : Noise signal, (b): Residual signal after STP analysis, and (c): Residual signal after LTP analysis Table NCC between transient noise and residual signals Residual after ... max gp max , otherwise (7) We restrict the gain to 1.2 in the proposed system [12] Utilizing the estimated pitch lag and gain, the LTP analysis filter extracts the pitch component from the input ... to the look-ahead memory A method to find a fractional pitch lag can be also applied to Eq (14), which may further improve the pitch estimation accuracy The optimum pitch gain for the estimated...
- 9
- 464
- 0
Báo cáo hóa học: " Fine Splitting of Electron States in Silicon Nanocrystal with a Hydrogen-like Shallow Donor" ppt
... levels Indices a, b, c enumerate the spatial axes In Eqs 10, 11 they not coincide with each other The notation ‘‘E(±)’’ implies the solution obtained for the X-point a located at a- direction in the ... stands for the lattice constant of silicon The quasimomentum p and the energy E have the origin at the X-point Equation for an undoped nanocrystal has been already solved earlier [26] In the following ... s-type has been also plotted in the figure with solid line Since we direct the radial axis parallel to h, the donor is always situated somewhere at the right half of this axis ð within the range...
- 7
- 255
- 0
Báo cáo toán học: " Stress Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp" potx
... rectangle of the elastic strip situated under the bottom of the stamp from the data given in Part A and a specification of the displacement u = u(x) under the stamp Part A The Contact Problem Fig.1 ... (3) The paper consists of two parts In the first part, Part A, we compute the normal stress σy under the stamp The second part, Part B, is devoted to a determination of the stress field in a rectangle ... Field in an Elastic Strip in Frictionless Contact with a Rigid Stamp 475 D D Ang, Stabilized aproximate solution of certain integral equations of first kind arizing in mixed problems of elasticity,...
- 7
- 289
- 0
Báo cáo y học: "Transient early preeclampsia in twin pregnancy with a triploid fetus: a case report" pot
... that, after the death of the triploid twin, the partial molar placenta can still cause preeclampsia, but the preeclampsia can regress We conclude that, in the case of a twin pregnancy with a triploid ... twin pregnancy with a successful outcome for the healthy co-twin after early transient preeclampsia Case presentation A 33-year-old Caucasian woman, gravida 3, para 1, was admitted to our clinic ... fetus and one complete or partial molar, with or without a triploid fetus, are rare The molar tissue can provoke early preeclampsia, heavy vaginal bleeding and persistent gestational trophoblastic...
- 4
- 328
- 0
Báo cáo sinh học: "Reconstructing phylogenies from noisy quartets in polynomial time with a high success probability" docx
... components, each with at most n leaves, and such a node can be found in linear time in T such that each of the trees in T - {v} has at most n leaves An internal node v of T having such a property is called ... O(n5) time In each iteration of inserting a taxon into the current phylogeny, the algorithm goes through all the remaining taxa to make a selection Therefore the overall running time of the algorithm ... above and detailed in Table can be employed to construct the true phylogeny, where one can easily see that the final phylogeny obtained after inserting all the taxa satisfies all the quartet...
- 10
- 291
- 0
Báo cáo y học: "In silico experimentation with a model of hepatic mitochondrial folate metabolism" pps
... groups are carried by an increase in the rate of the GNMT reaction during loading The rise in SAM also causes an increase in the rate of the CBS reaction during loading, so there is an increased ... dietary input and vitamin status We plan to investigate the dynamic properties and potential interactions among the many methyltransferases that act in parallel using SAM as a substrate Finally, ... during protein loading and the mitochondrial SHMT reaction reverses direction The increase in serine increases the CBS reaction and the fraction transsulfurated, and the increase in glycine increases...
- 11
- 207
- 0
Reordering in statistical machine translation a function word, syntax based approach
... long-distance reordering 2.2 Phrase-based Approach Learning from the weaknesses of the word- based approach, the phrase-based approach improves statistical machine translation formulation in at least ... ordering of function words The heads are Chinese characters in the box and their ranks are indicated by the number in the box The node’s label indicates the head that is currently active reordering ... this thesis, we investigate a specific area within Statistical Machine Translation (SMT): the reordering task – the task of arranging translated words from source to target language order This task...
- 192
- 238
- 0
Problems of decision making in rural development NGOs a case study from india
... Welfare and Awakening in Rural Environment India Foundation AKRDP – Aga Khan Rural Development Programme AKRSP - Aga Khan Rural Support Programme AWARE – Action for Welfare and Awakening in Rural ... India with outreach projects in the North Its head office is in Hyderabad (capital of the state of Andhra Pradesh), but operates in other states like Tamil Nadu, Kerala, Karnataka, Orissa, and ... like AWARE, try to involve people in development AWARE addresses welfare, health, education, microfinance, vocational training, women and childcare and even political participation Apart from AWARE,...
- 314
- 362
- 0
PHOTOSTIMULATED QUANTUM EFFECTS IN QUANTUM WELLS WITH a PARABOLIC POTENTIAL
... expressions for electric field → − intensity vector E along the coordinate axes for the case of a specific GaAs/GaAsAl quantum wells The parameters used in the calculations are as follows [7, 8]: = 12,5; ... of the laser radiation; and on the parameters QW with a parabolic potential When ω0 → 0, the Eqs (9), (10), (11) give the same results as those obtained in bulk semiconductor [5, 12] The analytical ... E0x /EW on the amplitude F of the intense laser radiation in different cases of Ω From this figure, we can see that the more amplitude F of the laser radiation increases, the more the quotient...
- 6
- 323
- 0
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
... resultant force is to be F1, directed along the keel aa as shown, determine the magnitudes of forces T and P acting in each rope and the angle θ of P so that the magnitude of P is a minimum T acts ... as shown, determine the orientation θ of the third chain,measured clockwise from the positive x axis, so that the magnitude of force F in this chain is a minimum All forces lie in the x-y plane.What ... - Statics Chapter Problem 2-27 The beam is to be hoisted using two chains Determine the magnitudes of forces FA and FB acting on each chain in order to develop a resultant force T directed along...
- 1,119
- 1,071
- 2
Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
... frustration D sleeplessness Read the following passage and mark the letter A, B, C, or D on your answer sheet to indicate the correct word for each of the blanks from 31 to 40 Human beings have a ... the rest in the position of the main stress in each of the following questions wandered the dry and mountainous lands between the Rocky Mountains and the Pacific Ocean They gathered seeds and hunted ... rituals of American Indians D The way of life of American Indian tribes in early North America Question 72 According to the passage, the Hopi and Zuni typically built their homes A in valleys...
- 13
- 3,561
- 0
Mark the letter a b c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
... universal way B in different ways D either in the same way or in different ways Question 79 : The word “conflicting” appears in the last paragraph, and “conflict" can also be used as a noun For example, ... are so widespread in all cultures that there seems to be a physical basis for them All people react in the same way to certain exciting situations by breathing more rapidly and experiencing increased ... for each of the blanks The first traffic signal was invented by a railway signaling engineer It was installed (61) _ the Houses of Parliament in 1868 It (62) like any railway signal...
- 15
- 4,212
- 0
Read the passage and decide if the following statements are TRUE or FALSE
... France to the people in the United States The Statue was built in France Then it was taken apart, shipped across the Atlantic Ocean in crate, and rebuilt in the USA The statue weighs 225 tons and ... in two places They think that one kind of rice grew in Southern Asia thousands of years ago Someone in China wrote about it almost five thousand years ago Another kind probably grew in West Africa ... international language ? In the middle 19 th century, French was the international language The Britain became powerful in the world England stated colonies in the North Africa and India in the 17th century...
- 8
- 1,870
- 1
- iv fill in each blank a suitable word in the box and answer the below questions 3 5
- fill each blank with a suitable word
- fill in each blank with a suitable word
- b fill in each blank with one word or phrase from the dialogue p 75
- fill in each blank with one word or phrase from the dialogue
- choose the word or phrase a b c or d to fill in each blank to make a meaningful passage
- read the text and fill in each blank with a suitable verb
- an a some any fill in each blank with an a some or any
- the words in the box all appear in the passage fill each blank with a suitable word
- the words in the box all appear in the passage fill each blank with a suitabl word
- choose the most appropriate word or phrase to fill in each blank 2 25pts
- read the text carefully and fill in each blank with a suitable word moói caõu 0 25ủieồm
- fill each blank with a suitable word phrase various tuition preparatory aid private available grade prepare
- choose the most appropriate word or phrase to fill in each blank 2 75pts
- fill in each space with a suitable word
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25