an a some any fill in each blank with an a some or any
hoa duoc
... analytical balance is the most basic measurement made in an analytical laboratory Determining and comparing mass is fundamental to assays such as moisture and fat determination Accurately weighing ... my graduate student, Cynthia Machado, for her assistance and offering advice based on her experience in serving as a teaching assistant for a Food Analysis laboratory course West Lafayette, IN ... several laboratories Collaborative evaluations are sanctioned by groups such as AOAC International, AACC International, and the American Oil Chemists Society (AOCS) Such collaborative studies are...
- 171
- 2,080
- 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx
... O-antigens are available commercially; i.e anti-sera containing one or more “O” groups (called monovalent or polyvalent anti-O sera), anti-Vi sera, and anti-sera containing antibodies for one or ... 6.3 Incubator, capable of operating at 37 °C ± °C 6.4 Water bath, capable of operating at 41,5 °C ± °C, or incubator, capable of operating at 41,5 °C ± °C 6.5 Water baths, capable of operating at ... laboratory receive a sample which is truly representative and has not been damaged or changed during transport or storage Sampling is not part of the method specified in this International Standard...
- 34
- 690
- 0
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot
... into components creates a collection of set programming instances with a wide range of sizes and difficulty; we examine each instance and choose appropriate techniques for each one Table summarizes ... means there are no constraints between elements after u and elements before, or incomparable with, u All constraints across u must involve u directly As a result, we can solve a smaller instance ... solve an instance, and shows the number of times each rule was applied in a typical run with the modules extracted from ERG, a ten-minute timeout, and each λ from to 10 In many simple cases, GAK...
- 10
- 410
- 0
Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot
... penalized if a word occurs more frequently in a candidate translation than its maximum reference count This rewards using a word as many times as warranted and penalizes using a word more times than it ... It is clear that a program can rank Candidate higher than Candidate simply by comparing ngram matches between each candidate translation and the reference translations Experiments over large collections ... but not all Indeed, recalling all choices leads to a bad translation Here is an example Example 4: Candidate 1: I always invariably perpetually Candidate 2: I always Reference 1: I always Reference...
- 8
- 336
- 0
![Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)](https://media.store123doc.com/images/document/14/rc/yi/small_yil1395845738.jpg)
Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)
... C109/C109M – 1 1a ANNEX (Mandatory Information) A1 ANALYSES OF TEST RESULTS FOR QUALIFICATION OF ALTERNATE COMPACTION METHODS A1 .1 Calculation of Average Within-Batch Standard Deviation and Elimination ... with a watertight sealant Use microcrystalline wax or a mixture of three parts paraffin to five parts rosin by mass Paraffin wax is permitted as a sealant with molds that clamp to the base plate ... 2.75 parts of graded standard sand by weight Use a water-cement ratio of 0.485 for all portland cements and 0.460 for all air-entraining portland cements The amount of mixing water for other than...
- 10
- 851
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... 15th Annual Meeting of The Association for Natural Language Processing (in Japanese) Dekang Lin 1998 Automatic retrieval and clustering of similar words In Proceedings of COLING/ACL98, pages ... similarities using a large amount of Web data in Japanese and show that the proposed measure gives better word similarities than a non-Bayesian Bhattacharyya coefficient or other well-known similarity ... answers for each word are the other words in the set the word appears in We output a ranked list of 500 similar words for each word using a given similarity measure and checked whether they are...
- 10
- 472
- 0
a novel method for the synthesis of titania nanotubes using
... (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical method and annealed under N2 atmosphere ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... TiO2 nanotubes annealed under N2 atmosphere at 500 ◦ C given in Fig shows predominantly anatase TiO2 [9,22,23] DRUV–vis spectra of the as-anodized and annealed titania nanotubes are shown in Fig...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner ... size, a polymer contaminates In recent years, nanocrystalline is often used, either natural or synthetic, with inorganic metal oxides as solid reactive some affinity for metals catalyst sorbents instead ... in Figures and and Tables and The would hinder the coordination of the 2-CEPS isopropanol, heptane, toluene and 2-CEPS Since isopropanol is such a strong hindrance to are diagnosed at a retention...
- 12
- 705
- 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures
... following expression (1): Degradation (%) = C0 Ct A0 At u100% = u100% A0 C0 (1) where C0 and A0 are the initial concentration and absorbance of KGL, and Ct and At are the concentration and absorbance ... with increasing hydrothermal treatment time, more and more nanosheets with a {2 1 0}-planar surface become interlaced and overlapped with each other to form a multilayer network structure, and thereby ... the range 23 ȝm In addition, each flower was made up of many thin nanosheets as “petals”, and these nanosheets were about 30 nm in thickness Further information about the ZnO product was obtained...
- 26
- 551
- 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The authors would like to thank the surgical veterinary team of ... the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis and the preparation of the manuscript ... Viability was analyzed using a lactate dehydrogenase (LDH) assay [4], with a day non-culture group to provide baseline viability levels Harvested explants were cut with a Leica annular saw (Leica AG,...
- 4
- 403
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... results was used, with Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and ... designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and Research 2011, 6:3 http://www.josr-online.com/content/6/1/3 ... clubfeet) had Pirani severity score of six, and one children (2 clubfeet) had a Pirani score of five In unilateral group the mean Pirani score was 5.83 (range 5-6) The mean Mid Foot Score and Hind Foot...
- 7
- 531
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... results was used, with Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and ... designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and Research 2011, 6:3 http://www.josr-online.com/content/6/1/3 ... clubfeet) had Pirani severity score of six, and one children (2 clubfeet) had a Pirani score of five In unilateral group the mean Pirani score was 5.83 (range 5-6) The mean Mid Foot Score and Hind Foot...
- 7
- 802
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis All authors read and approved the final manuscript Competing interests The authors ... hybridization assay method only require extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison...
- 9
- 469
- 0
Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx
... Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin (Rmutr), Bangkok 10100, Thailand 3Centre of Excellence in Mathematics, Che, Si Ayuthaya Road, Bangkok 10400, Thailand ... Thailand Authors’ contributions All authors contribute equally and significantly in this research work All authors read and approved the final manuscript Competing interests The authors declare that ... Hilbert spaces J Math Anal Appl 318, 43–52 (2006) doi:10.1016/j.jmaa.2005.05.028 Takahashi, W, Toyoda, M: Weak convergence theorems for nonexpansive mappings and monotone mappings J Optim Theory Appl...
- 20
- 350
- 0
Báo cáo hóa học: " Research Article The Shrinking Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Mappings" ppt
... variationalinequality problems for two monotone mappings in Banach spaces,” Optimization Letters In press 26 A Tada and W Takahashi, “Weak and strong convergence theorems for a nonexpansive mapping ... where q PΘ I − A γ f q In this paper, motivate, by Tada and Takahashi 26 , Qin and Kang 27 , and Kumam and Jaiboon 28 , we introduce a new shrinking projection method for finding a common element ... recovery in tomograph and related areas,” in Image Recovery: Theory and Application, H Stark, Ed., pp 155–270, Academic Press, Orlando, Fla, USA, 1987 38 Y Censor and S A Zenios, Parallel Optimization,...
- 25
- 495
- 0
Báo cáo hóa học: " Research Article Hybrid Method for a Class of Stochastic Bi-Criteria Optimization Problems" docx
... appropriate combination of the mean and variance of the cost, which is to be minimized subject to some chance constraints The variance appeared in the cost function can be interpreted as a risk measure, ... value is taken, the higher probability the constraints are satisfied In other words, the chance constraints approach can guarantee that the obtained solution has less degree of constraint violation ... Journal of Industrial and Management Optimization, vol 6, no 1, pp 177–196, 2010 C Jiang, X Han, G R Liu, and G P Liu, A nonlinear interval number programming method for uncertain optimization...
- 12
- 387
- 0
Báo cáo hóa học: " Research Article A General Projection Method for a System of Relaxed Cocoercive Variational Inequalities in Hilbert Spaces" pot
... Shang: Department of Mathematics, Tianjin Polytechinc University, Tianjin 300160, China; Department of Mathematics, Shijiazhuang University, Shijiazhuang 050035, China Email address: meijuanshang@yahoo.com.cn ... 299–331, North-Holland, Amsterdam, Holland, 1983 [6] Z Huang and M Aslam Noor, An explicit projection method for a system of nonlinear variational inequalities with different (γ,r)-cocoercive mappings,” ... Press, New York, NY, USA, 1995 Meijuan Shang et al [5] D Gabay, “Applications of the method of multipliers to variational inequalities,” in Augmented Lagrangian Methods, M Fortin and R Glowinski,...
- 9
- 256
- 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx
... equation under consideration into an equivalent linear or nonlinear operator equation in an abstract separable Hilbert H or Banach H1 space Then, after some manipulations, we bring the linear ... consideration is transformed equivalently into a linear or nonlinear operator equation defined in an abstract Hilbert space H or Banach space H1 , respectively In this way, we can use various results ... 1, in order to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of nonlinear equations, we some...
- 12
- 257
- 0
A MODIFIED QUASI-BOUNDARY VALUE METHOD FOR A CLASS OF ABSTRACT PARABOLIC ILL-POSED PROBLEMS M. pot
... evolution equations, Journal of Mathematical Analysis and Applications 47 (1974), no 3, 563–572 , Cauchy problem for hyperparabolic partial differential equations, Trends in the Theory [13] and Practice ... evolution operator-differential equations, Vestnik Belorusskogo Gosudarstvennogo Universiteta Seriya Fizika, Matematika, Informatika (1998), no 2, 60–63, 81 (Russian) [2] K A Ames and L E Payne, Asymptotic ... Bessila, A modified quasi-boundary value method for ill-posed problems, Journal of Mathematical Analysis and Applications 301 (2005), no 2, 419–426 [6] V K Ivanov, I V Mel’nikova, and A I Filinkov,...
- 8
- 256
- 0
Radio Occultation Method for Remote Sensing of the Atmosphere and Ionosphere docx
... for Guidance and Data Analysis provides analysis of all information for supporting high accuracy in the retrieved parameters of a sounded medium and forms the data bank having several levels and ... single-ray area In a single-ray area the spectra W ( ) and A ( ) have one maximum; in a multi-path area they have several maxima or a broad spectrum The angular spectrum in RHFSA method may be interpreted ... (appeared as linear or parabolic trend) in the phase path excess without noticeable variations in the amplitude of RO signal Analysis of CHAMP data indicates importance of the amplitude variations...
- 176
- 302
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25