reabsorption of phosphate ca 2 and mg 2
Báo cáo khoa học: Chick embryo anchored alkaline phosphatase and mineralization process in vitro Influence of Ca 2+ and nature of substrates doc
... corresponding to various Ca2 + concentrations are: n, Ca2 + 2. 5 mM; e, Ca2 + mM; h, Ca2 + 7.5 mM; s, Ca2 + 24 mM measuring their IR spectra and X-ray diffraction patterns (see below) In all cases, medium lacking ... phosphate sugars and nucleotides In all cases, the mineralization medium without exogenous phosphate contained 24 mM Ca2 +, 12. 5 mM phosphate substrate and 0.8 U of GPI-bALP In the presence of phosphocreatine, ... deposit exhibited two bands located at 1 122 cm)1 and 918 cm)1 bands (Fig 5A) As mentioned above, the 918 cm)1 band may correspond to HPO 42 group in OCP The 1 122 cm)1 band (Fig 5A) may be associated...
- 9
- 367
- 0
Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx
... activity of UCP2 modulates MDP-induced mitochondrial inefficiency 22 23 24 25 26 27 28 29 30 31 32 33 34 35 bacterial peptidoglycan derivatives Biochem Biophys Res Commun 59, 1317–1 325 Chedid ... lL of Kreeb’s ringer phosphate buffer ( 123 mmolÆL)1 NaCl, 1 .23 mmolÆL)1 MgCl2, 4.9 mmolÆL)1 KCl and 16.7 mmolÆL)1 Na phosphate buffer, pH 7.4), containing mmolÆL)1 glucose, 0.5 mmolÆL)1 CaCl2 and ... housed under standard conditions ( 12 h light ⁄ dark cycle, 22 ± °C) All experiments were approved by the Institutional Animal Care and Use Committee of the University of Balamand and complied with...
- 11
- 430
- 0
Báo cáo lâm nghiệp: "The effects of elevated CO 2 and water stress on whole plant CO 2 exchange, carbon allocation and osmoregulation in oak seedlings" docx
... 43, 1131-1139 CO and Coleman JS, Bazzaz FA (19 92) Effects of CO and tem2 growth and resource use of co-occurring C and C annuals Ecology 73, 124 4- 125 9 Conroy JP (19 92) Influence of elevated atmospheric ... trees grown at ambient and elevated CO Oecologia 79, 21 2 -22 2 Reid CD, Strain BR (1994) Effects of CO enrichment on whole plant carbon budget of seedlings of Fagus grandifolia and Acer saccharum ... (1994) Effect of elevated CO on carbon and nitro2 gen distribution within a tree (Castanea sativa Mill) soil system Plant Soil 1 62, 28 1 -29 2 Sasek TW, Strain BR (1989) Effects of carbon dioxide...
- 13
- 284
- 0
General Report of Dredging Waterway of Corridor No 2 and 3 - Mekong Delta Transport Infrastructure Development Project (MDTIDP)
... -3,00 26 2, 5 21 9+850 22 0+ 125 1 ,29 -0,77 -3,00 26 2, 5 22 0+ 125 22 0+400 1 ,29 -0,76 -3,00 26 2, 5 22 0+400 22 4+ 825 1 ,29 -0,75 -3,00 26 2, 5 22 4+ 825 22 7+700 1 ,29 -0,75 -3,75 -3,00 26 2, 5 22 7+700 22 9+675 ... -1,06 -3,00 26 2, 5 21 2+075 21 2+350 1,48 -1,05 -3,00 26 2, 5 21 2+350 21 2+ 625 1,48 -1,04 -3,00 26 2, 5 21 2+ 625 21 2+ 925 1,48 -1,03 -3,00 26 2, 5 21 2+ 925 21 3 +20 0 1,48 -1, 02 26 2, 5 21 3 +20 0 21 3+475 1,48 ... -3,00 26 2, 5 21 5+675 21 5+975 1,48 -0, 92 -3,00 26 2, 5 21 5+975 21 6 +25 0 1 ,29 -0,91 -3,00 26 2, 5 21 6 +25 0 21 6+ 525 1 ,29 -0,90 -3,00 26 2, 5 21 6+ 525 21 6+800 1 ,29 -0,89 -3,00 26 2, 5 21 6+800 21 7+075 1 ,29 ...
- 81
- 421
- 0
Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2
... antibodies 22 2. 3 Serum samples 22 2. 4 Immunological assays 22 2. 4.1 Immuno dot blot 22 2. 4 .2 Specific IgE binding ELISA 23 2. 4.3 Inhibition ELISA 24 2. 4.4 Histamine release assay 25 2. 4.5 Dust ... and purification of wild type and mutant allergens 20 2. 2 .2 Isolation of native Blo t 21 2. 2.3 Circular dichroism (CD) spectropolarimetry 21 2. 2.4 Gel Filtration 21 2. 2.5 Generation of rabbit ... characterization of Der f 22 76 4.3 Genomic organization of Der f 22 and Der f 83 4.4 Southern blot analysis 86 4.5 IgE binding capacities of Der f 22 and Der f 88 4.6 Localization of Der f 22 and Der f on...
- 235
- 904
- 0
Báo cáo khoa học: Enzymes of mannitol metabolism in the human pathogenic fungusAspergillus fumigatus– kinetic properties of mannitol-1-phosphate 5-dehydrogenase and mannitol 2-dehydrogenase, and their physiological implications pot
... AfM1PDH AfM2DH 10.6 0.7 0.13 0.05 80 30 0.8 0.3 1.6 0.8 1 32 3 .2 0 .2 41 14 21 NA 300 ã 10)10 ã 10)10 [24 ] 14 .2 0.3 11 1.3 0 .2 0.11 0. 02 2.0 0.4 94 40 20 21 15 NA 1.4 0.9 20 ã 10)9 ... D kcat D kcat KMan-ol1P D kcat KNAD Fru6P reduction D kcat D kcat KFru6P D kcat KNADH AfM2DH Man-ol oxidation D kcat D kcat KMan-ol D kcat KNAD Fru reduction D kcat D kcat KFru D kcat ... Oxidation: Man-ol 2- [2H]-Man-ol, 0.9180 mm, and NAD+, mm; NAD+, 0.084 mm, and Man-ol 2- [2H]-Man-ol, 26 0 mm Reduction: Fru, 4840 mm, and NADH NADD, 0 .25 mm; NADH NADD, 0.0 020 .2 mm, and Fru, 800...
- 13
- 470
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
... ZnSO (7H 2O), 0.767 µM; MoO 3, 0 .20 8 µM; CuSO 5H 2O, 0. 321 µM; EDTA FeIII Na, 0.11 mM; KH2PO4, 0.1 mM; K2SO4, 0.1 mM; CaCl2 2H2O, 0.6 mM; MgSO4 (7H2O), 0 .2 mM; (NH4 )2 SO4, 0.75 mM Ca and Mg deficiencies ... 1. 12 ± 0 .23 b 1 .29 ± 0 .20 b Chl b (mg dm -2, n = leaves) A (µmol m -2 s-1) ci (µmol mol-1) n = plants 25 7 ± 43 24 5 ± 45 27 1 ± 52 261 ± 63 2. 57 ± 0. 32 a 1.53 ± 0 .20 b 1.45 ± 0.40 b 0.60 ± 0 .28 c 329 ... significantly different at p < 0.05) K Element concentrations (mg gDW-1) Ca Mg Control + Al – CaMg +Al-CaMg 9.3 ± 2. 2 a 17.4 ± 2. 4 b 9.1 ± 3.4 a 15.6 ± 2. 2 b Abaxial epidermal cells 11.3 ± 2. 2 a...
- 10
- 376
- 0
Significant substitutive figures of speech – linguistic functions and pedagogical implications part 2
... follows Fig 2a1 Fig 2b1 Fig 2a2 :the signified :the signifier The Governmen Washingto n The White House The U.S The U.S Fig 2b2 Figure 2: Synecdoche and metonymy Fig a1 & a2: The signified and the ... teaching ideas and detailed lesson plans, see Lazar, 20 03; Gauger, 20 02; Phung Thanh Phuong, 20 03 For definitions and examples of thematic idioms, see Deignan, 1995; Bringas, 20 00, 20 01; McCarthy & ... readers should be aware of, such as the rule of significance, the rule of metaphorical coherence, the rule of totality, the rule of thematic unity, the convention of genre, and other poetic traditions...
- 64
- 600
- 0
IELTS Part 2 and Part 3 Topics and Questions -The Cultural Impact of Overseas Travel
... advantages and disadvantages of, on the one hand, using mobile phones and the internet to communicate and, on the other hand, of face-to-face communication? • In the future, you think the use of high-tech ... examples of the scenes that can especially catch your attention? • What are some ways that a photograph can catch people's attention? • What are some examples of (or an example of) photographs that catch ... Part and Part Topics and Questions Page 33 161 A Photograph (3) (July 12, 20 08) 1 62 163 164 165 Someone You Enjoy Spending Time With (2) (Aug 16, 20 08) An Important Letter You Wrote (May 10, 20 08)...
- 45
- 1,025
- 1
Tài liệu Root Finding and Nonlinear Sets of Equations part 2 docx
... 1-800-8 72- 7 423 (North America only),or send email to trade@cup.cam.ac.uk (outside North America) a x2 x3 b x1 d c f e 351 9.1 Bracketing and Bisection 3 52 Chapter Root Finding and Nonlinear Sets of ... float *x2) Given a function func and an initial guessed range x1 to x2, the routine expands the range geometrically until a root is bracketed by the returned values x1 and x2 (in which case zbrac ... order Numerical Recipes books,diskettes, or CDROMs visit website http://www.nr.com or call 1-800-8 72- 7 423 (North America only),or send email to trade@cup.cam.ac.uk (outside North America) int zbrac(float...
- 5
- 452
- 0
Tài liệu Chapter 2: Indicators of Financial Structure, Development, and Soundness ppt
... G H I 22 Financial Soundness Indicators Chapter 2: Indicators of Financial Structure, Development, and Soundness Table 2. 3 The Core Set of Financial Soundness Indicators Indicator Indicates Comment ... institutions and their asset positions, and (b) the number of and growth rates of 10 11 12 A B C D E F G H I 16 Chapter 2: Indicators of Financial Structure, Development, and Soundness available money and ... Indicators of Financial Structure, Development, and Soundness In many cases, the ownership structure of the financial system can be indicative of competition or lack thereof For instance, banks of...
- 19
- 543
- 0
Tài liệu Understanding and Using Letters of Credit Part 2 doc
... to a standby letter of credit can cash it on demand Stand-by letters of credit are generally less complicated and involve far less documentation requirements than irrevocable letters of credit ... Administration of a Standby Letter of Credit for a systematic procedure for establishing a standby letter of credit Special Letters of Credit The following is a brief description of some special letters of ... by a certificate of origin Prices should be stated in the currency of the letter of credit and documents should in the same language as the letter of credit The Letter of Credit Application The...
- 10
- 528
- 2
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... CD2-1 CD2 -2 CD2-3 CD2 1099 Inter- 600 25 0 767 150 934 IB: -v-KIND E F CD2-1 CD2-1-1 634 CD2-1 -2 667 CD2-1-3 701 CD2-1-4 CD2-1-5 735 CD2-1-6 7 02 CD2-1-7 668 CD2-1-8 635 CD2-1-6-1 7 02 CD2-1-6 -2 ... CD2-1-6-3 Interaction PD Input GST CD2-1-1 CD2-1 -2 CD2-1-3 CD2-1-4 CD2-1 767 25 0 150 PD 734 Input GST CD2-1-5 CD2-1-6 CD2-1-7 CD2-1-8 CD2-1 600 734 744 755 25 0 PD Input GST CD2-1-6-1 CD2-1-6 -2 ... very-KIND-MAP2 interaction v-KIND KIND2 KIND2-1 KIND2 -2 KIND2-3 KIND2-4 KIND2-5 A 620 521 555 488 589 EGFP EGFP-KIND2-1 EGFP-KIND2 -2 EGFP-KIND2-3 EGFP-KIND2-4 EGFP-KIND2-5 EGFP-KIND2 EGFP-KIND1...
- 11
- 658
- 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... –1 2 20 50 –3 0 –4 10 20 30 40 50 20 0 Elution volume (mL) B –1 80 L·Mol ·cm ) % of buffer B 25 0 21 0 22 0 23 0 24 0 25 0 Wavelength (nm) kDa Fig Circular dichroism spectra of P I, P II, P III and ... an equilibration time of min, and a band width of nm The CD signal at 23 2 nm was recorded as a function of temperature, h2 32 (T) The wavelength 23 2 nm was chosen because of the maximal difference ... 25 6 .25 25 1.56 – – 1.56 25 1.56 3. 12 3. 12 12. 5 – P III P IV 90 Protein synthesis (% of control) Table Carbohydrate-binding specifity of P I, P II, P III and P IV In the first well, 100 lL of each...
- 12
- 763
- 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... Lord, J.M & Roberts, L.M (1997) Ricin A chain can transport unfolded dihydrofolate reductase into the cytosol J Biol Chem 27 2, 22 097 22 1 02 22 Leland, P.A., Schultz, L.W., Kim, B.M & Raines, R.T ... the production and purification of the enzyme [13] The molecular mass of each purified product, as measured by MALDI-TOF MS, was 11 947.87 2 for (Met1)-ONC (M23L) and 11 838 .21 2 for rONC, which ... (wild-type) (Pyr1)-ONC (M23L) (Met1)-ONC (M23L) a DHTma (kJÆmol)1) DGU (25 °C) (kJÆmol)1) (CGdm/HCl)½b (M) 65.1 (0.4) 58.5 (0 .2) 52. 9 (0.08) 417 (47) 355 (29 ) 345 ( 32) 33.8 26 .7 23 .2 4.5 3.4 ND Values...
- 9
- 704
- 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf
... 0/0 2/ 2 1/1 3/3 2/ 2 1/1 5 (n (n (n (n (n (n (n (n (n (n (n (n ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ ¼ SPT pos 10) 2) 2) 3) 2) 0) 1) 1) 1) 5) 3) 0) 3/3 0/1 1/1 2/ 3 1 /2 0/0 0/0 1/1 0/1 3/3 3/3 0/0 Ó FEBS 20 03 ... 5¢TTAC AAGGACAAATTAATTGTGCCAG For amplification of the long isoform the same 5¢ primers were used, the 3¢ specific primer was FF3B: 5¢TTACAAGTCTTGCAA AGGGAAGGAT For amplification the Expand long template ... tomato fruit [21 ] The allergenicity of b-fructofuranosidase of tomato was further confirmed by Foetisch et al [22 ] The aim of the present study was to analyze the role of N-linked glycans in the...
- 11
- 533
- 0
Tài liệu Báo cáo khoa học: Molecular and functional characterization of adenylate kinase 2 gene from Leishmania donovani pdf
... kinase with bound Ap5A, Mg2 + Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2 + and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, J & Ginsberg, ... 575–580 25 Bradford, M.M (1976) A rapid and sensitive method for quantification of microgram quantities of protein utilising the principle of protein-dye binding Anal Biochem 72, 24 8 25 4 ´ 26 Sanchez, ... sapiens (29 %) [16], P falciparum (15%) (AF3086 12) , T vaginalis (25 %) [18] and T brucei rhodesiense (14%) (AF047 722 ) Analysis of leishmania AK sequence by BLAST and CD search revealed the presence of...
- 9
- 487
- 0
Tài liệu Báo cáo Y học: Binding of gelsolin domain 2 to actin An actin interface distinct from that of gelsolin domain 1 and from ADF/cofilin pptx
... Vandekerckhove, J & Ampe, C (1997) Analogous F-actin binding 22 23 24 25 26 27 28 29 30 31 32 33 34 35 by cofilin and gelsolin segment substantiates their structural relationship J Biol Chem 27 2, ... to S2 peptide 198 22 7 and found that they could exclude residues 12 44, 22 8 25 7 and 354–375 from being the site of peptide binding Our adjacent peptide S2 159–193 did not bind the C terminus of ... participation of gelsolin S2 sequences (and homologue S2 equivalents) within residues 197 22 6 (including the long helix of the domain) and within residues 161 – 1 72 (including the A strand and the...
- 11
- 460
- 0
Báo cáo khoa học: Versatile regulation of multisite protein phosphorylation by the order of phosphate processing and protein–protein interactions pptx
... coefficient ranges between and (Fig 3E) For random and mixed FEBS Journal 27 4 (20 07) 1046–1061 ª 20 07 The Authors Journal compilation ª 20 07 FEBS C Salazar and T Hofer ¨ Kinetic models of multisite phosphorylation ... kinase cascade Proc Natl Acad Sci USA 93, 10078–10083 15 Bluthgen N & Herzel H (20 03) How robust are switches ¨ in intracellular signaling cascades? J Theor Biol 22 5, 29 3–300 16 Salazar C & Hofer ... but can be a poor switch Proc Natl Acad Sci USA 1 02, 14617–14 622 19 Bluthgen N, Bruggeman FJ, Legewie S, Herzel H & ¨ Westerhoff HV (20 06) Effects of sequestration on signal transduction cascades...
- 16
- 470
- 0
Báo cáo khoa học: GTP binding and hydrolysis kinetics of human septin 2 pot
... measured to be 0 .28 ± 0.06 lm in mm MgCl2 and 3.37 ± 1. 42 lm in 0.01 mm MgCl2 Thus, the approximate 12- fold difference between low and high Mg2 + concentrations indicates the importance of Mg2 + in GTP-binding ... carried out in buffer D in the presence of 15 20 lm SEPT2 and mm MgCl2 and 100 lm of each FEBS Journal 27 3 (20 06) 324 8– 326 0 ª 20 06 The Authors Journal compilation ª 20 06 FEBS Y.-W Huang et al GTP, GTPcS ... GDP koff in the presence and absence of Mg2 + while Mg2 + has no significant influence on Kon [30,36,37] In the case of Rho family proteins, RhoA, Cdc 42 and Rac1 show similar Kd values for GTPcS and...
- 13
- 469
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25