proteins at work in living cells
Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc
... on the length of linkers In the linker containing seven amino acids, a Pro-Pro sequence that is not contained in other linkers is incorporated This less flexible structure may inhibit fluorophores ... difficult to demonstrate, because of its inherent instability Our FRET–FLIM system may serve as a valuable tool for investigating weak interactions in the complex in living cells C-3¢, and pcerulean-C1 ... PGK linked to cerulean or citrine were introduced into CHO-K1 cells As shown in Figs 1A and S1A, transiently expressed GAPDH–citrine (chimeric protein with N-terminal GAPDH and C-terminal citrine)...
- 9
- 586
- 0
COMPUTER AND INTERNET USE AT WORK IN 2003 pot
... computer and the Internet at work by occupation and industry, October 2003 (Numbers in thousands) Occupation and industry Total employed Used a computer at work Used the Internet at work Total Percent ... occupations Installation, maintenance, and repair occupations Production, transportation, and material moving occupations Production occupations Transportation and material moving ... discussed in this release on computer and Internet use at work and job search using the Internet were obtained from the following questions: Do you use a computer at your main job? Yes No At your main...
- 13
- 406
- 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... for spatial and temporal interactions between proteins and conformational changes of proteins occurring in living cells The occurrence of FRET can be accurately and finely determined by measuring ... of cells examined Combination of protein a1 (%) s1 (ns) Cerulean-elongin B Elongin B-cerulean Cerulean-elongin B-citrine-elongin C Cerulean-elongin B-elongin C-citrine Elongin B-cerulean-elongin ... elongin C induced by binding of elongin B may occur and that this conformational change of elongin C leads to stabilization of elongin C and pVHL To visualize the conformational change in living cells, ...
- 9
- 420
- 0
Science at Work in BASKETBALL pdf
... lot of information about the basics of basketball, including some physics pointers 31 31 Science at Work in Basketball INDEX Page numbers in bold type are for photos, charts, and illustrations ... very goo intere ted n nter ted eres at it He went to Cambridge University, where he got interested in mathematics and science dge Late dge Later ater Newton eventually became a professor at Cambridge ... object begins with a certain momentum that it got from the force that threw or shot it After that, the main forces governing the ball’s motion are gravity and forces 19 Science at Work in Basketball...
- 33
- 382
- 0
Báo cáo hóa học: " Subcellular Localization of Thiol-Capped CdTe Quantum Dots in Living Cells" potx
... that the fluorescence intensity was much stronger at a later time Figure shows that the fluorescence intensity increased almost linearly during the incubation period from 30 to 55 min, demonstrating ... incubated for 30–60 in an incubator before the subcellular localization pattern of the QDs was studied The cells were kept at 37 °C during the microscopic examination using a temperature controller ... can be seen that many of the lysosomes only showed the green LysoTracker color at an early time (30 min), indicating there were no QDs in these lysosomes; while at a later time (55 min), most lysosomes...
- 7
- 227
- 0
Báo cáo y học: " Identification of biomolecule mass transport and binding rate parameters in living cells by inverse modeling" ppt
... inside living cells Overall, these results indicate that using experimental data from the FRAP protocol and coupling it with curve fitting methods, one cannot draw conclusions regarding binding ... pseudo-association rate coefficient, which confirms the high intercorrelation between them, and therefore indicates the difficulty in finding unique values for them Indeed, an infinite number of combinations ... one needs to incorporate diffusion in the mathematical model This can be achieved by writing a set of three coupled nonlinear partial differential equations in a cylindrical coordinate system:...
- 19
- 386
- 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG ... CAGCCGGGGCAGCACGCCCGATGGGATCCGGC 35 ACCATGGCCGGATCCGCTTTGAATTGCTGCCC 36 GGGCAGCAATTCAAAGCGGATCCGGCCATGGT 37 ATGGCCGGATCCTTTGCGAATTGCTGCCCCGG 38 CCGGGGCAGCAATTCGCAAAGGATCCGCCAT 39 GCCGGATCCTTTTTGGCTTGCTGCCCCGGCTG ... capable of inducing protein aggregation upon biarsenical labeling in living cells or in vitro1 Aggregation is initiated by labeling with ReAsH or CHoXAsH, but not with FlAsH Additionally, aggregation...
- 144
- 306
- 0
Quantification of epidermal growth factor receptor dynamics and interactions in living cells by fluorescent correlation and cross correlation spectroscopy
... space into the cells and initiates a large set of important pathway cascades, such as MAPK (mitogen-activated protein kinase) pathway, PI-3K (phosphatidylinositol-2 kinase) pathway, and STAT (signal ... of ATP (erlotinib, efitinib, and Gifitinib, for example), target to the ATP-binding pockets within the EGFR tyrosine kinase (TK) domain and block the phosphorylation and the following signalling ... DAG activates PKC (Protein Kinase-C), which leads to phosphorylation of various substrate proteins in regulating extracellular matrix remodelling, and then the activation of IKKs (I-ĸB-Kinases),...
- 186
- 1,434
- 0
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... protein and chromatin-bound protein After the band intensities were quantitated in each protein, the concentrations of these proteins in total and chromatin-bound fraction were determined The relative ... of cancer cells by facilitating genome replication As Mcm proteins bound to chromatin are present at higher levels in these cells, whether the number of replication initiation sites increases ... complex that is required for loading Mcm proteins onto chromatin, was detected at eight times the level in HeLa cells as in WI-38 cells These results suggest that Mcm2–7 and ORC2 proteins are expressed...
- 13
- 486
- 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx
... replicative chromatin regions remain attached Therefore, preserving the natural chromatin/matrix relations and extracting unbound replication proteins from the nuclei seemed to be more appropriate ... chromatin fragments preferably originating from regions far from matrix attachment points As DNA replication foci are probably located near the nuclear matrix, preferably nonreplicative chromatin ... preparing a cell fraction that contains the cellular chromatin and specifically retains the functionally bound (replication) proteins In this communication we demonstrate that by a simple starvation...
- 11
- 610
- 0
Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx
... further incubated in fresh medium at 37 °C For heat shock treatment, cells were treated in a water bath set at 45 °C for 15–120 Cell viability assay Cells (1 · 104 cells per well) in 96-well plates ... Apoptosis signal-regulating kinases (ASKs) are serine ⁄ threonine kinases that activate both the p38 MAPK and JNK signaling pathways as MAPK kinase kinase ASKs are activated in response to various ... apoptosis induced by heat shock in HeLa cells HeLa-tet ⁄ Hsp105 cells were heated at 45 °C for 15–60 min, and then the cells were further incubated at 37 °C for h Cell viability (A), phosphatidylserine...
- 13
- 215
- 0
Báo cáo khoa học: DYRK1A phosphorylates caspase 9 at an inhibitory site and is potently inhibited in human cells by harmine pptx
... cells were incubated with indicated concentrations of harmine for 30 (E) HeLa cells were incubated in the presence of lM harmine where indicated for 30 min, followed by immunoprecipitation of endogenous ... harmine in vivo Interestingly, our results show that harmine not only inhibits the protein–serine ⁄ threonine kinase activity of the mature enzyme, but also the tyrosine autophosphorylation that ... phosphorylates caspase at Thr125 Recombinant His6–caspase (His–C9) or His6–caspase 9(T125A) (both containing the catalytically inactivating C287A mutation) was incubated with recombinant DYRK1A in the...
- 13
- 317
- 0
Báo cáo y học: " Cigarette smoke exacerbates mouse allergic asthma through Smad proteins expressed in mast cells" pps
... pathways being involved in smokeexposed/OVA-induced activation of mast cells From our data, we can infer that the smoke-activated mast cells produce TGF-b, which stimulates cell activation in ... Co-localization of mast cell tryptase and Smad3 protein in lung tissues In order to investigate whether smoke-induced expression of Smad proteins was occurring in mast cells, we examined co-localization ... a local inflammation [28] Our data demonstrated that OVA/S mice enhance emphysema and expressions of TGF-b and Smad proteins in vivo and co-localization of mast cells and Smad3 protein in lung...
- 16
- 307
- 0
A study of instructions for group work in 2nd year non English major classrooms at Thai Nguyen University = Nghiên cứu việc hướng dẫn hoạt động nhóm trong các l
... strategy training) techniques that include the consultation and input of students and that not presuppose objectives in advanced techniques that allow for student‟ creativity and innovation ... communicative language teaching The growth of interest in the utility of Communicative Language Teaching has been shaped in the changes in the British language teaching tradition dating from late ... communicative teaching theory, the use of teacher talk, group work – its advantages and organization, the nature of instructions, and principles for giving instructions when organizing group work...
- 93
- 755
- 0
A study on students'''' behavior in group work in speaking classes at Vinh Uiniversity
... learning in general, and in learning language in particular There are many different kinds of motivation such as integrative motivation, instrumental motivation, intrinsic motivation, extrinsic ... is an interactive process of constructing meaning that involves producing, receiving and processing information Its form and meaning are dependent on the context in which it occurs, including the ... from sharing information Group work has been incorporated into language teaching and learning in most parts of the world since the emergence of the Communicative Language Teaching (CLT) in the...
- 83
- 469
- 0
An investigation into the use of group work in teaching speaking skill to the 11th graders at Bo Trach 1 high school
... MINISTRY OF EDUCATION AND TRAINING VINH UNIVERSITY -o0o TRỊNH LINH GIANG AN INVESTIGATION INTO THE USE OF GROUP WORK IN TEACHING SPEAKING SKILL TO THE 11th GRADERS AT BO TRACH ... Joyce (1997), speaking is “an interactive process of constructing meaning that involves producing and receiving and processing information” When participating in communicative activities, the speaker ... speaking is an interactive process of constructing meaning that involves producing, receiving and processing information; Its form and meaning are dependent on the context in which it occurs, including...
- 106
- 1,052
- 14
The study of interactions of transmembrane receptors and intracellular signaling proteins in live cells by fluorescence correlation and cross correlation spectroscopy
... C-terminus domain, to expose binding sites for Src-homology-2 (SH2) domain-containing proteins and phosphotyrosine-binding (PTB) domain-containing proteins Adaptor proteins with a SH2-binding domain ... hemagglutinin epitope tag heparin-binding epidermal growth factor protein kinase C-related kinase homology region IQ motif containing GTPase activating protein infrared insulin receptor tyrosine kinase ... mathematic models that were utilized in the quantification of complex (dimer) percentages of interacting proteins and the determination of the equilibrium dissociation v constants of binding proteins...
- 173
- 360
- 0
Analysis of transcription factors in living human cells with the help of split ubiquitin system
... libraries in the future Identification of linker histone-interacting proteins might yield interesting insights regarding various regulatory processes that control chromatin dynamics 15 CHAPTER ONE INTRODUCTION ... post-translational modifications of imprinted proteins as well as using modification specific antibodies to isolate differentially modified proteins 49 1.3.2 Capturing Protein-Protein-Interactions inside ... horizontal axis looking down at the top of the molecule in a 30 of 110 amino acids that are conserved in many chromatin-associated proteins, including histone acetyltransferases (HATs) such as PCAF,...
- 124
- 346
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25