protecting sustaining and empowering a historical perspective on the control of epidemics
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... What the rating agencies to earn their keep? The traditional answer to this question is that the agencies gather and analyze all sorts of pertinent financial and other information, and the n ... owners of financia l assets, the institutions (both public and private) that guarantee the assets, and the asset managers that act as agents for the principals or owners An asset manager, for example, ... established agencies that are so designated? Do they increase the likelihood of conflicts of interest and other potential abuses? Agency Theory and the Ratings Agencies Another explanation of the...
- 30
- 611
- 1
What Changes Are Being Made to Social Assistance Benefits: A Community Perspective on the Impact of these Changes. pdf
... response to the changes, and about the process for municipal decisionmaking; discover what provincial and local actions are taking place in response to the changes; have a chance to say what ... Ontario Works (OW) and the Ontario Disability Support Program (ODSP): $20 million as a result of the new overall cap on discretionary health and nonhealth related benefits, to take effect July ... costs like basic dental services, eyeglasses, and hearing aids for adults, as well as funerals and burials Non-health related benefits are for items like transit subsidies and recreational subsidies...
- 18
- 390
- 0
Retrovirology Commentary BioMed Central Open Access A historical reflection on the discovery of ppt
... neither was at hand After the discovery of reverse transcriptase from animal oncogenic RNA viruses (then called oncorna viruses and now called retroviruses) a large number of publications on ... to the infection of this virus The isolation of what is now called HIV-1 (will also be referred to as HIV, LAV, IDAV-1, IDAV-2, LAV-1, HTLV-III and ARV) and the demonstration of this virus as the ... for Disease Control, Atlanta, in collaboration with Montagnier's group at Pasteur The assay they used was based on immuno-precipitation The positive scores were: 51 of 125 (41%) of AIDS patients;...
- 9
- 251
- 0
Báo cáo y học: "A network perspective on the evolution of metabolism by gene duplication" pdf
... addition, in one control (see Additional data file 5), we extracted the subset of single-domain enzymes and repeated the analyses of retention of duplicates In a second control (see Additional data ... ancestral pathway would be dependent on the acyl carriers and fatty acids available To get a first approximation of the generality of this observation, we carried out an all-against-all comparison ... Collectively, these controls indicate that the increased retention of duplicates at smaller distances apart is independent of the way in which metabolic databases are constructed, their size, and the hub...
- 10
- 436
- 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... strand A (Y9) and the last amino acid of strand G (K87) The elongation of the x(Y9)Àx(87) distance up to the transition state is defined as the distance DxA’ÀG The crossing of the transition state ... originates from the same set of hydrogen bonds between the A and G bstrands (Figure A) In the constant-velocity simulations, the breaking of the hydrogen bonds between the A and G bstrands is the ... the first amino acid of strand A (Y9) and the last amino acid of strand G (K87) This distance, x(Y9)ÀxACHTUNGRE(K87), increases as the two b-strands separate under a constant force filling the...
- 12
- 553
- 0
Trans regional communities and external coupling a geographical perspective on regional development of the chaoshan region, china
... 5.8% of the total area of Guangdong Province and 13.4% of the provincial population The Chaoshan region provides an appropriate case to illustrate the relations between transnational/transregional ... regional and extra-regional actors, conditioned by the organization of production and marketing, transnational/trans-regional communities, and state institutions Adding the domestic dimension ... approaches (see Table 2-1) Proponents of organizational approaches consider firms as the main analytical focus and the organizational form of production as a key factor to explain regional economic growth...
- 260
- 336
- 0
Báo cáo khoa học: "A longitudinal study on the occurrence of Cryptosporidium and Giardia in dogs during their first year of life" docx
... 200× and 400× magnification, using an I3 filter with blue excitation and band pass filter (BP) 450 – 490 nm With each batch of stained slides a known positive sample was stained and used as a control ... with a calibrated eyepiece graticule to ensure that they were within the size range given for Cryptosporidium and Giardia A portion of the original faecal sample was also examined by a standard ... grams of faecal material are examined Statistical analyses Statistical tests included χ2 and Fishers' Exact test for analyzing × contingency tables, odds ratio calculations, ttest for comparisons...
- 10
- 507
- 1
Báo cáo sinh học: "A simulation study on the accuracy of position and effect estimates of linked QTL and their asymptotic standard deviations using multiple interval mapping in an F2 scheme" ppsx
... Mayer et al Table III Means and empirical standard deviations of additive QTL effect estimates over 100 replicates of simulation models and and means and standard deviations of the estimated asymptotic ... (in cM) of simulation models and and means and standard deviations of the estimated asymptotic standard deviation (R2 : relative QTL variance; a: all replicates (N = 100); s: based on the most ... the evaluation of the accuracy of the estimation is an important issue, their program does not provide any information on the accuracy of the estimates The MImapqtl program of the QTL Cartographer...
- 25
- 327
- 0
a comparative analysis on the discourse of american and vietnamese movie trailers = so sánh đối chiếu đặc điểm diễn ngôn quảng cáo phim mỹ và phim việt
... all the trailers analysed are orientation and complication Other parts such as abstract, coda and evaluation are optional parts The typical position is Abstract – Orientation – Complication accompanied ... such as the language of mathematics, computer science, law, politics, art and advertising and so on As far as language of advertising is concerned, it is used as a means of communication and providing ... accompanied by Climax – Coda Evaluation can appear in any position except before and after the abstract The appearances of these parts are as follows: 24 out of 25 (96%) American movie trailers analysed...
- 83
- 907
- 1
Effect of using HIV and infant feeding counselling cards on the quality of counselling provided to HIV positive mothers: a cluster randomized controlled trial
... ‘Intervention /Control on one hand and the outcomes: ‘Provider discussed advantages and disadvantages for expressed and heat treated breast milk’ and ‘Provider asked how the mother will manage to feed the ... population, the mother’s understanding of the infant feeding counselling session, and how she assessed the provider in terms of counselling skills Data management and analysis Data was entered and ... (36) health facilities in Kafue and Lusaka districts were randomized into intervention and non-intervention sites The grouping and randomisation of health facilities was done in WHO headquarters,...
- 10
- 855
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/ or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural ... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the...
- 16
- 727
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... interco-operation, social transformation, universal character, education The mission and corporate values summarize the corporation and the culture of all the firms belonging to it: customer satisfaction, ... external relations, education and training, working teams and committees and the assembly system for decisions All of these are based on participation in the process Although the new information...
- 10
- 1,063
- 1
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... bear Other Variables Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/ or law ... can consider variables relevant to the selection of education, marketing, and law as sets of tools that can be brought to bear on the management of public health and social issue behaviors The ... Social Change San Francisco, CA: Jossey-Bass Publishers a good understanding of and accommodate the target's MOAs and the trade-off of free choice and externalities The potential for success of the...
- 14
- 780
- 0
A Modern Treatise on the Principle of Legality in Criminal Law doc
... social reflection, and social consensus, in offences of mala in se and mala prohibita, and in the formal publication of the criminal norm In order to understand the distinction of mala in se offenses ... structure of the criminal norm contains only valid conditional clauses A valid conditional clause that is part of the criminal norm contains the components necessary to impose criminal liability on the ... two types of conditional clauses4: valid and invalid A valid conditional clause refers to a real occurrence; an invalid conditional clause relates to a hypothetical situation that has not, will...
- 214
- 2,149
- 0
Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf
... thus one candidate for an acceptable translation Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact that the main process and the modifier ... conceptual information and speech act information Penman has a rich variety of inquiries dealing with such information and so makes available a large set of resources and capabilities for any system ... relate particular instances of what is to be expressed to the categories of semantic organisation that the grammar's semantics requires These categories, and the relationships among them, constitute...
- 9
- 680
- 1
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... (0.2 lm each) Amplificates were analyzed on 1% agarose gels and GAPDH amplification served as a control for the RT-PCR reaction and PCR conditions Primer sequences and the amplificate length are provided...
- 13
- 487
- 0
hughes t. groove and flow - six analytical essays on the music of stevie wonder (диссертация)
... makes a dollar a - Couplet 4: His mother goes… gets a penny B - Refrain: Living just enough… for the city B Chorus a Dadada, Da dada da da, Dada dada da dada, Da da da da, Dada da dada Figure 3: The ... terms and labels In this example, the bridge and the ending are variations of the music from the verse but only appear once, hence they are labeled A' and A' ', respectively.) Song Stanza a Term Label ... could also be some other similar vocalized syllable The lyrics printed on the original album had a combination of “la,” “da,” and “ba.” However, these combinations are not accurately transcribed and...
- 296
- 512
- 1
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... sectors Unfortunately, beyond data on nationality and year of arrival as derived from immigration and registration data, no further information was available on the overall Page of 12 (page number ... Return and Onward Migration among Working Age Men In Family and Labour Studies Ottawa: Statistics Canada; 2006 Takenaka A: Secondary Migration: Who Re-Migrates and Why These Migrants Matter Washington ... educational needs and perhaps the long-term care needs of elderly parents, in addition to any personal or financial motivations for migration As Papastergiadis explains: "The constraints of the...
- 12
- 495
- 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
... World Health Organization has advocated the creation of national TB/HIV working groups, which would have the authority to oversee increased collaboration and integration of TB and HIV programs and ... models of collaboration and integration and their relevance to the specific setting These models may range from maintenance of separate programs and services with enhanced communication and referral ... in urban and rural areas have been carried out or are ongoing In Rwanda, integration of TB and HIV services at a district hospital increased HIV counselling and testing of TB patients and improved...
- 5
- 469
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25