poly i c induced cytokine secretion in beas 2b cells
Báo cáo y học: " Lymphocyte apoptosis in murine Pneumocystis pneumonia Xin Shi, Nicole J LeCapitaine, Xiaowen L Rudner, Sanbao " potx
... 5'-AAACTTACACAAGGAGGGTGTTTG-3', 5'-AATGCCTTCTCCATACCAGACG-3', 5'-TTACCGCGAGGCTGAAGACCACCC-3'; mSurvivin, 5'-ATCGCCACCTTCAAGAACTGG-3', 5'TCAGGCTCGTTCTCGGTAGG-3', 5'-ATGAAGCCAGCCT CCGCCATTCGC-3'; ... fluorochromeconjugated Abs specific for murine CD3 (BD), CD4 (Invitrogen) and CD8 (eBioscience), respectively Isotype control antibody staining was used to assist in gating It is difficult to conclusively ... Health Sciences Center Pneumocystis inoculation Pneumocystis for inoculation was prepared as described earlier using lung homogenates from chronically infected Scid mice [24] In brief, Scid mice chronically...
- 15
- 267
- 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
... staining using affinity purified mouse monoclonal antibodies against CD4 (1F6, mIgG1) and CD8 (4B11, mIgG1) (Novocastra, CA) The specificities of these mAbs in immunohistochemistry on paraffin ... by destruction of the tumor microenvironment by CRT, which facilitates the recruitment of circulating T cells In fact, Lugade et al have suggested that radiation -induced IFNg production in the ... Hodgkin lymphoma [20,21], which is contrary to the general findings in other tumors [16,22,23] Since anal carcinoma is usually associated with human papilloma virus, specific viral proteins processed...
- 6
- 371
- 0
Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf
... Kolitz J, Schulman P, Lichtman SM, Buchbinder A, Vinciguerra VP, Chiorazzi N, Gregersen PK: Clonal expansion within the CD4+CD57+ and CD8+CD57+ T cell subsets in chronic lymphocytic leukemia J Immuno ... X, Chen S, Yang L, Chen S, Li Y: Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic ... ± 13.76% in PBMCs from CML patients The sjTRECs levels in PBMCs, CD3+, CD4+ and CD8+ T cells from patients with CML are shown in Figure In comparison with the sjTRECs in healthy individuals (3.76...
- 8
- 367
- 0
Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx
... gradients, cytokine release and cytotoxic activity of distinct T cell populations Detection of the inducible inflammatory chemokine receptors CCR5 and CCR3 on CD45RA+ T cells suggests that CD45RA+ ... CD45 staining, then analyzed for expression of CD45RO and CCR5 or CCR3 CD8–APC, CD45RO–PE (PE = phycoerythrin), CD45RA–FITC (FITC = fluorescein isothiocyanate), CD45–PerCP (PerCP = peridinin chlorophyll ... differentiation into tissue-specific memory T cells [12,29] Thus, CD4+CD45RA+ and CD8+CD45RA+ T cells expressing the inducible inflammatory chemokine receptors CCR5 or CCR3 as well as CD62L might constitute...
- 7
- 354
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... values in a population at risk for human immunodeficiency virus infection and diagnostic and prognostic application to infected children Pediatr Infect Dis J 1992, 11(8):639-644 Publish with Bio ... the competitor's upon co-amplification Staining with ethidium bromide can be quantitative provided that digital imaging is employed [9] The standard curve plots the log cDNA/competitor band intensity ... Downregulation of cell surface molecules during noncytopathic infection of T cells with human immunodeficiency virus J Virol 1987, 61(12):37413748 Crise B and Rose JK Human immunodeficiency virus type...
- 4
- 319
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... T cells, reports mainly focused on T cell lines in vitro, except for one study reporting resting CD4+ T cells in viremic versus aviremic HIV+ individuals [16] The limitation of in vitro studies ... SERPING1L ctccttacccaggtcctgct SERPING1R ggatgctctccaggtttgtt BDLvsVIR CD4 -5.0 -2.6 C1 QB NM_000491.3 complement component 1, q subcomponent, B chain C1 QBL ggcctcacaggacaccag C1 QBR ccatgggatcttcatcatcata ... up-regulated genes encoding for proteins promoting G1 to S transition include (1) cyclin dependent kinase (CDK)-cyclin complexes, CDK4/6-cyclin D and CDK2cyclin E; (2) transcription factors E2F and...
- 21
- 376
- 0
Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt
... individual variability in antigen expression significantly increased expression For HIV-specific CD8+ cells, diminished proliferative capacity results in a memory T cell population with reduced capacity ... report of the involvement of intercellular adhesion molecule-1 in syncytia formation and virus infectivity and the increase in its expression on lymphocytes in HIV infection [40] Interestingly, the ... increases were not significant, which is consistent with reduced immune activation in patients with reduced viral replication Increased Fas-receptor (CD95) expression on CD4+ and CD8+ lymphocytes...
- 13
- 289
- 0
Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot
... and MC participated in the design and validation of antibodies and receptor binding domain constructs as well as binding studies; NM helped to conceive the studies, participated in their design ... peptide encoding the 13 C- terminal amino acids As expected from the literature cited above, Glut-1 expression was significantly increased in both CD4 and CD8 T cells following TCR stimulation (Fig 3A), ... the pLib HeLa cDNA library (Clontech), and inserted into pCHIX, a modified version of the pCSI vector that includes a C- terminal factor Xa cleavage site, and the hemagglutinin (HA) and histidine...
- 9
- 283
- 0
Báo cáo y học: " Interaction between human lung fibroblasts and T-lymphocytes prevents activation of CD4+ cells" pdf
... however did not yield statistical significance In contrast, co-incubation of fibroblasts with activated lymphocytes determined a pronounced increase of the expression of both ICAM-1 and COX-2 MFI to ... allergen -induced production of Tcell derived cytokines in asthma requires the interaction between costimulatory molecules and points to the CD28-B7 pathway as being important to the inflammation distinctive ... identifying individual IFNgamma-producing lymphocytes J Immunol Methods 95(1):1-7 1986 Dec Assenmacher M, Schmitz J, Radbruch A: Flow cytometric determination of cytokines in activated murine...
- 13
- 278
- 0
Xác định sơ bộ giá trị phần trăm, tuyệt đối của tiêu chuẩn quần thể Lympho (T CD3, T CD4, T CD8, B, NK) ở nhóm người bình thường tại thành phố Hồ Chí Minh bằng máy Fascalibur docx
... premixed monoclonal antibodies:CD3 (FITC)/ CD8 (PE)/ CD45 (PerCP)/ CD4 (APC); CD3 (FITC)/ CD16-56 (PE)/ CD45 (PerCP)/ CD19 (APC) After stain, whole blood is passed lyses procedures, wash and final ... đ c phân tách sau máy FASC - Kháng thể BD: + CD3 (FITC)/ CD8 (PE) / CD45 (PerCP) / CD4 (APC) + CD3 (FITC) / CD16,56 (PE) / CD45 (PerCP) / CD19 (APC) - Dung dịch ly gi i hồng c u - Máy FASCalibur ... ng i Iran, Châu Âu, TCD3, TCD4, CD19 thấp V i kh c biệt khiến ng i ta suy nghĩ nh vai trò đáp ứng miễn dịch tự nhiên (thông qua NK) quần thể này? Sự cao tỷ lệ NK c giúp ích cho c thể vi c giúp...
- 6
- 978
- 0
Báo cáo khoa học: Identification of CD4 and transferrin receptor antibodies by CXCR4 antibody-guided Pathfinder selection pot
... Pathfinder selection, respectively, to isolate scFvs against CXCR4 because of our interest in developing neutralizing antibodies against CXCR4 for potential use in inhibition of HIV-1 infection Pathfinder ... 23 24 25 26 27 characterization of the CXCR4 chemokine receptor in human T cell lines: ligand binding, biological activity, and HIV-1 infectivity J Immunol 160, 877–883 McGraw, T.E., Greenfield, ... also contribute to the steric hindrance In addition, it is unlikely that the size and genetic complexity of the nonimmune library used in this study limited our ability to isolate CXCR4 scFvs...
- 10
- 473
- 0
Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt
... allophycocyanin-H7 anti-CD4), BioLegend (phycoerythrin antiCD25 and peridin-clorophyll protein-Cy5.5 anti-CCR7), eBioscience (phycoerythrin-Cy7 anti-CD127), and Miltenyi Biotech (allophycocyanin ... amplification of coding joints *Abbreviations: IQR, Interquartile range; KRECs, kappa-deleting recombination excision circles; TRECs, T-cell receptor excision circles supported by the presence in both ... suppressive function and determines Treg dysfunction in multiple sclerosis J Immunol 2007, 179:1322-1330 13 Sottini A, Ghidini C, Zanotti C, Chiarini M, Caimi L, Lanfranchi A, Moratto D, Porta F, Imberti...
- 7
- 559
- 0
Báo cáo y học: "Impact of cytokines and T lymphocytes upon osteoclast differentiation and function" pot
... supplied This lineage switch between osteoclasts and dendritic cells has been described in vitro, where cytokine delivery can be precisely defined The situation in vivo is less clear, and the local ... http://arthritis-research.com/content/9/2/103 blockade of GM-CSF production is sufficient to override the inhibitory action of IL-18 In contrast, IL-12 predominantly increases the production of IFN-γ, ... stimulating factor; sFRP, secreted Frizzled-related protein; OCIL, osteoclast inhibitory lectin [4] Finally, T lymphocytes express tumour necrosis factor (TNF)-α and this acts in concert with...
- 3
- 272
- 0
Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx
... mouse cyclin T1 (CycT1), which is an important Figure HIV-1 virus stocks produced in cotton rat cells infect human cells HIV-1 virus stocks produced in cotton rat cells infect human cells Kinetic ... microbicide to prevent viral infection PRO 2000 gel has been shown to inhibit vaginal simian/ human immunodeficiency virus infection in macaques[27], HSV-2 infection in mice[28], gonorrhea in ... peripheral blood mononuclear cells (PBMC) Virus inoculation induced a distinct and characteristic HIV-1 antibody response that in some animals We hypothesized that the lack of specific HIV-1 receptors...
- 9
- 329
- 0
Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf
... mouse cyclin T1 (CycT1), which is an important Figure HIV-1 virus stocks produced in cotton rat cells infect human cells HIV-1 virus stocks produced in cotton rat cells infect human cells Kinetic ... microbicide to prevent viral infection PRO 2000 gel has been shown to inhibit vaginal simian/ human immunodeficiency virus infection in macaques[27], HSV-2 infection in mice[28], gonorrhea in ... peripheral blood mononuclear cells (PBMC) Virus inoculation induced a distinct and characteristic HIV-1 antibody response that in some animals We hypothesized that the lack of specific HIV-1 receptors...
- 9
- 251
- 0
Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... Matteucci D, Pistello M, Mazzetti P, Giannecchini S, Isola P, Merico A, Zaccaro L, Rizzuti A, Bendinelli M: AIDS vaccination studies using feline immunodeficiency virus as a model: immunisation with ... mouse models, efficiency at transducing the murine cell line NIH-3T3 was a major guiding criterion in its design as well as in optimizing transduction protocol However, in its original format LA34 ... mostly inactive (selfinactivating [SIN] vectors) Also, these vectors are produced using multiple constructs encoding different components to minimize the risk of generating replicationcompetent viruses...
- 13
- 277
- 0
Báo cáo khoa học: " Early changes of CD4-positive lymphocytes and NK cells in patients with severe Gram-negative sepsis" ppt
... their modification after triggering by lipopolysaccharide are shown in Figure Discussion The identification of early changes taking place in the clinical setting of a septic host is of prime importance ... 15:148-151 Calandra T, Cohen J, International Sepsis Forum Definition of Infection in the ICU Consensus Conference: The international sepsis forum consensus conference on definitions of infection in ... following combinations were applied: anti-CD3/anti-CD4, anti-CD3/anti-CD8, anti-CD3/anti-CD(16+56), ANNEXIN-V/ anti-CD4/anti-CD3, ANNEXIN-V/anti-CD8/anti-CD3 and Available online http://ccforum.com/content/10/6/R166...
- 7
- 223
- 0
Báo cáo y học: "Determinants in HIV-1 Nef for enhancement of virus replication and depletion of CD4+ T lymphocytes in human lymphoid tissue ex vivo" doc
... NAKC signalosome as two distinct protein interaction sites involved in this process Individual mutation of both motifs significantly impaired Nef-mediated CD4+ T lymphocyte depletion, indicating ... one Direct staining of CD4 was avoided due to the reduction of CD4 surface exposure in HIV-1 infected cells, but a control staining for mock infected cells reveals that virtually all CD3+/CD 8cells ... spread in HLAC, two distinct protein interaction surfaces were identified that specifically govern Nef-mediated enhancement of CD4+ T lymphocyte depletion which preferentially occurs in bystander cells...
- 14
- 264
- 0
Báo cáo y học: " Effect of chloroquine on reducing HIV-1 replication in vitro and the DC-SIGN mediated transfer of virus to CD4+ T-lymphocytes" pdf
... statistically significant Abbreviations Ab, antibody; CQ, chloroquine; DC, dendritic cell; DCSIGN, DC-pecific ICAM3 grabbing non-intergrin; ECD, extra-cellular domain; HCQ, hydroxychloroquine; R5, CCR5 ... lowering rates of transmission, given the relative inefficiency of infection [35,36] The effect of CQ on DC-SIGN binding in vivo remains to be determined, but if the DC-SIGN binding is indeed ... of HIV-1 with dendritic cell-specific intercellular adhesion molecule-3-grabbing nonintegrin-expressing cells is influenced by gp120 envelope modifications associated with disease progression...
- 12
- 316
- 0
Báo cáo y học: " Decrease of CD4-lymphocytes and apoptosis of CD14-monocytes are characteristic alterations in sepsis caused by ventilator-associated pneumonia: results from an observational study" ppt
... following combinations were applied: antiCD3(FITC)/CD4(PE), anti-CD3(FITC)/CD8(PE), antiCD3(FITC)/CD(16+56)(PE), anti-CD19(FITC), annexinV(FITC)/CD4(PE)/PI (PC5), and annexin-V(FITC)/antiCD8(PE)/PI(PC5) ... The ACCP/SCCM Consensus Conference Committee, American College of Chest Physicians/Society of Critical Care Medicine: Definitions for sepsis and organ failure and guidelines for the use of innovative ... intraabdominal infection was made in patients with temperature above 38 C or below 36 C, leukocytosis (WBC >12,000 cells/ μl) and radiological findings consistent with an intraabdominal infection [15]...
- 8
- 343
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25