... English 20 1 .2. 2 Characteristics of Business English 21 1 .2. 3 Performance objectives for Business English 22 1 .2. 4 Content of Business English course 23 1.3 Summary ... 25 2.2 Objectives of the ESP course at TUEBA 26 2. 3 Materials of the ESP course 26 2. 4 The problems in teaching and learning ESP at TUEBA 27 2. 4.1 Problems ... teachers 27 2. 4 .2 Problems on the part of the students 27 2. 5 Summary 27 Chapter 3: RESEARCH METHODOLOGY 29 3.1 Research questions 29 3 .2 Participants...
... 5.0 50.0 20 .0 100.0 10.0 100.0 Average recovery (µg/L) Standard deviation (µg/L) Average percent recovery 5 .2 51.4 4.0 44.4 0.1 9.3 4 .2 51.4 20 .1 101.3 9.1 104.0 0 .2 0.7 0 .2 0.8 0.1 1.1 0 .2 1.5 ... 5 .2. 2 The trap must be at least 25 cm long and have an inside diameter of at least 0.105 in The trap must be packed to contain 1.0 cm of methyl silicone coated packing (Section 6.5 .2) and 23 ... wash, rinse with tap and distilled water, and dry at 105°C before use 5.1 .2 5 .2 Septum—Teflon-faced silicone (Pierce # 127 22 or equivalent) Detergent wash, rinse with tap and distilled water and...
... autonomous FEBS Journal 27 2 (20 05) 22 61 22 75 ª 20 05 FEBS C M L Barrett and C Robinson 17 18 19 20 21 22 23 24 25 26 27 Tat translocation system J Biol Chem 27 7, 326 8– 327 3 Bolhuis A, Mathers JE, ... E103Q E103A R104A R105A F118A G 121 A Y154S F169A P172A T208A P209A D211N D211A L 225 A Sequence 5’ to 3’ Substitution G2A F W7P F I12P F V16G F F20A F G21A F K24A F L25A F G33A F F39A F K37Q F gaggaattcaccatggctggtatcagtatttgg ... Name of primer TatA mutants G2A 3Pro3Gly I12P 3Pro6Gly F20A G21A K24A L25A G33A F39A 3K > Q TatB mutants E8Q E8A 3Gly V12P G21A P22G P22L L25A P26A L63A 2R > N 3K > Q TatC mutants P48A I81M P85A...
... 50, 27 7–303 28 Hildebrand M & Dahlin K (20 00) Nitrate transporter genes from the diatom Cylindrotheca fusiformis (Bacil- FEBS Journal 27 2 (20 05) 3413–3 423 ª 20 05 FEBS N Poulsen and N Kroger ¨ 29 ... Eur J Biochem 23 9, 25 9 26 4 Gatignol A, Durand H & Tiraby G (1988) Bleomycin resistance conferred by a drug-binding protein FEBS Lett 23 0, 171–175 FEBS Journal 27 2 (20 05) 3413–3 423 ª 20 05 FEBS Inducible ... identified in the two other diatom NR genes [18] is also conserved in CfNR (aa 21 1 22 7) FEBS Journal 27 2 (20 05) 3413–3 423 ª 20 05 FEBS 3415 Inducible promoter for transgenic diatoms N Poulsen and N...
... alternate column packings are provided in Section 12. 2 5.6 .2 Column 2 1.8 m long x mm ID glass, packed with 10% SP -22 50 on Supelcoport (100/ 120 mesh) or equivalent 5.6.3 Detector—Nitrogen-phosphorus, ... N-Nitrosodi-n-propylamine Test conc (µg/L) 20 20 20 Limit for s (µg/L) 3.4 6.1 5.7 Range for (µg/L) 4.6 -20 .0 2. 1 -24 .5 11.5 -26 .8 Range for P, Ps (%) 13-109 D-139 45-146 s = Standard ... Industrial and Municipal Wastewaters,” EPA 600/4- 82- 016, National Technical Information Service, PB 82- 199 621 , Springfield, Virginia 22 161, April 19 82 ASTM Annual Book of Standards, Part 31, D3694-78...
... 0-309-08336 -2 Additional copies of this report are available from National Academy Press, 21 01 Constitution Avenue, N.W., Lockbox 28 5, Washington, DC 20 055; (800) 624 - 624 2 or (20 2) 334-3313 (in ... Modified Organisms, 20 Materials Science and Technology, 21 Nanotechnology, 21 Microelectromechanical Systems, 24 Fuel Cells, 25 Materials for Electromechanical Applications, 26 Computer and Information ... Research and Development Expenditures: Fiscal Year 20 00 [Early Release Tables], NSF 02- 4 02, Table B- 32, at ) 5An analysis of shifting emphasis...
... Physical Plant S&S Lion Surplus See page 16 20 20 20 11 20 16 10, 16 18, 20 18 20 8, 20 2, 20 8, 20 20 20 13 18 2, 8, 20 10 16 18 8, 18, 20 2 8, 18, 20 20 8, 20 10, 16 10, 16 www.ehs.psu.edu www.generalstores.psu.edu ... Refrigerants 11 12 13 15 16 18 III IV Equipment and Labware used with Chemicals, Petroleum Products, Oils, Infectious Agents, or Radioactive Materials 20 V Quick Reference Chart 23 Environmental ... cylinders purchased through General Stores are to be used in accordance with SY25 (http://guru.psu.edu/policies/SY25.html) and returned through General Stores when empty or no longer needed b...
... from the other 21 TCDD isomers 12. 6 .2 The masses for native 2, 3,7,8-TCDD (LRMS-m/z 320 , 322 , and 25 7 and HRMS-m/z 320 and 322 ) and labeled 2, 3,7,8-TCDD (m/z 328 or 3 32) must exhibit a simultaneous ... masses at m/z 320 , 322 , and 25 7 for 2, 3,7,8-TCDD and either m/z 328 for 37Cl4 2, 3,7,8-TCDD or m/z 3 32 for 13 C 2, 3,7,8-TCDD For HRMS, use masses at 12 m/z 319.8965 and 321 .8936 for 2, 3,7,8-TCDD ... masses at m/z 25 7, 25 9, 320 and either m/a 328 or m/z 322 can be performed The masses at m/z 25 7 and m/z 25 9 are indicative of the loss of one chlorine and one carbonyl group from 2, 3,7,8-TCDD...
... Similarlly, temperature decreased steadily from 320 C to 28 0C(figure 2) Figure 2: Mapping temperature during journey from Nghe An to Hanoi for water melon 3 .2 Spoilage rate during transportation Table ... Table 1: Spoilage of cabbage during transportation Spoilage rate (%) In Hanoi After days 1.1 2.2 Wood box 2. 5 3.4 Jute bag (control) 3.7 8.6 Carton used for transportation In Hanoi, spoilage rate ... Rolle and A Acedo, 20 09 Horticultural Chain Management for Countries of Asia and the Pacific Region/ A training package FAO-RAP publication 20 09/06 Bautista O and E.B Esguerra, 20 07 Postharvest...