... 14 1.1 .1 Definitions of ESP 14 1. 1.2 Types of ESP 15 1. 1.3 The differences between General English and ESP 18 1. 2 Business English – a type of ESP 20 1. 2 .1 ... study 12 Method of the study 12 Scope of the study 12 Organization of the study 13 Chapter 1: LITERATURE REVIEW 14 1.1 ESP Teaching ... Code: 60 14 10 Supervisor: Phạm Thị Hạnh, MA HANOI – 2 010 TABLES OF CONTENTS PART ONE: INTRODUCTION 1 Rationale 11 The significance of the study 12 Aims of...
... Gln P48A F I81M F P85A F F94A F P97A F L99A F E103Q F E103A F R104A F R105A F F 118 A F G121A F Y154S F F169A F P172A F T208A F P209A F D 211 N F D 211 A F L225A F ggtatccgcggcattgatcaagcagttg ggtgtcgctgatgctgtcagcgccg ... F20A G21A K24A L25A G33A F39A 3K > Q TatB mutants E8Q E8A 3Gly V12P G21A P22G P22L L25A P26A L63A 2R > N 3K > Q TatC mutants P48A I81M P85A F94A P97A L99A E103Q E103A R104A R105A F 118 A G121A Y154S ... Ala Ile 81 to Met Pro85 to Ala Phe94 to Ala Pro97 to Ala Leu99 to Ala Glu103 to Gln Glu103 to Ala Arg104 to Ala Arg105 to Ala Phe 118 to Ala Gly1 21 to Ala Tyr154 to Ser Phe169 to Ala Phe172 to Ala...
... was 1 10 7ÆmL )1 for each clone (C) GFP fluorescence intensity (excitation 485 nm, emission 510 nm) of transformant C 31 in different growth media, containing nitrate (1. 5 mM KNO3), ammonium (1. 5 ... 5¢-UTR starting 12 bp upstream of the start ATG, was then cloned into the Eco105I–XbaI sites of pBluescript ⁄ fcp1.9kb, generating pBluescript ⁄ fcp1.6kb, which covers bp )12 to )16 13 upstream of ... 11 3 12 0 10 Dunahay T, Jarvis E & Roessler P (19 95) Genetic transformation of the diatoms Cyclotella cryptica and Navicula saprophila J Phycol 31, 10 04 10 12 11 Kilian O & Kroth PG (2005) Identification...
... 45268, March 19 79 10 “EPA Method Study 15 , Method 605 (Benzidines),” EPA 600/4-84-062, National Technical Information Service, PB84- 211 176, Springfield, Virginia 2 216 1, June 19 84 11 “EPA Method ... mode of operation 8 .1. 1 8 .1. 2 In recognition of advances that are occurring in chromatography, the analyst is permitted certain options (detailed in Sections 10 .9, 11 .1, and 12 .1) to improve the ... (Section 12 ) If the sample requires further cleanup, proceed to Section 11 10 .12 Determine the original sample volume by refilling the sample bottle to the mark and transferring the liquid to a 10 00-mL...
... tube with 1- 2 mL of pentane Analyze by gas chromatography (Section 12 ) 11 .4 Alumina column cleanup for nitrosamines 11 .4 .1 Place 12 g of the alumina preparation (Section 6 .10 ) into a 10 mm ID ... Column 4 .1 12 .1 b 12 .8 Method detection limit (µg/L) 0.88 4.2 c 6.4 0 .15 46 81 Column conditions: Chromosorb W - AW (80 /10 0 mesh) coated with 10 % Carbowax 20 M/2% KOH packed in a 1. 8 m long ... mode of operation 8 .1. 1 8 .1. 2 In recognition of advances that are occurring in chromatography, the analyst is permitted certain options (detailed in Sections 10 .4, 11 .1, and 12 .2) to improve the...
... Patrick Young I Trends in Industrial R&D Management and Organization Alden S Bean 71 75 77 80 10 0 12 9 14 3 16 7 19 9 Executive Summary In September 2000, the National Institute of Standards and Technology ... EXECUTIVE SUMMARY 1 INTRODUCTION PUSH FACTORS Biological Science and Engineering, 10 Molecular and Cell Biology, 10 Synthetic-Biologic Interactions, 15 Medical Devices and Instrumentation, 17 E-Medicine ... Applications [which as of January 1, 20 01, became part of the Division on Engineering and Physical Sciences] will examine forces and trends over the next to 10 years pertinent to NIST’s mission...
... collected fraction to 1. 0 mL as in Section 10 .16 and analyze by GC/MS (Section 12 ) 11 .3 Silica gel column cleanup for 2,3,7,8-TCDD 11 .3 .1 Fill a 400 mm long x 11 mm ID chromatmgraphic column with silica ... m/z 332 for 13 C 2,3,7,8-TCDD For HRMS, use masses at 12 m/z 319 .8965 and 3 21. 8936 for 2,3,7,8-TCDD and either m/z 327.8847 for 37Cl 2,3,7,8-TCDD or m/z 3 31. 9367 for 13 C12 2,3,7,8-TCDD 12 .3 If lower ... silica gel column may be helpful 11 .2 Alumina column cleanup for 2,3,7,8-TCDD 11 .2 .1 Fill a 300 mm long x 10 mm ID chromatographic column with activated alumina to the 15 0 mm level Tap the column...
... (%) after 10 days Control 7.2 Chlorine 10 0ppm 1.1 Chlorine 15 0ppm 0.8 Chlorine treatment after 10 days of harvesting reduced the spoilage rate to 0.8 -1. 1% while the control had high spoilage ... water melon 3.2 Spoilage rate during transportation Table 1: Spoilage of cabbage during transportation Spoilage rate (%) In Hanoi After days 1.1 2.2 Wood box 2.5 3.4 Jute bag (control) 3.7 8.6 Carton ... carried out Brush with 15 % alum solution or saturated lime on the butt after trimming Table 3: Postharvest treatment for cabbage Spoilage (%) after days Control 19 .0 Alum 15 % 3.4 Lime The table...