patients elbow extension is important for transfer capabilities andto reach objects from a seated wheelchair position how can elbow extension bereconstructed with tendon transfers
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
- 137
- 853
- 0
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx
... (Invitrogen, Carlsbad, CA, USA) Quantitative real-time PCR analysis Total RNA was extracted with Trizol reagent from different tissues of Arabidopsis Contaminated DNA was removed with RNase-free DNase ... The Authors Journal compilation ª 2011 FEBS 2303 Analysis of an Arabidopsis DExD ⁄ H box RNA helicase R.-R Xu et al use Total RNA was isolated from different A thaliana seedlings with Trizol reagent ... 451–458 Anderson JA, Huprikar SS, Kochian LV, Lucas WJ & Gaber RF (1992) Functional expression of a probable Arabidopsis thaliana potassium channel in Saccharomyces cerevisiae Proc Natl Acad Sci USA...
- 11
- 786
- 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... information indicates that the Arg252 variant is atypical, as all hitherto sequenced variants of TPP II (i.e rat, mouse, fruit fly, Arabidopsis thaliana, Caenorhabditis elegans and Schizosaccharomyces ... catalytic Asp44 and His264 are indicated by asterisks to activate the material, as previously described [15] However, all attempts so far to associate this material have failed Thus, it appears ... column and chromatography was performed as described in Materials and methods Enzyme activity was analysed by the standard assay and the immunoreactivity was detected by Western blot analysis and...
- 6
- 520
- 0
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishian F, Domingo R, Ellis MC, Fullan A et al (1996) A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis Nat ... immunostained with anti-HA and anti-BiP Ig, and processed for fluorescence microscopy Co-localization masks were created as described in Materials and methods, and represent areas with overlapping green and ... Ireland) To generate the pEP7–HFE-N11 0A HA vector we used the following primer set: sense, ATGGAAAATC ACGCCCACAGCAAGGAG; antisense, CTCCTTGTCG N-Glycosylation of HFE TGGGCGTGATTTTCCAT To generate...
- 16
- 538
- 0
Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot
... base DNA13-RNA4(5¢-AATAGAGAAAAAGaaaaAAGATGGCAA DNA12 AG-3¢), 29 base DNA15-RNA1-DNA13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled 18 base RNA9-DNA9 (5¢-uugcaugccTGCAGGTCG-3¢) with ... maritima MSB8, which was obtained from the American Type Culture Collection (Manassa, VA, USA), was used as a template The sequences of the PCR primers are 5¢- TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ ... CAAAAAAATACTAC-3¢ for primer 1, 5¢- CGCATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, and 5¢- CGGAATTCTCATGTGTCCAGTTCTG GACAGATGCACTC-3¢ for primer...
- 16
- 459
- 0
Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf
... mean parameters as indicated Statistical analysis was carried out using one-way ANOVA with an appropriate posthoc test or Students t-test as appropriate (ORIGIN v6.0 and PRISM v3.0) Statistical ... images and the quantitative data are shown in Fig 6B–D In both cases there was a measurable and significant increase in membrane associated immunofluorescence in keeping with the visual appearance ... Statistical significance is as indicated in the legend and text Data are presented as mean ± SEM RESULTS To facilitate biochemical studies, we generated a polyclonal rabbit antisera raised to a short peptide...
- 11
- 467
- 0
Báo cáo sinh học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" ppt
... (5'-GGGCCTCTCTTTCCAAAACAC-3') and a dual labeled probe (5'-6-FAM-CAAACAAGCAGTGCCCAGTGCAGC-TAMRA-3') The relative amount of viral RNA in the drug-treated cells was expressed as a percentage of the average amount ... percentage of the average number of infected cells in the mock-treated (control) cell cultures Data are presented as mean ± standard error of mean (n = 6) For statistical analysis a one-way ANOVA with ... coordinated the research efforts and assisted with writing the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by grants from the Sophia Foundation...
- 5
- 449
- 0
Báo cáo hóa học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" pptx
... (5'-GGGCCTCTCTTTCCAAAACAC-3') and a dual labeled probe (5'-6-FAM-CAAACAAGCAGTGCCCAGTGCAGC-TAMRA-3') The relative amount of viral RNA in the drug-treated cells was expressed as a percentage of the average amount ... percentage of the average number of infected cells in the mock-treated (control) cell cultures Data are presented as mean ± standard error of mean (n = 6) For statistical analysis a one-way ANOVA with ... coordinated the research efforts and assisted with writing the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by grants from the Sophia Foundation...
- 5
- 392
- 0
báo cáo khoa học: " A var2 leaf variegation suppressor locus, SUPPRESSOR OF VARIEGATION3, encodes a putative chloroplast translation elongation factor that is important for chloroplast development in the cold" docx
... USA) Manipulation of nucleic acids The CTAB method was used to extract Arabidopsis leaf DNA [81], and the Trizol RNA reagent (Invitrogen, CA, USA) was used to extract total leaf RNA RNA gel analysis ... chloroplast translation, rather than to a general compromised translation Page 14 of 18 It is important to note that SVR3, as a translation elongation factor, is not expected to be a basic protein ... TypA, LepA and EF-G share an additional three domains (Domains II, III and V) [39,40] EF-G contains a unique domain IV whereas LepA and TypA each have a unique C-terminal domain (CTD) The overall...
- 18
- 554
- 0
Báo cáo y học: " The formation of cysteine-linked dimers of BST-2/tetherin is important for inhibition of HIV-1 virus release but not for sensitivity to Vpu" potx
... performed the molecular and biochemical studies, and assisted in writing the manuscript EM performed biochemical and FACS analyses and helped with data analysis SK assisted with BST-2 mutagenesis ... Rollason R, Sugden A, Wilde A, Banting G: Bst-2/HM1.24 is a raft-associated apical membrane protein with an unusual topology Traffic 2003, 4:694-709 Sakuma T, Noda T, Urata S, Kawaoka Y, Yasuda ... 5' ATAAC TCGAG GTGGA ATTCA TGGCA TCTAC TTCGT ATGAC TATTGC and 3' AAGCT TGGTA CCTCA CTGCA GCAGA GCGCT GAGGC CCAGC AGCAC The resulting PCR product was cleaved with XhoI and KpnI and cloned into the...
- 16
- 275
- 0
SNX27 is important for postnatal development in mice
... γ-adaptin ear containing, ARF binding proteins (GGA) also act as clathrin adaptors There are three GGA adaptors, including GGA1, GGA2 and GGA3 They are localized to the TGN together with AP-1 and ... pGBKT7SNX27 aCT Human SNX2 7a aa 287-541 pGBKT7 For yeast two-hybrid analysis as Gal4-BD fusion protein pGBKT7SNX27 a RA Human SNX2 7a aa 1-460 pGBKT7 For yeast two-hybrid analysis as Gal4-BD fusion ... endoplasmatic reticulum embryonic stem fetal bovine serum forkhead-associated fluorescein isothiocyanate Fab1, YOTB/ZK632.12, Vac1, and EEA1 Gal4 DNA binding domain Gal4 DNA activating domain GTPase...
- 163
- 283
- 0
Reproductive intentions and choices among HIV-infected individuals in Cape Town, South Africa: Lessons for reproductive policy and service provision from a qualitative study ppt
... FINDINGS Participant characteristics Average time since HIV diagnosis was 2.5 years for women (range weeks–8 years) and 2.8 years for men (range weeks–10 years) The average age of female (range 20–45 ... to have a child, especially if they had no live children One man reported that his decision to reproduce was shaped by a desire to have a larger family, similar to that of his father and another ... report treatment [PMTCT] that can feeling that pregnancy and childbirth was a woman’s prerogative assist us [but] it is not only about and that if their partner wished to have children and they...
- 6
- 553
- 0
Báo cáo y học: "Emotional well-being in children and adolescents treated with atomoxetine for attention-deficit/hyperactivity disorder: Findings from a patient, parent and physician perspective using items from the pediatric adverse event rating scale (PA
... size calculation for the two studies have been published elsewhere [28,29] The data of all patients were evaluated (Full Analysis Set, FAS) using SAS version The dataset for all analyses of changes ... pediatric patients who are treated with psychotropic medication, especially as participant in clinical trials, and was developed as part of the Child and Adolescent Psychiatry Trials Network (CAPTN) ... failure to take at least 70% of study medication for at least two weeks, or repeated intentional intake of more than the prescribed dose Sample size and statistical analysis Details on the sample...
- 10
- 482
- 0
How important is transnational knowledge transfer for the competitive advantage of the Vietnamese software industry within the global IT outsourcing industry?
... Virtual Software Teams GSD’06, May 23, 2006, Shanghai, China 11 Linda Argote and Paul Ingram (2000) Knowledge Transfer: A Basis for Competitive Advantage in Firms Organizational Behavior and Human ... World Bank, Asian Development Bank (ADB), Vietnam Ministry of Planning and Investment (MPI), Vietnam Software Association (VINASA), Danish Embassy in Hanoi, etc and various local and international ... international market demand and international linkages Oval model is an adaptation and enhancement from Software Export Success Model It excludes international market demand with an argument that currently...
- 86
- 486
- 0
Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot
... confirmation that the aadA cassette has inserted in the psaJ gene M, marker; 1, total DNA from transgenic plant as template; 2, plasmid DNA used to transform the plants as template; 3, total DNA from ... thank Ingrid Duschanek and Elli Gerick for excellent technical assistance, and Steen Malmmose for assistance with growing plants The Danish National Research Foundation, the Danish Veterinary and ... signal was passed via a preamplifier (Tektronix ADA40 0A) to an oscilloscope A total of 32 absorbance transients were collected with s interval and averaged for each decay curve The recorded absorbance...
- 13
- 381
- 0
Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot
... tetra-loops appear to prefer a certain receptor motif, but with a significant cross reaction [24,25] Here, GUGA, GUAA and GAAA tetra-loops preferentially interact with CU:AG, CC:GG and a 11 nt motif, respectively ... motifs at the second and third base pair positions (CU:AG and CC:GG) were analyzed for hydrolytic cleavage Furthermore, the CU:AG motif was inverted to a nonreceptor sequence (GA:UC) and analyzed ... by GUGA However, no significant reduction in hydrolytic cleavage rate with respect to wild type and mutant P5 constructs could be found (data not shown) In summary, comparative data support a P5...
- 10
- 412
- 2
Báo cáo khoa học: The predominant protein arginine methyltransferase PRMT1 is critical for zebrafish convergence and extension during gastrulation pdf
... phosphorylation by AKT and promote nuclear localization and transactivation of FOXO1 [16] In addition, PRMT1 is a transcriptional coactivator of various nuclear receptors (NRs) [17] as another PRMT family ... investigation of a protein arginine methyltransferase family member in zebrafish The investigation also establishes zebrafish as a good study platform for protein arginine methylation Isolation of ... by natural spawning and staged according to Kimmel et al [37] mRNA expression analyses by RT-PCR Total RNA was isolated from embryos at different stages of embryogenesis and different adult tissues...
- 13
- 368
- 0
Báo cáo Y học: The C-terminal region of ammodytoxins is important but not sufficient for neurotoxicity pot
... atc gaa ggt cGG AAC CTT TAC CAG TTC GGG-3¢ and the antisense oligonucleotide 5¢-cg taa aac tgc agt tcg AAA GCA GAT TGC CGC GAC CC-3¢ (sequences complementary to the template are in capital letters; ... values are mean ± S.E.M of at least three independent measurements The enzymatic activity values are accurate to within ± 10% IC50 (nM) sPLA2 R25 CaM AtxA AtnI2 AtnI2/AtxA(K108N) AtnI2(N24F)/AtxA(K108N) ... spectra of mutant and natural sPLA2s The far-UV CD spectra of AtnI2/ AtxA(K108N) (short-dashed line) and AtnI2(N24F)/AtxA(K108N) (long-dashed line) are compared with that of wild-type AtnI2 (solid...
- 6
- 344
- 0
Báo cáo y học: "Preventive health services for systemic lupus erythematosus patients: whose job is it" pps
... Panopalis P, Gillis JZ, Hersh AO, Julian LJ, Katz PP, Criswell LA, Yelin EH: Provision of preventive health care in systemic lupus erythematosus: data from a large observational cohort study Arthritis ... important for those patients at higher risk of not obtaining these services: the young and the uneducated or less educated We and others have shown that many of the less-than-ideal outcomes that patients ... Group Arthritis Rheum 2001, 45:191-202 Durán S, González LA, Alarcón GS: Damage, accelerated atherosclerosis, and mortality in patients with systemic lupus erythematosus: lessons from LUMINA, a multiethnic...
- 2
- 231
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose