... Daily Average Volume ($ Bil) A Comparison of OTC Traded and Exchange-traded IRD We compared OTC traded volume in our data to the average daily trading volume of exchange-traded IRD activity ... categorized OIS contracts that started and ended on central bank rate effective dates as “central bank” trades and contracts associated with two IMM futures expiry dates as “IMM futures” trades Page 13 of 21 ... Offsetting Ratio = (Total DV01 Traded in Opposite Direction - Total DV01 Traded in Same Direction)/Large Trade DV01 Amount Trade sizes were adjusted to DV01terms for comparability across the trading...
... concentration of the enzyme solution from the small amount of evaporation that took place at high temperature Thermoactivity assays were done at temperatures ranging from 30 to 85 °C Background rates ... been subtracted from each assay at the respective temperatures Anaerobic titrations Anaerobic titrations were conducted as described previously [26] The temperature of 60 °C was chosen (rather ... very high temperatures and high concentrations of metals found in the natural environment of Pyrococcus The observed CoA concentration of 0.64 lmol CoAÆg dry weight)1 compares favorably with the...
... bank-client market Thus, the average interbank rate should be somewhere between the bid rate and the ask rate quoted in the bank-client market Yet in practice, the official exchange rate has frequently ... Commercial Bank Selling Rate, and Parallel Market Selling Rate, Jan 08 -Apr 09 Daily VND/USD 19,000 Low er Bound Official Rate Upper Bound Bank Selling Rate Parallel Market Selling Rate 18,500 18,000 ... and local transactions Local transactions only Philippines Both cross-border and local transactions Local transactions only Thailand Both cross-border and local transactions Local transactions...
... previously [5] Briefly, the cohort includes SIF users who were selected through a random number generation strategy Each week between 16 and 32 two-hour time blocks were designated for recruitment ... tested, 170 of 1007 (17%) were found to be HIV positive Table shows the demographic characteristics of the participants stratified by HIV serostatus In this bivariate comparison, HIV positive status ... CI:1.00, 2.03) Discussion The overall HIV seroprevalence among a random cohort of injection drug users attending the SIF was 17% This was not unexpected as high rates of HIV infection among injection...
... liên kết văn tiếng Anh – Phân tích đối chiếu vớiyếu tố tương đương tiếng Việt ứng dụng việcdạy kỹ viết trường Đại học Sư phạm Kỹ thu t Hưng Yên) M.A MINOR PROGRAMME THESIS Field: English Linguistics ... system of grammatical sentences of English Thus, it is doubtless that a large number of celebrated grammarians in the world pay much attention to English conjunctions Given such that considerable ... concluded that VÀ is completely equivalent to AND in this case, and we can also use VÀ CÒN / HƠN NỮA CÒN instead of VÀ However, there are cases in which only VÀ cannot be able to transfer the meaning...
... apply - Overall corporate strategy (% respondents who chose 'overall corporate strategy') Adopting new business models 63 Expanding to new product markets 60 Expanding to new geographic markets ... demographic changes, being experienced across many markets, may bring Corporate leaders will need to assess such impacts across several key aspects of their business l Overall corporate strategy: ... london@eiu.com FRANKFURT Bockenheimer Landstrasse 51-53 60325 Frankfurt am Main Germany Tel: +49 69 7171 880 E-mail: frankfurt@eiu.com PARIS rue Paul Baudry Paris, 75008 France Tel: +33 5393 6600 E-mail:...
... membrane (Roth, Karlsruhe, Germany) at 25 V for h The membrane was incubated with mouse anti-a-synuclein (BD Transduction Laboratories, Franklin Lakes, NJ, USA), mouse antiHSP70 (Zymed Laboratories, ... imported into the nucleus through RanGTP-dependent transport and activates the transcription of target genes by recruiting other factors such as the histone acetyltransferase RuvB-like (Tip49 ⁄ pontin) ... 200 V, h linear gradient to 2000 V, h at 2000 V, h of linear gradient to 5000 V, h at 5000 V, h linear gradient to 8000 V and h and 30 at 8000 V IPG strips were then equilibrated for · 30 in...
... ACS84 ameliorated behaviour symptom in the unilateral 6-OHDA rat model To evaluate the therapeutic effect of ACS84 on Parkinson’s disease, we established the unilateral 6-OHDA lesion rat model ... sulfurtransferase (3MST) The main substrates of CBS and CSE are L-cysteine and/or homocysteine [179, 180], while 3MST facilitates the transfer of thiol group from L-cysteine to -ketoglutarate, ... PD rat model Male Sprague-Dawley (SD) rats (180-220 g) were anesthetized with ketamine (75 mg/kg, i.p.) and xylazine (10 mg/kg, i.p.) After that, the rats were placed in a stereotaxic apparatus...
... giúp ngôn ngữ có vị trí toàn cầu điều kiện để giúp cho tiếng Anh có vị Những tác động ngôn ngữ toàn cầuvới người học Việt Nam đề cập đến viết Tác động tiếng Anh vào nhiều lĩnh vực Việt Nam khoa ... University, 1992 Tiếng Anh - Ngôn ngữ toàn cầu tác động với người học Việt Nam Nguyễn Thúy Nga Khoa tiếng Anh, Trường Đại học Sư phạm Hà Nội, 136 Xuân Thủy, Cầu Giấy, Hà Nội, Việt Nam Bài viết viết ... meaningful English sentences or utterances To sum up, together with advantages English also causes unsolved problems as tradition turbulence such as moral degradation, wreck in human relationships...
... kit and radiographic film exposure ELISA analysis of IL-1b, TNF-a and IL-10 secretion by MSCs The MSCs-CM was concentrated 20 · by ultrafiltration using 10 kDa molecular mass cut-off ultrafiltration ... compilation ª 2010 FEBS 3689 Paracrine anti-fibrotic effects of MSCs in vitro Z Li et al > 30 and < 30 kDa components using a 30 kDa molecular mass cut-off ultrafiltration membrane Fractionation revealed ... demonstrate that hypoxia ⁄ SD induces IL-1b and TNF-a transcription, which are dependent on activation of the NF-jB pathway Hypoxia ⁄ SD-induced IL-1b and TNF-a transcription depend on the extracellular...
... ⁄ Q ratio; b, membrane potential (Dw); d, matrix ATP ⁄ ADP ratio (ATPin ⁄ ADPin); c, extramitochondrial ATP ⁄ ADP ratio (ATPout ⁄ ADPout) Arrows marked e, h1 and p indicate electron flux, transmembrane ... ADPout ratio predicted by the calculation Palmitoyl-CoA specifically affects the ANT Fig Dependence of AMP concentration on the ATP ⁄ ADP ratio (A) Dependence of AMP concentration on the ATP ⁄ ADP ratio ... was moderate and similar with both respiratory substrates When the two substrates are compared, using glutamate plus malate instead of succinate, control of the fluxes shifts from the respiratory...
... so-called type I transmembrane single-chain receptors containing three domains: intracellular catalytic GC, adjacent kinase-like and extracellular ligand-binding domains They transmit NP signalling ... cardiovascular receptors Rapidly accumulating literature has demonstrated that, apart from crossregulation of each other, stimulation of the AR pathways triggers alterations in the signal transduction of ... electrical stimulus originating in the heart Thereby, the noradrenergic sympathetic impulses increase the cardiac rate, contractile force and accelerate relaxation via the b-adrenoceptors (b-ARs), while...
... tiếng Anh ý nghĩa so sánh việcdạy ngữ điệu tiếng Anh cho người Việt Lưu Thị Kim Nhung Khoa tiếng Anh, Trường Đại học Sư phạm Hà Nội, Tầng 1, Nhà D3, 136 Xuân Thu , Cầu Giấy, Hà Nội, Việt Nam ... practice - Give feedback and practice using instructional technology One way of doing so is by letting learners listen to recordings of themselves This can be a valuable awareness raising strategy; ... intonation pattern, the duration of the tone is shorter than its inherent duration In this intonation pattern, the duration of the tone is longer than its inherent duration In this intonation...
... giá ngôn ngữ Bài viết bắt đầu việc nhấn mạnhvào nhiều định nghĩa khác “kênh phản hồi” Tiếp theo, khảo sát số thu t ngữ có khái niệm tương tự số nghiên cứu khác Vớiviệc điểm lại số định nghĩa ... Melbourne, Australia Phương thức mà kỳ thi ảnh hưởng tới việcdạy học thường miêu tả “kênh phản hồi” Đã có nhiều định nghĩa “kênh phản hồi” đề xuất nghiên cứu tư liệu bàn kiểm tra - đánh giá ngôn ... 1993 [1]; Cheng; 2005 [8]) Tests are encouraged to promote the idea of lifelong learning and encourage people to learn English (Language Testing and Training Centre, 2008) 5.3 Negative Washback...
... interactions exist in the literature While the analysis of variance interaction test in this study indicated no significant interaction, the effects-coded model testing for PMT/EPPM type interactions ... differences such as personality traits or demographic characteristics (e.g., gender) not appear to influence processing of fear appeal messages, except on rare occasions In general, the results of this ... positive, indicating that the moderator variable moderates between a higher and a lower positive correlation rather than between a positive and a negative correlation Thus, the expected relationship...
... an effective alternative therapy for malignant brain cancer Nutr Metab (Lond) 2007, 4:5 274 Fredericks M, Ramsey RB: 3-Oxo acid coenzyme A transferase activity in brain and tumors of the nervous ... substrate level phosphorylation for energy production following respiratory damage during the protracted process of carcinogenesis Only those cells capable of making the gradual energy transition ... transition from respiration to substrate level phosphorylation in response to respiratory damage will be able to evade apoptosis Cells unable to make this energy transition will die and thus never become...
... mitochondrial membrane preparations (data not shown) This could be a result of the instability of the mutant enzyme and an increased sensitivity to degradation during membrane preparation, as discussed ... bead mill operating at 30 Hz Membranes were separated from cell debris by centrifugation (10 000 g, 20 min) The supernatant was centrifuged (100 000 g, 90 min) and the pelleted membranes were resuspended ... mitochondrial membrane preparations (40 lg of total protein per sample) were electrophoresed on SDS/polyacrylamide gels (4–20% linear gradient polyacryamide gel) prior to transfer to poly(vinylidene...
... (A) and an illustration of impossible cases of the functional interaction structure with regard to x1 (B) We can identify the impossible interaction structure by noting the temporal slope changes ... interactions We should consider the dynamic range of the system when we define an appropriate sampling rate for application of the proposed method The requirement for defining the sampling rate ... The budding yeast (S cerevisiae) has several MAPK cascades Fig The identified partial interaction structure (A) vs the known interaction structure from literature (B) for the simple real example...
... & Wilson, P (1999) Sex and attitude: A randomized vignette study of the management of depression by general practitioners The British Journal of General Practice, 49, 17-21 Sheps, D S., Kaufmann, ... & Medicine, 45, 231-246 Hankin, B L., & Abramson, L Y (2001) Development of gender differences in depression: An elaborated cognitive vulnerability-transactional stress theory Psychological Bulletin, ... coping strategies rather than actual personal utilization of strategies (Porter et al., 2000) Without sufficient assessment, the strength of this construct to predict outcomes remains unknown Thus,...
... Adh) Adh4 (class IV Adh) Adh4 (class IV Adh) Aldh1 (class I Aldh) – Mouse Rat Rat Mouse Rat Mouse Rat Rat Rat Rat ⁄ mouse Rat ⁄ mouse ACAGCCAATGATGACAGACAGACCGACACCTCCGAGGCCAAACACGGC GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT ... deionized water at room temperature Sections were dehydrated in increasing concentrations of ethanol and finally air-dried Parallel sets of slides were exposed to autoradiographic films (Biomax, Eastman ... was thus transcribed in the mucosa from esophagus to colon, while rectum was mainly devoid of detectable levels of Aldh1 mRNA Adh1, Adh3, Adh4 and Aldh1 transcription in rat tissues In the rat...