nhóm 8 là số 1
Báo cáo y học: "Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing" pps
... +++ 84 50 +++ 10 4 48 +++ 34 26 ++++ 24 24 ++ 10 5 48 ++ 11 4 41 ++ 72 42 10 ++ 75 25 11 ++ 96 46 12 ++ 74 34 13 ++ 1 18 42 14 ++ 60 28 15 ++ 10 1 49 16 ++ 48 40 17 + 96 35 18 + 48 11 19 + 48 31 20 ... 1, 324 98. 11 Variovorax sp (1 ReA) AB196432 1, 383 99. 28 α Proteobacterium (1 ReA) AY162046 1, 3 08 99.62 α Proteobacterium (1 ReA+ 21 UA) AY162053 1, 332 99 .85 β Proteobacterium (1 UA) AF236007 1, 3 71 ... gracilis (1 OA) AB10 988 9 1, 379 99. 71 Rhodococcus fascians (1 RA) Y 111 96 1, 365 99. 71 Antarctic bacterium (1 RA) AJ440974 1, 3 21 98. 86 Uncultured α proteobacterium (1 RA) AJ6045 41 1,324 98. 60 Uncultured...
- 14
- 500
- 0
Báo cáo khoa học: Spermosin, a trypsin-like protease from ascidian sperm cDNA cloning, protein structures and functional analysis doc
... Biol Chem 259, 2900±2904 10 Sawada, H., Yokosawa, H., Someno, T., Saino, T & Ishii, S (1 984 ) Evidence for the participation of two sperm proteases, 13 14 15 16 17 18 19 20 21 spermosin and acrosin, ... valuable advice 11 12 REFERENCES Hoshi, M., Takizawa, S & Hirohashi, N (19 94) Glycosidases, proteases and ascidian fertilization Semin Dev Biol 5, 2 01 2 08 Muller-Esterl, W & Fritz, H (1 9 81 ) Sperm acrosin ... (residues 13 0± 388 ) and the light chain designated as L2 (residues 97 12 9), and the 40-kDa spermosin consists of the heavy chain (residues 13 0± 388 ) and the light chain designated as L1 (residues 23 12 9)...
- 7
- 493
- 0
Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx
... chaffeensis 16 S rRNA gene fragment (396 bp) sequences No 1 10 11 12 13 14 15 16 17 18 19 20 21 0 10 11 12 13 13 13 15 15 15 17 21 30 31 34 10 11 12 13 14 15 16 17 18 19 20 21 100 10 0 10 0 98. 5 97.9 ... 93 .1 92 .1 91. 9 90.6 13 13 13 14 15 14 15 17 18 95.4 95.7 99.7 95.7 95.6 93 .1 92 .1 91. 9 90.6 13 13 13 14 15 14 18 20 21 18 18 94.4 95 .1 94.4 99.2 92.9 91. 0 91. 3 92.0 15 15 15 13 15 14 14 15 14 17 ... 17 17 22 95.4 10 0 95.2 93.9 91. 4 91. 4 91. 1 15 15 15 14 16 15 16 17 16 1 28 24 95.4 95.7 92.9 91 .8 91. 6 90.3 15 15 15 13 13 16 14 15 16 17 17 22 17 95.2 93.9 91. 4 91. 4 91. 1 17 17 17 16 17 15 20...
- 5
- 353
- 0
Báo cáo y học: " Comparative evaluation of INNO-LiPA HBV assay, direct DNA sequencing and subtractive PCR-RFLP for genotyping of clinical HBV isolates" pot
... AB033559-PAPUA, AB0 780 32-JAPAN, AY090453-SWEDEN, AY7 417 96-IRAN, AB126 5 81 -RUSSIA, AB104 712 -EGYPT and AY7 216 05-TURKEY) Ali et al Virology Journal 2 010 , 7 :11 1 http://www.virologyj.com/content/7 /1/ 111 strains ... [8] For isolates giving aberrant results, the amplicons were cloned in pGEM-T Easy plasmid as KWT1 KWT2 KWT3 KWT4 KWT5 KWT6 KWT7 KWT8 KWT9 KWT10 KWT 11 KWT12 KWT13 X59795 KWT14 AJ34 411 6 AY1 611 57 ... AJ34 411 6 AY1 611 57 KWT15 AB033559 KWT16 AB0 780 32 AY090453 AY7 417 96 AB126 5 81 AB104 712 AY7 216 05 Page of described previously [11 ] In each case, the plasmid DNA was isolated from 10 independent clones...
- 5
- 370
- 0
Analysis, sequencing and in vitro expression of PCR products
... TCTGAACGGTACAATCCTTGCTTGTCAGCCGTCAACATTGGGTTGACCTTGGCATTGGGTAGGGACGTCCATGTCTTTGAAGAT 90 10 0 11 0 12 0 13 0 14 0 15 0 16 0 17 0 TGGGCTATAGACTTCGCCATTCTTCTCAAATACGCCACCGCTCCAGGAGCCTCCAATGGTAAAAACACGACCGTCTGACATGC 18 0 19 0 200 210 220 230 240 250 (C) GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT ... products 10 7 14 15 16 17 18 19 20 21 22 23 24 DNA sequencing of allele-specific polymerase chain reaction-amplified HLA-DR genes BioTechniques 10 : 30 Stahl S, Hultman T, Olsson A, Moks T, Uhlen M (1 988 ) ... Natl Acad Sci USA 85 : 7652–7656 11 Hultman T, Bergh S, Moks T, Uhlen M (19 91) Bidirectional solid-phase sequencing of in vitro-amplified plasmid DNA BioTechniques 10 : 84 –93 12 Hultman T, Stahl...
- 24
- 494
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... A3 485 3 43.2 37.6 28. 0 28. 5 25.2 25.2 45.7 39.3 26.6 26.6 25 .1 25 .1 CAA2 486 3 27.4 AAB2 61 48 28. 0 CAA2 486 3 27.0 26.9 26.6 25.7 AAG16755 NP_0 611 94 AAK624 68 AAG 414 01 NP_06 087 2 16 .0 19 .0 13 .8 14 .3 15 .0 ... Epstein–Barr virus IL -10 (CAA2 486 3), IL -10 (NP_000563), IL -19 (AAG16755), IL-20 (NP_0 611 94), IL-22 (AAK624 68) , IL-24 (AAG 414 01) , IL-26 (NP_06 087 2) and interferon-a (P 015 79); from torafugu IL -10 (CAD62446); ... IL -10 -related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL -10 and inducible by IL-9 J Immunol 16 4, 18 1 4– 18 1 9 Ó FEBS 2003 Cloning and analysis of IL -10 ...
- 8
- 584
- 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx
... sequence 10 11 12 13 Neutral Neutral Other Basic QH Basic QH Basic Y Basic Y Basic Y Basic Y Basic QH Basic QH Other Basic G 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 P1 ... Tachystatin B2 fragments Tachystatin B1 Tachystatin B2 Tachystatin A Tachystatin A fragment IGFBP-like protein 13 5 14 3 13 1 11 0 19 6 16 1 14 1 13 7 12 0 6 08 79 41 Unknown R&R R&R Unknown R&R R&R R&R ... Number 10 13 19 25 29 37 P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 P 11 P12 P13 P14 P15 4 780 Protein Name Residue number Chitin-binding motif DCA incorporation Basic QH4 Basic Y6 Basic Y7 Basic QH10 Basic G13...
- 13
- 582
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... implications Gene 205, 12 5 14 0 12 Ojala, D., Montoya, J & Attardi, G (1 9 81 ) tRNA punctuation model of RNA processing in human mitochondria Nature 290, 470–474 13 Gelfand, R & Attardi, G (1 9 81 ) Synthesis ... 2 58, 10 104 10 110 Min, J & Zassenhaus, H.P (19 93) Identification of a protein complex that binds to adodecamer sequence found at the 3¢ ends of yeast mitochondrial mRNAs Mol Cell Biol 13 , 416 7– 417 3 ... Biochemistry 22, 315 1– 315 6 15 Christianson, T.W & Clayton, D.A (1 988 ) A tridecamer DNA sequence supports human mitochondrial RNA-3¢-end formation in vitro Mol Cell Biol 8, 4502–4509 16 Kruse, B.,...
- 13
- 415
- 0
DNA Sequencing – Methods and Applications Edited by Anjana Munshi pptx
... 99 .8 (0.4) 10 0.0 (0) 10 0.0 (0) 99 .8 (0.4) 1 08 (0) 1 08 (0) 1 08 (0) 1 08 (0) 1 08 (0) 1 08 (0) 1 08 (0) 1 08 (0) 1 08 (0) 1 08 (0) BRAF (74%) 70 75 80 90 10 0 67 .8 (7 .1) 69.7 (3.5) 73.5 (7.6) 67.7 (10 .0) 72.7 ... 15 3 .8 (0 .8) 15 4.0 (1. 4) 15 4.4 (1 .8) 15 4.2 (1. 5) 15 4.4 (1. 1) 15 3.6 (0.9) 15 4.4 (0.9) 15 4.0 (1. 0) 15 4.4 (3.4) 70 18 . 1 (16 .6) 66.3 (23.5) 55.3 (4.7) 97 .1 (3.2)** 75 80 16 .7 (8. 9) 29.2 (14 .0) 82 .4 (6.9) ... (5 .1) 72.3 (6.3) 78. 3 (2.5) 67.9 (7.9) 73.6 (2 .1) 68. 9 (11 .5) 97.2 (2.6) 98. 2 (1. 5) 99.2 (0 .8) 98. 3 (0.6) 98. 8 (1. 3) 99.4 (0.7) 99.4 (0.7) 99 .8 (0.3) 99.3 (0.7) 98. 5 (1. 4) 15 4 .8 (2.5) 15 3 .8 (0 .8) ...
- 184
- 928
- 0
Báo cáo khoa học: Site-directed mutagenesis and footprinting analysis of the interaction of the sunflower KNOX protein HAKN1 with DNA ppt
... patterns divide the maize knotted1-like homeobox genes into two classes Plant Cell 6, 18 7 7– 18 8 7 11 Jackson D, Veit B & Hake S (19 94) Expression of maize KNOTTED1 related homeobox genes in the ... sequence relatedness and expression patterns [10 ] Based on the expression patterns [11 13 ], analysis of mutants [14 17 ] and overexpression studies [ 18 21] it was proposed that class I knox genes ... Natl Acad Sci USA 99, 9579–9 584 27 Laughon A (19 91) DNA binding specificity of homeodomains Biochemistry 30, 11 357 11 367 28 Tioni MF, Gonzalez DH & Chan RL (2003) Knotted1like genes are strongly expressed...
- 13
- 558
- 0
Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx
... )22 01 )36 ⁄ )17 ) 211 6 ⁄ )2097 )17 12 ⁄ )16 93 )83 7 ⁄ ) 81 8 ) 685 ⁄ )666 )637 ⁄ )6 18 ) 619 ⁄ )600 )599 ⁄ ) 580 ) 580 ⁄ )5 61 )560 ⁄ )5 41 )542 ⁄ )523 )523 ⁄ )504 )503 ⁄ ) 484 )466 ⁄ )14 7 )4 18 ⁄ )399 ) 3 81 ... ) 214 )11 3 ⁄ )94 )97 ⁄ ) 78 )83 ⁄ )64 ) 71 ⁄ )52 )12 6 ⁄ )10 7 )14 6 ⁄ )12 7 )17 5 ⁄ )15 6 )229 ⁄ ) 210 )350 ⁄ )3 31 )396 ⁄ )377 )492 ⁄ )473 a In relation to the translation start site at ) 211 6, )17 12, )83 7, ... LUC MU-F MNEG-U LUC MU-I A549 DU145 FEBS Journal 275 (20 08) 18 6 0– 18 7 3 ª 20 08 The Authors Journal compilation ª 20 08 FEBS SV40-Promoter 50 10 0 15 0 LUC activity 18 6 5 Analysis of upstream region...
- 14
- 340
- 0
Báo cáo khoa học: Tracking interactions that stabilize the dimer structure of starch phosphorylase from Corynebacterium callunae Roles of Arg234 and Arg242 revealed by sequence analysis and site-directed mutagenesis doc
... E coli XL1 Blue harbouring pQE 30-StP (or pQE 70-StP) were grown in media that contained tryptone (10 gÆL )1) , yeast extract (5 gÆL )1) , and NaCl (10 gÆL )1) and ampicillin (10 0 lgÆmL )1) After the ... at 30 °C (M)/t1/2 at 45 °C (min) Enzyme KdSO4 (mM)/KdPi (mM) No oxyanion added + sulfatea Wild-type 4.5 ± 0.5/ 18 ± 1. 17 ± 0.03/3.2 ± 0 .1 2.95 ± 0 .10 /stableb R234A R242A ± 3/n.a 3 .8 ± 0.4/n.a 2.60 ... 2 282 10 Tagaya, M., Shimomura, S., Nakano, K & Fukui, T (1 982 ) A monomeric intermediate in the reconstitution of potato apophosphorylase with pyridoxal 5¢-phosphate J Biochem 91, 589 –597 11 Weinhausel,...
- 11
- 444
- 0
bioinformatics sequence and genome analysis - david w. mount
... Biol 14 7: 19 5 19 7 ——— 1 9 81 b Comparison of biosequences Adv Appl Math 2: 482 – 489 Staden R 1 984 Computer methods to locate signals in nucleic acid sequences Nucleic Acids Res 12 : 505– 519 ——— 1 989 ... to our decimal format 0, 1, plus the letters A, B, F Thus, hexadecimal 0F corresponds to binary 0000 11 11 and decimal 15 , and FF corresponds to binary 11 11 111 1 and decimal 255 A DNA ... SEQUENCE 25 /// 2 688 checksum agc t 25C8 checksum aac t seq1 seq1, 16 bases, 2 688 checksum 10 15 30 a g c t a g c t a g c t a g c t 20 seq2 seq2, 16 bases, 25C8 checksum 10 15 30 a a c t a a...
- 565
- 510
- 0
Báo cáo hóa học: " Research Article Binocular Image Sequence Analysis: Integration of Stereo Disparity and Optic Flow for Improved Obstacle Detection and Tracking" pptx
... and MVD y (il , j) , are defined as 20 18 16 50 14 12 10 10 0 15 0 200 50 10 0 15 0 200 250 300 (a) No fusion Disparity map 20 18 16 50 14 12 10 10 0 15 0 200 50 10 0 15 0 200 250 300 (b) With fusion MVDx ... K Young 50 50 10 0 10 0 15 0 15 0 200 200 50 10 0 15 0 200 250 300 50 10 0 15 0 200 250 300 10 0 15 0 200 250 300 (a) The stereo image pair at frame 60 50 50 10 0 10 0 15 0 15 0 200 200 50 10 0 15 0 200 250 300 ... k +1 k +1 − Pk +1 = − Kk +1 ·C Pk +1 , (13 ) (14 ) (15 ) Y Huang and K Young Distance tracking results Longitudinal speed tracking results 15 15 10 Longitudinal speed Z’(m/s) Distance Z (m) 14 .5 14 13 .5...
- 10
- 363
- 0
Báo cáo hóa học: " Autoregressive Modeling and Feature Analysis of DNA Sequences" pot
... Processing 1 .8 Residual error 1 .8 Residual error 1. 6 1. 4 1. 2 1. 6 1. 4 50 10 0 Order 15 0 1. 2 200 50 (a) 15 0 200 15 0 200 (b) 1 .8 1 .8 Residual error Residual error 10 0 Order 1. 6 1. 4 1. 2 1. 6 1. 4 50 10 0 Order ... well Position with the same features DNA segment 210 – 217 (template) 517 4–5 18 1 12 572 12 579 19 2 78 19 285 29624–296 31 36 387 –36394 5 580 5–5 5 81 2 6 310 6–6 311 3 CTCACATT CTCACATT CTCACATT AATGTGAG CTCACATT ... 0.2 0. 18 0.22 0.2 50 10 0 Order 15 0 0. 18 200 50 (a) 15 0 200 15 0 200 (b) 0.26 0.24 0.24 Residual error 0.26 Residual error 10 0 Order 0.22 0.2 0. 18 0.22 0.2 50 10 0 Order 15 0 200 0. 18 (c) 50 10 0 Order...
- 16
- 331
- 0
Báo cáo khoa học: " Sequence Analysis of Canine LINE-1 Elements and p53 Gene in Canine Transmissible Venereal Tumor" doc
... * ** * * * * *A * * * * 954 3040 9 81 312 0 10 08 3200 10 34 3 280 10 61 3360 1 088 3440 11 14 3520 11 41 3600 11 68 3 680 11 94 3760 12 21 384 0 12 48 3920 12 74 4000 12 75 4 080 G A CT G C T A AC T C T G GG A ... tumor Proc Natl Acad S ci U.S A 19 91, 88 , 81 36 - 81 39 Cohen, D The canine transmissivle venereal tumor : a unique result of tumor progression Adv Cancer Res 1 985 , 43, 75 -11 2 Devilee, P., Van Leeuw en, ... Biochem 1 982 , 51, 81 3 -84 4 10 Johnson, A S., Couto, C G., Weghorst, C M Mutation of the p53 tumor suppressor gene in spontaneously occurring osteosarcomas of the dog Carcinogenesis 19 98, 19 (1) , 213 -7...
- 8
- 263
- 0
Minireview Maize DNA-sequencing strategies and genome organization Ron J Okagaki and Ronald L ppt
... Issue 5, Article 223 Okagaki and Phillips 223.3 References 10 13 14 16 17 19 20 interactions 18 refereed research 15 deposited research 11 12 reports reviews comment Bennetzen JL, Chandler VL, Schnable ... 2003, 6 :1 28- 13 3 Bureau TE, Wessler SR: Mobile inverted-repeat elements of the Tourist family are associated with the genes of many cereal grasses Proc Natl Acad Sci USA 19 94, 91: 1 411 -14 15 Sidorenko ... duplicate genes Science 2000, 290 :11 51- 115 5 Kermicle JL, Eggleston WB, Alleman A: Organization of paramutagenicity in R-stippled maize Genetics 19 95, 14 1:3 61- 372 Assaad FF, Tucker KL, Signer...
- 3
- 249
- 0
Signal sequence analysis of expressed sequence tags from the nematode Nippostrongylus brasiliensis and the evolution of secreted proteins in parasites potx
... not C elegans NBC000 28 10 4 1e-23 1 CE004 31 YYYYS 0.7 31 18 0.999 Y N Globin NBC0 012 4 1 28 8e- 31 1 CE004 31 YYYYS 0.7 31 18 0.999 Y N Globin NBC0 014 4 19 5 7e- 51 CE29663 YYNYS 0 .86 6 19 0.963 Y N Transport-secretion ... 0.903 17 1. 000 Y Y Unknown NBC00354 91 4e- 21 CE16530 YYYYS 0. 511 17 0.943 Y Y Unknown NBC00472 215 8e-57 CE0 488 6 YYYYS 0. 319 15 0.999 Y Y Signal sequence receptor 55 7e-09 CE05972 YYYYS 0.979 21 ... NBC00237 84 5e -17 CE20223 YYYYS 0.6 71 19 1. 000 Y Y Unknown (similar to NBC00 012 ) NBC002 58 14 5 1e-35 CE0 013 3 YYYYS 0.524 19 0.999 Y Y FAR -1 fatty acid/ retinol-binding protein NBC00266 12 9 6e- 31 CE19630...
- 15
- 416
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose