k kawazoc n fukiyamark 1993 serum albumin is a strong predictor of death in chronic dialysis patients kidney int 44 115 119
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test The MannWhitney rank sum test was used for comparison between individual ... regulation of Ang-1 in critically ill patients Experimental endotoxaemia has been shown to disrupt protective Ang-1/Tie-2 signalling by reducing Ang-1 and inducing Ang-2 expression [39] In line ... on the role of Ang-2 as a biomarker in critically ill patients are warranted Key messages • Excess Ang-2 was independently associated with inferior survival • Ang-2 concentrations are increasingly...
- 9
- 634
- 0
Mobility is a key predictor of change in well being among older adults who experience falls evidence from the vancouver falls prevention clinic cohort
... function.[31] 169 M AN U TE D 168 SC 161 Statistical Analyses 171 Data distributions were initially examined using visual inspection of histograms and computation of skew 172 and kurtosis values ... Neuroscience, a Michael Smith Foundation for Health Research (MSFHR) Scholar, a Canadian Institutes of Health Research (CIHR) New Investigator, and a Heart and Stroke Foundation of Canada’s Henry JM SC Barnett’s ... trends were non-significant In contrast, the 13 ACCEPTED MANUSCRIPT Mobility predicts wellbeing among older fallers TUG was significant for males and females in explaining variation in wellbeing...
- 29
- 342
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... that are characteristic of RNA-binding proteins, and an alanine-rich carboxy-terminal sequence that could be involved in protein–protein interactions Interestingly, this alanine-rich sequence, ... may mediate the enhancing effect of splicing on mRNA translation [34–36] Rbm9, as a splicing factor interacting with a PAP, may also participate in the translational enhancement mediated by introns ... translation On the one hand, CPEB represses the translation of CPE-containing mRNAs via its interaction with other partners, including Maskin, the RNA helicase Xp54 and Pumilio [3–5] Maskin interacts...
- 14
- 502
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, Taguchi H: A novel treatment strategy targeting Aurora kinases in acute myelogenous leukemia Mol Cancer ... Tanaka N, Katayama H, Lee S, Spiess PE, Steinberg JR, Wang Z, Katz RL, et al: Quantitation of Aurora kinase A gene copy number in urine sediments and bladder cancer detection J Natl Cancer Inst ... DNA, 2N DNA, 2N to 4N DNA, 4N DNA and > 4N DNA and the percentage of cellular events in each of the five regions quantified Defining Cell Sensitivity An analysis of cell line sensitivity to GSK1070916...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, Taguchi H: A novel treatment strategy targeting Aurora kinases in acute myelogenous leukemia Mol Cancer ... Tanaka N, Katayama H, Lee S, Spiess PE, Steinberg JR, Wang Z, Katz RL, et al: Quantitation of Aurora kinase A gene copy number in urine sediments and bladder cancer detection J Natl Cancer Inst ... DNA, 2N DNA, 2N to 4N DNA, 4N DNA and > 4N DNA and the percentage of cellular events in each of the five regions quantified Defining Cell Sensitivity An analysis of cell line sensitivity to GSK1070916...
- 10
- 665
- 0
Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps
... be noted that we did not find increased sputum concentrations of pro-inflammatory cytokines in patients with bacterial colonisation Different reasons may explain this finding, including a small ... pro-inflammatory cytokines, including interleukin-1 (IL-1), interleukin-6 (IL-6), interleukin-8 (IL-8), and tumour necrosis factor-alpha (TNFalpha) were measured using quantitative sandwich immunoassay ... exacerbation induction, independent of a new strain acquisition In a prospective longitudinal cohort of COPD patients assessed during exacerbations and stable disease, sputum concentrations of pre-existing...
- 9
- 395
- 0
Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt
... oxygenation index and an increased extravascular lung water [3-5] However, important decisions regarding therapeutic interventions and changes in goals of care are often made later in the course of ... software was used for statistical analysis All interval data in tables and text are presented as mean with standard deviation in parentheses Data presented in graphs are mean with error bars indicating ... Alia I, Brochard L, Stewart TE, Benito S, Epstein SK, Apezteguia C, Nightingale P, et al: Characteristics and outcomes in adult patients receiving mechanical ventilation: a 28-day international...
- 8
- 351
- 0
Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf
... transcriptase inhibitors (NRTI) plus a protease inhibitor (PI) or a nonnucleoside reverse transcriptase inhibitor (NNRTI) or a PI and an NNRTI in combination [20] As adherence is a major component ... identified as risk factors for mortality in the post-HAART era [4,6,46] In our cohort, almost 30% of patients had a recent AIDS diagnosis and were HAART naive, and an additional 16% of the patients ... of all patients Patients (n = 88) Age (years) 40 (31-47) Male gender Statistical analysis Continuous variables were summarized as medians and interquartile ranges We compared the distribution...
- 8
- 409
- 0
The plancherel formula of l 2(n 0 GIpsi) where g is a p adic group
... obtain the Plancherel formula for this unitary representation Dinakar Ramakrishnan first studied the case for GL(2) in [Ram2] obtaining a Plancherel formula for the archimedean and non-archimedean ... Cartan decomposition as nw2 −1 and w2 k1 are contained in K 1.2 THE CARTAN AND IWASAWA DECOMPOSITIONS OF G −1 (2) If n ∈ N0 ,0 but a 1 na1 ∈ K, then na1 k1 = a1 (a 1 na1 )k1 = w2 a2 w2 n0 k1 where ... derive a contradiction Write the component of an arbitrary n ∈ N0 in N as n Since a 1 na1 ∈ K, n ∈ N is contained in at most N ,λα val(α (a) ) However by our assumption on n0 , n ∈ N ,λα val(α (a) )...
- 52
- 291
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... distinguishing between noninfection and infection in newly admitted critically ill patients Eosinopenia is a moderate marker in discriminating between SIRS and infection in newly admitted critically ... hypothetical mechanism of eosinopenia as the migration of eosinophils to the inflammatory site is taken into account, this may explain the difference found between sepsis-related conditions and SIRS in ... promising sepsis markers in critically ill patients, and is capable of complementing clinical signs and routine laboratory variables that are suggestive of sepsis [3-12] The procalcitonin plasma...
- 10
- 597
- 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... The author is primarily concerned with (A) describing a phenomenon and explaining its causes (B) outlining a position and supporting it with statistics (C) isolating an ambiguity and clarifying ... leading provider of education information and advice, with books and online resources focusing on education search, test preparation, and financial aid Its Web site offers searchable databases and...
- 696
- 1,001
- 1
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... of external stimuli and consist of three sequentially acting protein kinases: a MAPK kinase kinase, a MAPK kinase (MAPKK) and finally a MAPK [19] However, little is known about the function and ... Yonezawa M, Maruyama K, Yamaguchi-Shinozaki K & Shinozaki K (2007) The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis ... protein kinase PINOID Cell 100, 469–478 Benjamins R, Quint A, Weijers D, Hooykaas P & Offringa R (2001) The PINOID protein kinase regulates organ development in Arabidopsis by enhancing polar auxin...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG ... spectrometry analysis and their position in isoform ⁄ a of PDIP46 ⁄ SKAR The asterisk indicates the peptide identified by manual analysis of MS ⁄ MS spectra Comparison of the intracellular localizations of ... known as the RNA binding domain (Fig 2) [26] Interaction of the human proteins ER and PDIP46/SKAR in vitro In order to confirm the physical interaction of the human ER protein with PDIP46 ⁄ SKAR...
- 14
- 517
- 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... basement membranes Histochem Cell Biol 113, 115 124 Nagahama H, Hatakeyama S, Nakayama K, Nagata M, Tomita K & Nakayama K (2001) Spatial and temporal expression patterns of the cyclin-dependent kinase ... medium chain Syndecan Adducin (gamma) Caveolin, caveolae protein Kinesin family member 5B Stromal antigen SH3-binding domain glutamic acid-rich protein like Cyclin-dependent kinase inhibitor ... creatine kinase enhancer Mol Cell Biol 24, 2132–2143 Ozaki H, Watanabe Yoko Ikeda K & Kawakami K (2002) Impaired interactions between mouse Eya1 harboring mutations found in patients with branchio-otorenal...
- 16
- 476
- 0
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... radioactivity was counted in a liquid scintillation counter (Aloka LSC5100, Tokyo, Japan) Cloning and sequence analysis of TH cDNA Total RNA was isolated from integuments of day last instar larvae ... calmodulin-dependent protein kinase II-activated AP-1 and c-Jun N- terminal kinaseactivated EGR-1 signaling pathway in tumor necrosis factor-ƒ and lipopolysaccharide-induced CD44 expression in ... The Authors Journal compilation ª 2007 FEBS Y Ninomiya and Y Hayakawa Regulation of melanin synthesis in insect cuticle A Anti PsTH IgG A2 3187 0µM A in vitro 6h incubation Dorsal Ventral A2 3187...
- 10
- 440
- 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... chromatin immunoprecipitation (ChIP) and RNA interference-mediated gene knockdown SerpinA3 is a member of the serine protease inhibitor family, and is involved in the in ammatory response It is mainly ... expressed as the mean ± SD (n = 3), with significant differences assessed using one-way analysis of variance (ANOVA) at P < 0.05 or P < 0.01 Acknowledgements We thank Dr Hanna Harant (Novartis Institute ... containing 3% BSA at °C overnight, washed abundantly in NaCl/Pi, and incubated for h with the TRITC-conjugated secondary antibody The final concentration (10 lgÆmL)1) of DAPI was added and incubated...
- 14
- 397
- 0
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx
... AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, ... E 1A promoter with approximately a 20-fold increase in the same assay system In addition, T20 activated transcription in an EBVori-containing episome and, most interestingly, in the genome of all ... DNA introduced into episomes can activate transcription in a TATA box-dependent manner J Adv Sci 16, 99–103 15 Tanaka J, Miwa Y, Miyoshi K, Ueno A & Inoue H (1999) Construction of Epstein–Barr...
- 12
- 399
- 0
Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf
... with other proteins, whereas its C-terminal domain is involved in DNA binding [38] By contrast, the DNA-binding domain of Elk-1 is present at its N- terminal end and C-termini allows it to form ... transcription factor and the urokinase-type plasminogen activator is correlated with the malignant and invasive potential in meningiomas Cancer 89, 2292–2300 Jayaraman G, Srinivas R, Duggan C, Ferreira ... Tokunaga Y, Yagi N, Yasunaga A, Kishikawa M & Naito S (1999) Ets-1 transcription factor-mediated urokinase-type plasminogen activator expression and invasion in glioma cells stimulated by serum...
- 15
- 325
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... 3374–3378 101 Kanaan A, Farahani R, Douglas RM, Lamanna JC & Haddad GG (2006) Effect of chronic continuous or intermittent hypoxia and reoxygenation on cerebral capillary density and myelination Am J ... [51,52] On the other hand, at least in endothelial cells, protein kinase A is involved in HIF- 1a phosphorylation under intermittent hypoxia but not under chronic hypoxia, and protein kinase A inhibition ... oxygen sensing, signalling and gene regulation J Exp Biol 203, 1253–1263 Yuan G, Nanduri J, Bhasker CR, Semenza GL & Prabhakar NR (2005) Ca2+ ⁄ calmodulin kinase-dependent activation of hypoxia inducible...
- 12
- 390
- 0
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
... homologous integrin a2 I domain [26] The present study demonstrates that saratin interferes with integrin a2 b1 binding to collagen, in addition to inhibiting VWF–collagen binding, presumably by binding ... fibrinogen (Table 1), indicating that saratin does not inhibit platelet integrin aIIbb3 binding to fibrinogen Saratin blocks Src kinase-independent platelet adhesion to soluble collagen A set of ... Taken together, these data are reflective of the ability of saratin to both block VWF–collagen binding and to inhibit a2 b1–collagen interactions Inhibition of a2 integrin subunit I domain binding...
- 11
- 440
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008