Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells Abhay A Shukla, Misti Jain and Shyam S Chauhan Department of Biochemistry, All India Institute of Medical Sciences, New Delhi, India Keywords 5¢-RACE; electrophoretic mobility shift assays; promoter; site-directed mutagenesis; transcription factors Correspondence S S Chauhan, Room No -3009, Department of Biochemistry, All India Institute of Medical Sciences, New Delhi 110029, India Fax: +91 11 2658 8663 Tel: +91 11 2659 3272 E-mail: s_s_chauhan@hotmail.com Database The nucleotide sequence of the human DPP-III promoter has been submitted to the GenBank database under the accession number FJ793449 (Received November 2009, revised 25 December 2009, accepted February 2010) doi:10.1111/j.1742-4658.2010.07603.x Dipetidyl-petidase III is a metallopeptidase involved in a number of physiological processes and its expression has been reported to increase with the histological aggressiveness of human ovarian primary carcinomas Because no information regarding the regulation of its expression was available, experiments were designed to clone, define and characterize the promoter region of the human dipeptidyl-peptidase III (DPP-III) gene In this study, we cloned a 1038 bp 5¢-flanking DNA fragment of the human DPP-III gene for the first time and demonstrated strong promoter activity in this region Deletion analysis revealed that as few as 45 nucleotides proximal to the transcription start site retained  40% of the activity of the full-length promoter This promoter lacked the TATA box but contained multiple GC boxes and a single CAAT box Similarly, two Ets-1 ⁄ Elk-1-binding motifs are present in the first 25 nucleotides from the transcription start site Binding of Ets-1 ⁄ Elk-1 proteins to these motifs was visualized by electrophoretic mobility shift and chromatin immunoprecipitation assays Mutations of these binding sites abolished not only binding of the Ets protein, but also the intrinsic promoter activity Increased DNA-binding activity of Ets-1 ⁄ Elk-1 by v-Ha-ras also augmented the mRNA level and promoter activity of this gene Similarly, co-transfection of DPP-III promoter–reporter constructs with Ets-1 expression vector led to a significant increase in promoter activity From these results, we conclude that Ets-1 ⁄ Elk-1 plays a critical role in transcription of the human DPP-III gene Introduction Dipeptidyl-peptidase III (DPP-III), a cytosolic aminopeptidase has been purified and characterized from different tissues of various animal species such as rat and human skin [1,2], bovine and human cataractous lens [3], rabbit and human erythrocytes [4], rat brain [5] and pancreas [6], monkey brain [7], human placenta [8], neutrophils [9], Saccharomyces cerevisiae [10] and Drosophila melanogaster [11] All mammalian DPP-IIIs require zinc ions for their maximum activity and have therefore been termed metalloaminopeptidases The crystal structure of yeast DPP-III has been described by Baral et al [12], providing an insight into its catalytic mechanism and mode of substrate binding No endogenous substrate for this enzyme has yet been identified However, it has broad specificity for a number of polypeptides, suggesting its involvement in the terminal stage of intracellular protein catabolism Interestingly, DPP-III activity has been reported to increase in retroplacental serum [8] suggesting that it is synthesized in placental cells and released into the maternal circulation In view of its high affinity for angiotensin II and III [13], the potential role of this Abbreviations ChIP, chromatin immunoprecipitation; CLR, Chang liver Ras cells; CLDR, Chang liver DRas cells; DPP-III, dipeptidyl-peptidase III; EMSA, electrophoretic mobility shift assay; ERK, extracellular regulated kinase; Inr, initiator element; MEK, mitogen-activated protein kinase kinase FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1861 Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al peptidase in elevating the level of plasma angiotensin hydrolysing activity during pregnancy has been described Similarly, it exhibits high affinity for Leuenkephalins [5] These features suggest a potential role for DPP-III in the regulation of blood pressure [10] and in pain modulation [14] Human DPP-III has been shown to increase with the histological aggressiveness of human ovarian primary carcinomas [15] Because levels of DPP-III alter in several physiological and pathological conditions it must necessarily be amenable to regulated expression However, no systematic study has been carried out to elucidate the regulatory molecular mechanisms associated with its expression Therefore, this study was designed to clone and characterize the human DPP-III promoter in order to elucidate the transcriptional regulation of the gene In this regard, we identified the region that plays an impor- tant role in determining the basal promoter activity of the gene Furthermore, with the help of binding assays and site-directed mutagenesis, we established that Ets-1 ⁄ Elk-1 play a key role in the regulation of DPP-III transcription in human glioblastoma cells Results PCR amplification, sequence analysis and demonstration of promoter activity in the 5¢ upstream region of the human DPP-III gene Using primer designs based upon the DPP-III gene located on chromosome 11q 12 fi q13.1 of the human genome sequence (accession number NT_033903.7), we were able to amplify a single 1038 bp DNA fragment by PCR (data not shown) This fragment was cloned Fig Nucleotide sequence of the 5¢-flanking region of the human DPP-III gene The transcriptional initiation site determined by 5¢-RACE in U87MG cells is denoted as +1 Different primers were used for amplification of the 1038 bp full-length promoter and its deletion fragments, 5¢-RACE and ChIP assays are shown by arrows The most 5¢end base of the full-length promoter and the different deletion constructs are shown in bold and indicated by arrows ( fi ) with respect to the transcription initiation site (; +1) The translation initiation codon ATG is underlined Potential cis-element regulatory motifs are in italics and marked by dashed arrows Two AT-rich sequences present at positions )24 and )29 are written in bold The intronic sequences are written in lower case Primers used for the amplification of DPP-III promoter sequence are also underlined 1862 FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al As a first step towards characterization of the human DPP-III promoter, the transcriptional start site in U87MG cells was mapped using 5¢-RACE Resolution of RACE products on agarose gel revealed the amplification of a single  200 bp fragment (Fig 3) This fragment was cloned into a TA cloning vector and six representative clones were subjected to double-stranded DNA sequencing All clones exhibited 100% homology to DPP-III mRNA and contained the same nucleotide (G) corresponding to the 33rd nucleotide upstream of the translation initiation codon in the reported mRNA sequence (accession number NM_005700) These results suggested that this nucleotide is the transcription initiation site (marked +1 in Fig 1) A Oligo dT-anchor primer (T)nTTTV (A)nAAA AAS2 PCR anchor Primer t oduc E pr RAC PCR cont negativ e rol x796.23 AAS1 00 Luciferase activity fold increase over pGl3-basic Mapping of the transcriptional start site B 1000 900 800 These results established that the cloned fragment is a functional DPP-III promoter DL1 into a TA cloning vector and sequenced Analysis of its nucleotide sequence showed 100% homology to the upstream region and part of the reported 5¢-end of DPP-III mRNA These results indicated that the amplified region is physically linked to exon of the DPP-III gene Nucleotide sequence analysis of the cloned 1038 bp human DPP-III promoter revealed that it contained 63.19% G + C nucleotides, no detectable TATA box, a single CAAT box and several GC boxes (Sp1-binding sites) Multiple putative transcription factor binding sites were identified in this region using the motif finder program (http://motif genome.jp/) with high-stringency parameters for core similarity of 0.85 and matrix similarity of 0.85 As shown in Fig 1, these motifs include NF-jB, USF, C ⁄ EBP, CREB, NF-1 and multiple binding sites for the Sp1 and Ets family of transcription factors, suggesting that the amplified region is a potential promoter To demonstrate promoter activity in the amplified fragment, we cloned it upstream of the luciferase reporter gene in the pGL3-Basic vector Transfection of the resulting construct (pAAS-1) into U87MG, Caov-2, Chang liver, Panc1 and NIH 3T3 cells yielded  800-,  200-,  100-,  80- and 25-fold higher luciferase activity respectively, compared with the pGL3-Basic transfected cells (Fig 2) 700 600 500 400 300 200 x212.53 x102.28 100 500 bp x77.88 x23.42 U87MG Caov-2 Chang Liver Panc1 NIH3T3 Fig Demonstration of promoter activity in the 5¢ flanking region of the human DPP-III gene in different cell lines The PCR-amplified 5¢ flanking region of human DPP-III gene (1038 bp) was cloned upstream of the luciferase reporter gene in promoter-less plasmid pGL3-Basic The resulting construct (pAAS-1) was transfected into U87MG (human glioblastoma grade III), Caov-2 (ovarian carcinoma), Chang liver (human liver), Panc1 (human pancreatic carcinoma) or NIH 3T3 (mouse fibroblast) cells After 48 h of transfection, cells were washed three times with ice-cold NaCl ⁄ Pi, lysed and luciferase activity was assayed in the cell lysates Cells transfected with pGL3-Basic were processed in an identical way and served as the negative control Values are the mean ± SE of at least three independent experiments performed in triplicate Other details are given in Materials and methods ~200 bp 100 bp Fig Mapping of the transcription initiation site of the DPP-III gene (A) Schematic diagram showing the location of different primers used for 5¢-RACE on U87MG cDNA (B) Total cellular RNA isolated from U87MG cells was reverse transcribed using a genespecific primer (AAS-2) and used in 5¢-RACE to map the transcription initiation site PCR performed without a template served as the negative control RACE products were resolved on 2% agarose gel and stained with ethidium bromide The prominent 200 bp fragment (indicated on the right-hand side) was excised, cloned and subjected to double-strand DNA sequencing DL100 corresponds to a 100 bp DNA ladder (MBI Fermentas, Vilnius, Lithuania) FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1863 Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al from the 5¢-end resulted in a significant reduction in promoter activity Constructs which lacked 548 bp ()485 ⁄ +5, pAAS-3), 803 bp ()230 ⁄ +5; pAAS-4), 909 bp ()123 ⁄ +5; pAAS-5), 940 bp ()93 ⁄ +5; pAAS6), 980 bp ()53 ⁄ +5; pAAS-7) and 993 bp ()40 ⁄ +5; pAAS-8) from the 5¢-end, retained 51, 48, 39, 42, 44 and 40% promoter activity, respectively, compared with the full-length promoter (Fig 4A) All these constructs exhibited > 300-fold promoter activity compared with pGL3-Basic Thus, 45 nucleotides (minimal promoter) from the 3¢-end of the DPP-III promoter retained 40% of the full-length promoter (pAAS-1) activity (320-fold over pGL3-Basic) Sequence analysis of the minimal promoter region ()40 ⁄ +5) revealed no obvious TATA or CAAT boxes However, two perfect Deletion analysis of human DPP-III promoter In order to define the minimal promoter region and identify the functional transcription factor binding motif(s) in this region of the DPP-III gene, a series of promoter–reporter constructs with varying lengths for the 5¢-region were generated The 5¢-ends of these constructs are marked ( ) in Fig These constructs were transfected into human glioblastoma cells (U87MG) followed by estimation of the luciferase activity The construct pAAS-2 ()781 ⁄ +5), which lacks first 252 bases from the 5¢-end of the full-length promoter, retained 92% of the promoter activity ( 740-fold promoter activity over pGL3-Basic vector) (Fig 4A) Further deletion of 548 or more bases B x816.25 800 x741.11 x824.23 x352.61 x312.07 x337.31 * * 300 * x319.48 * 200 100 x312.07 b 400 300 200 100 x4.22 –1033 pAAS–1 pAAS–8 –40 +5 Luc +5 Luc pAAS–7 –53 Luc +5 pAAS–6 –93 Luc +5 pAAS–5 –124 Luc +5 pAAS–4 –230 Luc +5 pAAS–3 –485 Luc +5 –781 pAAS–2 –1033 pAAS–1 +5 Luc 600 500 Luc * 400 –21 x390.93 pAAS–9 –124 * Luc x418.59 +5 500 a 800 700 pAAS–5 –124 600 900 Luc 700 +5 900 Luciferase activity (fold increase over pGL3-basic) Luciferase activity (fold increase over pGL3-basic) A Fig Functional analysis of deletion constructs of the human DPP-III gene (A) A series of DNA fragments were PCR amplified using fulllength promoter fragment as the template Seven fragments with different 5¢-ends (nucleotides )781, )485, )230, )124, )93, )53 and )40) and a common 3¢-end (nucleotide +5) were cloned upstream of the luciferase reporter gene in promoter-less plasmid pGL3-Basic to generate constructs pAAS-2, pAAS-3, pAAS-4, pAAS-5, pAAS–6, pAAS-7 and pAAS-8, respectively U87MG cells were transiently co-transfected with test plasmid and pRL-TK internal control plasmid Values significantly different from pAAS-1 are marked by * (B) A DNA fragment lacking 25 bases from the 3¢ end of pAAS-5 was amplified using DPP-III F-124 and DPP-III R-21 as the sense and antisense primers pAAS-1 was used as a template for the PCR The 99 bp amplified fragment was digested with XhoI and HindIII and cloned into the pGL3Basic to generate pAAS-9 ()124 ⁄ )21) U87MG cells were transiently transfected with pAAS-9 pAAS-1 and pAAS-5 were also transfected in separate experiments Luciferase activity in the cell lysates was measured 48 h after transfection Each transfection was performed in triplicate and the results are expressed as the mean ± SE of three independent experiments a Significantly higher compared with pAAS-9 (P < 0.001); b significantly higher compared with pAAS-9 (P < 0.001) Statistical analysis was performed using a paired two-tailed Student’s t-test 1864 FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al consensus Ets-1 ⁄ Elk-1 core binding motifs (GGAA GCAGGAA) separated by three bases were present in this region (at positions )6 and )13) To elucidate the role of these motifs, we deleted 25 bases from the 3¢end of the construct pAAS-5, thus generating pAAS-9 ()124 ⁄ )21) This construct, which lacked bases of exon and 20 bases of the promoter region, including Ets-1 ⁄ Elk-1-binding motifs, exhibited no promoter activity (Fig 4B) These results established that nucleotides between )20 and +5 are essential for DPP-III promoter activity Binding of transcription factors to the minimal promoter region (-40 ⁄ +5) Site-directed mutagenesis To further corroborate our results, we mutated these two Ets-1 ⁄ Elk-1 binding motifs sequentially in pAAS-1 using site-directed mutagenesis and assessed the promoter activities of the resulting constructs (Fig 5) pAAS-1Mut1 (harbouring a mutated Ets-1 ⁄ Elk-1 motif at position )6) and pAAS-1Mut2 (having Ets-1 ⁄ Elk-1 mutated motifs at both position )6 and position )13), were transfected in U87MG cells Mutations in the motif at )6 (pAAS-1Mut1) resulted in an 81% loss of basal promoter activity compared with the full-length x816.25 a To show the in vivo binding of Ets-1 and Elk-1 transcription factors with the human DPP-III minimal promoter region, we performed chromatin immunoprecipitation (ChIP) assays using Ets-1 and Elk-1 antibodies The immunoprecipitated chromatin was subjected to PCR using primers flanking the binding motifs present at positions )6 and )13 in the DPP-III promoter Amplification of a specific 81 bp DNA fragment was observed when the DNA was immunoprecipitated using Ets-1 or Elk-1 antibodies However, no amplification of any DNA fragment was evident when DNA was precipitated using mouse IgG (negative control) (Fig 6) The identity of the amplified products as part 800 od y tib an tib -1 an Elk nti 10 Et s-1 +A b 200 DL x152.48 300 nti 400 +A 500 od G 600 y 700 +A an nti m tib od ouse y Ig Luciferase activity fold increase over pGl3-basic 900 construct (pAAS-1) Whereas mutations in both Ets-1 ⁄ Elk-1-binding motifs (pAAS-1Mut2) resulted in a 96% loss of basal promoter activity compared with the full-length construct (pAAS-1, Fig 5) Abolition of the promoter activity confirmed that Ets-1 ⁄ Elk-1 binding motifs are essential for transcription of the human DPP-III gene Because mutation of the motif present at the )6 position alone resulted in an 81% loss of promoter activity, we conclude that Ets-1 ⁄ Elk-1-binding motifs are critical for DPP-III gene expression 200 bp x35.94 100 81 bp pAAS-1 pAAS-1 Mut1 pAAS-1 Mut2 Fig Functional relevance of Ets-1 ⁄ Elk-1-binding motifs in DPP-III promoter activity U87MG cells were transiently transfected with either wild-type promoter, construct pAAS-1 or promoter constructs containing one ()6; pAAS-1Mut1) or both ()6 and )13; pAAS1Mut2) mutated Ets-1 ⁄ Elk-1-binding motifs Luciferase activity was measured 48 h after transfection and is plotted in the left-hand panel Each transfection was performed in triplicate and the results are expressed as the mean ± SE of three independent experiments (a) Significantly higher compared with pAAS-1Mut1 (P < 0.001); (b) significantly higher compared with pAAS-1Mut2 (P < 0.001) Statistical analysis was performed using a paired twotailed Student’s t-test Fig In vivo analysis of binding of Ets-1 and Elk-1 to the DPP-III promoter by ChIP assay U87MG cells were fixed with 1% formaldehyde to cross-link the existing in vivo proteins–DNA complex Nuclei of the cross-linked cells were isolated and subjected to sonication to shear the DNA Anti-Ets-1 and anti-Ek-1 IgG were used to immunoprecipitate DNA bound to these proteins PCR was performed using DPP-III F-45 and ChIP R as the sense and antisense primers to specifically amplify 81 bp DPP-III promoter region including the Ets-1 ⁄ Elk-1-binding motifs present at positions )6 and )13 PCR using the same primers was also performed with DNA immunoprecipitated using mouse IgG as template and served as a negative control DL100 corresponds to a 100 bp DNA ladder and a single fragment of 200 bp is indicated by an arrow FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1865 Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al Table Sequence of double-stranded oligonucleotides used in the gel-shift assay The two Ets-1 ⁄ Elk-1-binding motifs present (positions )6 and )13 in the dipeptidyl-peptidase III promoter sequence) in the wild-type oligonucleotide (Ets-Wt; )18 ⁄ +5 with respect to transcription initiation site) are shown in bold Mutated nucleotides are shown in lowercase Probe – + + + Ets-Wt + + – – Ets-M1 – – + – Ets-M2 GAGCCGGAAGCAGGAAGTGAGTT GAGCCGGAAGCAGtAtGTGAGTT GAGCCGtAtGCAGtAtGTGAGTT Nuclear extract – – – + Sequence (5¢-3¢) Ets-Wt Ets-M1 Ets-M2 A Shift Shift of the DPP-III promoter was confirmed by DNA sequencing An electrophoretic mobility shift assay (EMSA) was performed to assess the specific binding of Ets-1 ⁄ Elk-1 to the DPP-III minimal promoter region EMSA was performed using nuclear extracts obtained from U87MG cells Nucleotide fragments (23 bp) harbouring wild-type ()18 ⁄ +5; Ets-Wt) or mutated (Ets-M1 and Ets-M2) Ets-1 ⁄ Elk-1 motifs were used as radiolabelled probes for this purpose (Table 1) Incubation of radiolabelled Ets-Wt with the nuclear extract resulted in the formation of two DNA–protein complexes which migrated more slowly than the free radiolabelled probe (Fig 7A,B; lanes 2) In the first complex (Fig 7A; shift 1), nuclear proteins showed strong binding to the probe compared with the second complex (Fig 7A; shift 2), which migrated more slowly than the first Formation of these complexes was abrogated in the presence of a 100 molar excess of unlabelled Ets-Wt (Fig 7B, lane 3) Incubation of either radiolabelled Ets-M1 or Ets-M2 with the nuclear lysate did not result in the formation of any such complex (Fig 7A; lanes and 4) Consistent with these results, in the presence of a 100 molar excess of unlabelled Ets-M2, no change in the binding of nuclear proteins to radiolabelled Ets-Wt was observed (Fig 7B; lane 4) Incubation of the mixture of radiolabelled probe and nuclear lysate with antibodies specific for Ets-1 ⁄ Elk-1 resulted in ‘supershifts’ of the complex (shift 1) (Fig 7B; lanes and 8) However, the formation of such complexes was not observed when antibodies were added to the nuclear lysate prior to addition of the labelled probe (Fig 7B; lanes and 7), Upregulation of DPP-III expression and promoter activity by v-Ha-ras Promoter deletion analysis, site-directed mutagenesis, EMSA and ChIP assays demonstrated that Ets-1 and Elk-1 play a critical role in the transcription of 1866 B Nuclear extract – + + + + + + + Radiolabeled Ets-Wt + + + + + + + + Unlabeled Ets-Wt – – + – – – – – Unlabeled Ets-M2 – – – + – – – – Ets-1 antibody – – – – +* + – – Elk-1 antibody – – – – – – +* + Shift Super shift Shift Fig Binding profile of nuclear proteins from U87MG cells to the 5¢-flanking region of the human DPP-III gene (A) Radiolabelled 23mer double-stranded wild-type (Ets-Wt) and mutated (Ets-M1 and Ets-M2) oligonucleotides were incubated with nuclear extracts (15 lg of protein) prepared from U87MG cells in the binding assay The DNA–protein complexes (black arrow) were resolved on a nondenaturing gel and subjected to autoradiography (B) The binding reactions were carried out in the absence or presence of a 100 molar excess of unlabelled wild-type or mutant double-stranded oligonucleotides In some of the reactions, lg of antibody against c-Ets-1 and pElk-1 were incubated with nuclear lysate before (lanes and 7) or after (lanes and 8) adding labelled probe The shifts produced are shown by black arrows and supershifted complexes are shown by white arrows FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al DPP-III gene Most Ets family proteins are nuclear targets for phosphorylation by the RAS ⁄ mitogenactivated protein kinase (MAPK) signalling pathway These nuclear phospho-proteins in turn influence cell proliferation, differentiation and oncogenic transformation Our laboratory has developed a human liver cell line (Chang liver) stably expressing v-Ha-ras (M Jain et al., unpublished results) These Chang liver ras (CLR) cells exhibited approximately twofold higher levels of pElk-1 (P £ 0.002) compared with cells stably transfected with the empty vector (Chang liver DRas; CLDR) (Fig 8A) Transfection of pAAS-1 in CLR and CLDR cells demonstrated a twofold higher luciferase activity in CLR cells compared with CLDR cells, (P < 0.001; Fig 8B) To demonstrate that the higher DPP-III promoter activity was because of increased levels of pElk-1 in v-Ha-ras-expressing cells (CLR), we treated CLR and CLDR cells with mitogen-activated protein kinase kinase ⁄ extracellular regulated kinase (MEK ⁄ ERK) inhibitor U0126 (Sigma-Aldrich, Urbana, IL, USA) Immunoblot analysis using antibodies specific for pERK confirmed a significant reduction in the levels of its phosphorylated form (P £ 0.02; Fig 8D,E) Similarly, levels of pElk-1 were found to be decreased in U0126-treated CLR cells compared with untreated cells (P £ 0.003) However, CLDR cells did not exhibit any significant difference in pElk-1 levels on treatment with the inhibitor (Fig 8F,G) Our efforts to compare the levels of pEts-1 failed because the antibody did not work in western blots The effect of inhibition of the MAPK pathway by the U0126 inhibitor and the concomitant influence of pElk-1 levels on transcription of the DPP-III gene was assessed In this regard, mRNA levels specific for the DPP-III gene were estimated in both cell lines before and after treatment with inhibitor We observed that expression of DPP-III mRNA in CLR cells was twofold higher than in CLDR cells (P £ 0.002) Treatment of CLR cells with U0126 decreased the DPP-III mRNA level by threefold (P £ 0.03), although there was no significant effect on DPP-III mRNA levels in treated CLDR cells (Fig 8H) Thus we conclude that upregulation of DPP-III expression by v-Ha-ras is mediated by increased Elk-1 phosphorylation Induction of DPP-III promoter activity by Ets-1 It is evident from the results presented in Fig that the DPP-III promoter exhibits minimal activity in human cell lines like Panc1 and Chang liver Therefore, to further establish the role of Ets-1 in the transcription of DPP-III, we co-transfected Chang liver cells with DPP-III promoter–reporter construct containing wild- type (pAAS-1) or mutant (pAAS-1Mut2) Ets-1 ⁄ Elk-1binding motifs with the Ets-1 expression vector (pEts-1) in a molar ratio of : Simultaneously, pAAS-1 and pAAS-1Mut2 were also co-transfected along with empty Ets-1 expression vector (pcDNA3.1) and luciferase activity was assayed in all transfected cells Co-transfection of pAAS-1 with pEts-1 resulted in a significant (P = 0.03) increase in promoter activity compared with co-transfection with empty vector (Fig 9) However, no such difference in promoter activity was observed when pAAS-1Mut2 was co-transfected with pEts-1 or empty vector (Fig 9) These results clearly establish that over-expression of Ets-1 induces the DPP-III promoter activity Discussion Human DPP-III, a metalloaminopeptidase, purified and characterized from a number of tissues, has been implicated in several physiological and pathological processes To understand the regulation of its expression, the promoter of this peptidase has been cloned and characterized for the first time in this study We amplified a 1038 bp genomic fragment located upstream of the previously published DPP-III transcript (accession number NM_005700) This fragment exhibited maximal promoter activity in human glioblastoma cells compared with other human and murine cells, as assessed by luciferase reporter assays (Fig 2) These results are in agreement with the high DPP-III activity reported in brain homogenates of rat, monkey and guinea pig [5,7,16] The presence of DPP-III in the central nervous system facilitates the degradation of angiotensins and encephalin, suggesting its role in blood pressure regulation and in pain modulation [5] Analysis of the amplified fragment (DPP-III promoter) revealed the absence of a consensus TATA box, a high GC content (63.16%), and the presence of multiple binding motifs for Sp1, suggesting that the human DPP-III gene is a housekeeping gene (Fig 1) [17–19] This is corroborated by reports demonstrating its expression in a wide range of tissues from different animal species [5,9,11,20] Our results demonstrate increased DPP-III promoter activity in v-Ha-ras transformed cells Consistent with these results, TATA-less promoters of human lysosomal cysteine cathepsins are also upregulated by malignant transformation [21] Most of the TATA-less promoters are known to initiate transcription from multiple sites However, TATA-less promoters with multiple GC boxes have been shown to initiate transcription from a single site, as in the case of nerve growth factor receptor [22], the cellular retinol-binding protein [23], endothelial nitric FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1867 Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A CLR A A Shukla et al B CLΔR 16 a pELK-1 arbitrary units (× 104) 14 pELK-1 CLR CLΔR 12 10 CLR α-Tubulin Luciferase activity fold increase over pGl3-basic C 250 D x190.35 200 CLΔR Tr CLR a Tr CLΔR Untr CLΔR Untr CLR 150 pElk x102.28 100 α-Tubulin 50 E CLΔR 180 pELK arbitrary units (× 102) CLR 160 F Untr CLR Tr CLR Untr CLΔR Tr CLΔR 140 120 pElk 100 80 α-Tubulin 60 40 20 Untr Tr CLR CLΔR H 35 Relative abundance of DPPIII mRNA G Untr Tr pELK arbitrary units (× 104) 30 25 20 15 10 Untr Tr CLR 1868 Untr Tr CLΔR 1.2 a,b,c 0.8 0.6 0.4 0.2 Untr Tr CLR Untr Tr CLΔR FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al Luciferase activity fold increase over pGl3-basic 250 x185.51 a 200 150 100 x94.07 50 x7.52 x6.30 Fig Overexpression of pEts-1 results in increased DPP-IIII promoter activity in human liver cells DPP-III promoter–reporter construct harbouring wild-type (pAAS1) or mutant (pAAS1Mut2) Ets-binding motifs were co-transfected with Ets-1 expression vector (pEts-1) or empty vector (pcDNA3.1) at a molar ratio of : in Chang liver cells Forty-eight hours post transfection, cells were lysed and luciferase activity was assayed Values are the mean ± SE of four independent experiments performed in triplicate Results were statistically analysed using the Student’s t-test and luciferase activity significantly different from the promoter–reporter construct transfected with empty vector is denoted by ‘a’ oxide [24] and genes coding for DPP-I [18] Similarly, we observed a single transcriptional start site located 33 nucleotides upstream of the translation initiation codon for DPP-III in U87MG cells (Fig 1) Analysis of the DPP-III promoter sequence revealed the presence of an initiator element (Inr)-like sequence surrounding the transcription initiation site and two A ⁄ T-rich sequences at positions )29 and )24 (Fig 1) The A ⁄ T content of the )30 sequence in an Inrcontaining synthetic promoter has been shown to have a profound positive influence on the strength of the promoter, despite having minimal resemblance to the TATA consensus sequence [25,26] The stretch of DNA between the Inr sequence and the A ⁄ T-rich region in the DPP-III promoter contains a GC box (Sp1-binding motif) and two Ets-1 ⁄ Elk-1-binding motifs Both of these transcription factors are known to help in recruitment of the transcription initiation assembly [27–29] and therefore this arrangement of nucleotides in the DPP-III promoter is probably responsible for the strong promoter activity of DPP-III in U87MG cells Deletion analysis of the DPP-III promoter revealed that the region between )781 and )485 bp contains several transcription factor binding motifs such as USF, C ⁄ EBP and Sp1 (Fig 1), and removal of this region results in a 40% decrease in promoter activity Fig Elevation of DPP-III mRNA, promoter activity and pElk-1 levels by H-ras in human liver cells (A) An equal amount of total protein from Chang liver cells expressing v-Ha-ras (CLR) and control cells (CLDR) was resolved on SDS ⁄ PAGE and subjected to western blotting using mAb raised against phosphorylated form of Elk-1 (pElk-1) protein or a-tubulin (B) The individual pELK-1 bands of the blots given in (A) have been quantitated densitometrically and normalized with the a-tubulin levels Values are the mean ± SE of three independent experiments Results were statistically analysed using the Student’s t-test Values significantly different from CLDR cells are denoted by ‘a’ (C) To measure DPP-III promoter activity, CLR and CLDR cells were transiently transfected with DPP-III full-length promoter construct (pAAS-1) and luciferase activity was measured 48 h post transfection Other details are given in Material and methods Values are the mean ± SE of at least three independent experiments a Significantly higher compared with CLDR (P < 0.05) (D) Equal amounts of total protein from Chang liver cells expressing v-Ha-ras (CLR) and control cells (CLDR) treated with either dimethylsulfoxide or U0126 were resolved on SDS ⁄ PAGE and subjected to western blotting using an antibody raised against the phosphorylated form of Erk-1 or a-tubulin protein (E) Densitometric quantitation of the phosphorylated form of Erk-1 The bands of the blot given in (D) were subjected to densitometry and the values obtained were normalized with the levels of a-tubulin Values are the mean ± SE of three independent experiments Results were statistically analysed using the Student’s t-test Values significantly different from CLDR cells are denoted by ‘a’ (F) Equal amount of total protein from Chang liver cells expressing v-Ha-ras (CLR) and control cells (CLDR) treated with either dimethylsulfoxide or U0126 were resolved on SDS ⁄ PAGE and subjected to western blotting using an antibody raised against the phosphorylated form of Elk-1 or a-tubulin protein (G) Densitometric quantitation of phosphorylated form of Elk-1 Bands of the blot given in (F) were subjected to densitometry and the values obtained normalized with the levels of a-tubulin Values are the mean ± SE of three independent experiments Results were statistically analysed using the Student’s t-test Values significantly different from CLDR cells are denoted by ‘a’ (H) An equal amount of total RNA from CLR and CLDR cells before and after treating cells with either U0126 (10 lgỈmL)1) or dimethylsulfoxide was reverse transcribed and subjected to real time PCR using DPP-III (DPP F20 and AAS1) and b-actin (b-actin-F and b-actin-R) specific primers The DPP-III mRNA levels were calculated using b-actin as the internal control Cycle threshold (Ct) values were calculated for each PCR and relative fold change was calculated using 2)DD Ct method [16] Each set of observations was compared with the other set using a paired two-tailed t-test, assuming unequal variances among the sample means A P-value of £ 0.05 was considered statistically significant a Significantly higher compared with Chang liver Ras treated (P < 0.05), b significantly higher compared with Chang liver DRas untreated (P < 0.05), c significantly higher as compared to Chang liver DRas untreated (P < 0.05) FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1869 Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al (Fig 4A) These results suggest that some or all of these motifs are important for DPP-III transcription This analysis also suggested that the 25 nucleotides at the 3¢-end of the DPP-III promoter are essential for its activity (Fig 4B) Nucleotide sequence analysis of this region revealed the presence of two Ets-1 ⁄ Elk-1-binding motifs (GGAAGCAGGAA) at positions )6 and )13 EMSA and ChIP assays established the binding of the transcription factor(s) to these motifs Ets-1 has been shown to positively regulate urokinase plasminogen activator (uPA) expression in breast cancer, glioma, astrocytoma and meningioma cells [30,31] Similarly, Ets transcription factor(s) regulate the expression of several other human genes such as stromelysin [32], prolactin and growth hormone [33] and chemokine [34] Mutations in the Ets-1 ⁄ Elk-1binding motifs abolished promoter activity (Fig 5) This was in agreement with the EMSA results using the 23 bp DNA fragment, wherein no shift in mobility was observed, (Fig 7) These results led us to conclude that the mutations which abolish the binding of Ets-1 and Elk-1 to DPP-III promoter result in a concomitant loss of promoter activity Several studies have demonstrated that Ets-binding motifs when present in a pair and in close proximity with each other, induce gene expression to a higher level [35–37] Consistent with these reports, the DPP-III promoter containing two Ets-binding motifs (at positions )6 and )13) separated by three nucleotides exhibits robust activity (800-fold over pGL3Basic) in U87MG cells (Fig 2) Mutagenesis of just one of these motifs ()6 position) resulted in a > 80% decrease in promoter activity, suggesting that both motifs are essential for strong promoter activity (Fig 5) The cooperative binding of Ets proteins as a homodimer or a heterodimer to form a ternary complex with the promoter region of several genes has been demonstrated [32,36] Stromelysin-1 promoter is transactivated by a homo-dimer of Ets-1 through head-to-head Ets-binding sites [36] The DPP-III promoter contains two Ets-binding motifs arranged in a head-to-tail orientation within the first 25 bp upstream of the transcription start site However, Ets-1 binds as a homodimer when the two motifs are present in a head-to-head orientation [36] In supershift assays, the mobility of the DNA–protein complex was further shifted to a similar extent by both Ets-1 and Elk-1 antibodies (Fig 7B), suggesting the binding of both these transcription factors to their cognate motifs in this region The formation of two DNA–protein complexes also suggests that both these transcription factors bind individually, as well as in the form of a heterodimer to the DPP-III promoter 1870 The N-terminal domain of Ets-1 is involved in the formation of a complex with other proteins, whereas its C-terminal domain is involved in DNA binding [38] By contrast, the DNA-binding domain of Elk-1 is present at its N- terminal end and C-termini allows it to form homo- or heterodimers In our supershift experiments, we used an antibody against Ets-1 raised against its N-terminal region and an antibody against Elk-1 raised against phosphorylated Ser383 present at the C-terminus of this protein Preincubation of nuclear proteins with antibodies completely abolished the formation of shift (Fig 7B; lanes and 7) This result suggests that shift was created by binding a heterodimer of Ets-1 and Elk-1 to the probe, and the N-terminus of Ets-1 and the C-terminus of Elk-1 were involved in the formation of the heterodimer Preincubation of nuclear proteins with antibodies against Ets-1 or Elk-1 prevented the formation of any such complex, confirming the binding of a heterodimer of Ets-1 and Elk-1 to the probe Likewise, incubation of antibodies with the DNA–protein complexes did not produce any supershift of shift because the N-terminus of Ets-1 and the C-terminus of Elk-1 were involved in the formation of the heterodimer and were not therefore available for binding to their respective antibodies However, these antibodies allowed us to identify binding of both Ets-1 and Elk-1 separately, as well as in the form of a complex to the DPP-III promoter The slower moving complex (Fig 7A, shift 2) showed strong binding of nuclear proteins to the probe only when antibodies were added after incubation of probe with the nuclear proteins (Fig 7B, lanes and 8) suggesting stabilization of the DNA–protein complex From these results it is apparent that Ets-1 and Elk-1 are involved in the formation of a ternary complex with the DPP-III promoter and in regulating its expression In addition, Ras has been shown to mediate the phosphorylation of Ets proteins thereby increasing their transactivation ability [39,40] In this regard, we observed significantly higher mRNA expression and promoter activity of DPP-III associated with elevated levels of phosphorylated Elk-1 in CLR cells This further reiterates the role of Ets proteins in DPP-III expression Finally, co-transfection of Ets-1 expression vector (pEts-1) with promoter–reporter construct harbouring wild-type (pAAS-1), but not mutated (pAAS-1Mut2), Ets-1 ⁄ Elk-1-binding motifs exhibited a significant increase in promoter in Chang liver cells (Fig 9) These results confirm that Ets-1 is necessary for DPP-III transcription and convincingly demonstrate the critical role of Ets-1 ⁄ Elk-1 in the expression of this peptidase FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al Materials and methods Cell culture Human glioblastoma (U87MG), ovarian carcinoma (Caov-2), pancreatic carcinoma (Panc1) and mouse fibroblast (NIH 3T3) cells (obtained from National Centre for Cell Science, Pune, India) were grown in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, St Louis, MO, USA) containing high glucose (4.5 gỈL)1 at 25 mm) and supplemented with 20 lgỈmL)1 ciprofloxacin and 10% fetal bovine serum (Gibco Life Technologies, Karlsruhe, Germany) in a humidified atmosphere containing 5% CO2 at 37 °C Chang liver cells, and stably v-Ha-ras-transfected Chang liver cells, were cultured under identical conditions in minimum essential medium containing 500 lgỈmL)1 G418 (Sigma-Aldrich) Antibodies Antibodies against human Ets-1 (sc-111) and human pElk-1 (sc-8406) were purchased from Santa Cruz Biotechnologies (Santa Cruz, CA, USA) Transfection For all transfections, 106 cells were plated in each well of a six-well plate day prior to transfection Next day, cells were washed twice with serum-free medium before transfecting with lg of control or test plasmid DNA using TransfastÔ (Promega), according to the manufacturer’s protocol After 48 h, transfectants were washed three times with ice cold NaCl ⁄ Pi, lysed and the luciferase activity in the cell lysates measured using a dual-luciferase reporter assay system (Promega, Madison, WI, USA) The pRL-TK vector containing the Renilla luciferase gene under HSV TK promoter (Promega) were co-transfected with each construct and served as an internal control for normalization for the transfection efficiency and cell number Treatment of cells with the MEK inhibitor U0126 MEK inhibitor U0126, (Promega) was dissolved in dimethylsulfoxide leading to a 50 mm U0126 stock solution Cells were serum starved for 24 h before treatment For the experiments, U0126 was used at a concentration of 10 lgỈmL)1 in medium In parallel, control cells were treated with dimethylsulfoxide alone in the respective concentration Amplification and cloning of the 5¢ upstream region of the human DPP-III gene Mapping of the transcription initiation site To amplify the upstream region of the DPP-III gene, HpaIand NheI-digested total human genomic DNA was used as a template and three rounds of PCR were performed using primers designed based on human genome sequence (accession number NT_033903.7) For primary PCR, a sense primer DPP-III F1 (5¢-TCCTAAGGACACCGACCAAC3¢, Fig 1) from the upstream region and an antisense primer DPP-III R1 (5¢-CAGAAAGGGAA-CGATTTTGC-3¢; Fig 1) from the first intron were used The product of the primary PCR was diluted 100-fold and lL of it was subjected to secondary PCR amplification using DPP-III F2 (5¢-AGCCTCGAGACCGTGCGGGATTTCA-3¢; Fig 1) and DPP-III R2 (5¢-AGTATGGATTCGCCTTGGTC-3¢; Fig 1) as nested sense and antisense primers, respectively Similarly, a 1.0 lL aliquot of 100-fold diluted secondary PCR products was subjected to a third round of PCR using DPP-III F2 and DPP-III R3 (5¢- CCCAAGCTTAACT CACTTCCTGCTTC-3¢; Fig 1) as the sense and antisense primers, respectively The amplified fragment was subjected to double-strand DNA sequencing followed by cloning into the promoter-less reporter vector pGL3-Basic (Promega, Madison, WI, USA) upstream of the luciferase reporter gene XhoI and HindIII restriction sites (shown in bold) were incorporated in DPP-III F2 and DPP-III R3, respectively, to facilitate the cloning of the amplified fragment The resulting construct was named as pAAS-1 and further used for generation of deletion and mutated constructs The transcription initiation site of the human DPP-III gene was mapped using a 5¢-RACE kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s protocol For this purpose, 3–4 lg of total RNA isolated from U87MG cells was reverse transcribed by avian myeloblastosis virus-reverse transcriptase using an antisense DPP-IIIspecific primer AAS-2 (5¢-CTGAGCAGAGCATAGATG TAG-3¢; Fig 1) A poly(A) tail was added to the 3¢-end of the purified cDNA with the help of terminal transferase The deoxyribosyladenosine-tailed cDNA thus obtained was used as a template for PCR using an oligo(dT) anchor primer provided with the kit and an antisense DPP-III specific primer AAS-2 Another round of PCR was performed using 10-fold diluted products of primary PCR as the template and the PCR anchor primer supplied with the kit and a gene-specific primer AAS-1 (5¢-GACAGGTGG TAGGCATAGAG-3¢; Fig 1) The RACE products were cloned into pGEM-TEasy (Promega) and sequenced Generation of promoter deletion constructs Various 5¢ promoter deletion constructs were generated by PCR using wild-type full-length DPP-III promoter–reporter construct ()1033 ⁄ + 5; pAAS-1) as the template and a common antisense primer DPP-III R3 However, different sense primers were used for each deletion construct The PCR FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1871 Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al fragments were cloned upstream of the lucifersae reporter gene in HindIII- and XhoI-digested pGL3-Basic vector These sites were introduced in antisense and all-sense primers, respectively to facilitate the process of cloning and have been shown in bold The sense primers used for the different constructs were DPP-III F-786: 5¢-CCCCTCGAGCCGTC CAGACCTGTAAAAG-3¢ ()781 ⁄ +5; pAAS-2), DPP-III F-490: 5¢-CACCTCGAGCTTTGCAACTTCCAAG-3¢ ()485 ⁄ +5; pAAS-3), DPP-III F-129: 5¢-CGACTCGAGAAG CTCGTCTTGG-3¢ ()124 ⁄ +5; pAAS-5), DPP-III F-98: 5¢-GGCTCGAGCTGACGCCCATCC-3¢ ()93 ⁄ +5; pAAS–6), DPP-III F-58: 5¢-GTTCTCGAGGGGGGGCGGGGTT-3¢ ()53 ⁄ +5; pAAS-7), DPP-III F-45: 5¢-GCGCTCGAGGCA GAGCCCCAAT-3¢ ()40 ⁄ +5; pAAS-8) However, to generate the construct pAAS-9 ()124 ⁄ )21) lacking 25 bases from the 3¢-end and 909 bases from 5¢-end of the promoter, the sense and antisense primers used were DPP-III F-129 and DPP-III R-21: 5¢-CCGAAGCTTCCATTCATTGGGG-3¢ Promoter–reporter construct pAAS-4 ()230 ⁄ +5) was generated by excision of the ()1033 ⁄ +5) fragment from pAAS-1 by digesting with KpnI followed by religating the larger fragment All constructs were subjected to double-stranded DNA sequencing to rule out the inadvertent induction of mutation(s) by PCR Site-directed mutagenesis Oligonucleotide-mediated mutagenesis was employed to introduce mutations into the Ets-1- and Elk-1-binding motifs present at positions )6 and )13 in the DPP-III promoter PCR was performed using pAAS-1 as a template, DPP-IIIF2 as the sense primer and DPP-III R3M1 (5¢-CCCAAGCTTAACTCACaTaCTGCTTC-3¢) as the antisense primer to mutate the Ets-1 ⁄ Elk-1-binding motif present at position )6 However, for mutagenesis of the Ets-1 ⁄ Elk-1 motifs present at both the )6 and )13 positions, PCR was performed using same the sense primer and DPPIII R3M2 (5¢-CCCAAGCTTAACTCACaTaCTGCTTaCG3¢) as the antisense primer The nucleotides changed to mutate the Ets-1 ⁄ Elk-1-binding motifs are shown in lower case The amplified fragments were cloned and sequenced Preparation of nuclear extract U87MG cells were grown in flasks until they were  80% confluent Cells were harvested and washed twice in NaCl ⁄ Pi A pellet of · 107 cells was resuspended in 200 lL of sucrose buffer (320 mm sucrose, 10 mm Tris pH 8, mm MgCl2, mm Mg-acetate, 0.1 mm EDTA, 0.5% NP-40, mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride and 10 mm NaF) and incubated on ice for 10 min, followed by centrifugation for at 500 g The pellet was washed with sucrose buffer (without NP-40) and resuspended in 60 lL of low-salt buffer (20 mm Hepes ⁄ KOH pH 7.9, 1.5 mm MgCl2, 40 mm KCl, 0.2 mm 1872 EDTA, 25% glycerol, 0.5 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride, 10 mm NaF and protease inhibitor cocktail; Sigma-Aldrich, St Louis, IL, USA) High-salt buffer (20 mm Hepes ⁄ KOH pH 7.9, 1.5 mm MgCl2, 800 mm KCl, 0.2 mm EDTA, 25% glycerol, 1% NP-40, 0.5 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride, 10 mm NaF and protease inhibitor cocktail) was added slowly in very small aliquots, while mixing with a pipette tip, followed by incubation on ice with intermittent shaking After 45 min, the lysate was centrifuged at 14 000 g for 15 All the steps were carried out at °C The supernatant was removed and stored at )70 °C in small aliquots, following protein estimation using the Bradford method [41] ChIP assays ChIP assays were performed using ImprintÔ Chromatin Immunoprecipitation Kit (Sigma-Aldrich) according to the manufacturer’s protocol Two micrograms of antibody, diluted in 100 lL antibody buffer was incubated for 90 in the strip wells provided in the kit Simultaneously, · 106 U87MG cells were treated with 1% formaldehyde for 10 at 25 °C to cross-link the existing DNA–protein complex(s) After treating with glycine (125 mm) to quench cross-linking, cells were processed for the isolation of nuclei The nuclear pellet was resuspended in the shearing buffer provided in the kit and subjected to sonication using a Misonix sonicator at a power setting of 1.5 and a 100% duty cycle; the extracts were sonicated for three 10 s pulses, with on ice between pulses Sheared chromatin was separated from the cell debris by centrifugation at 14 000 g for 10 at °C The supernatant was incubated in wells precoated with the antibodies for 90 The immunoprecipitated DNA was recovered and used as a template for PCR with DPP-III F-45 and ChIPR (5¢-CCG CGCCTCACCTGCAGCA-3¢; Fig 1) as the sense and antisense primers The products were resolved on agarose gel, purified and sequenced EMSA Twenty-three base pair radiolabelled double-stranded fragments (from position )18 to +5 with respect to transcription initiation site mapped) containing wild-type or mutated Ets-1 ⁄ Elk-1-binding motifs were end-labelled with [32P]ATP[cP] and T4 polynucleotide kinase The unincorporated [32P]ATP[cP] was removed by Sephadex G25 column chromatography Gel-shift assays were performed using Promega’s Gel Shift Assay System according to the manufacturer’s protocol Binding reactions were carried out at room temperature for 30 using 15 lg of U87MG nuclear lysate and 0.035 pmol of radiolabelled probe in buffer containing 2% glycerol, 0.5 mm MgCl2, 0.25 mm EDTA, 0.25 mm dithiothreitol, 25 mm NaCl, mm FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al Tris ⁄ HCl pH 7.5 and 0.025 mgỈmL)1 poly(dI-dC)Ỉ(dI-dC) A 100 m excess of unlabelled wild-type or mutated probe was added to the binding reactions for specific and nonspecific competitive assays For supershift assays lg of the specific antibody against Ets-1 and ⁄ or pElk-1 was added to the binding reactions, followed by incubation for h at room temperature Protein–DNA complexes were resolved on 5% nondenaturing PAGE in 0.5 · TBE buffer and visualized by autoradiography other set using a paired two-tailed t-test, assuming unequal variances among the sample means A P-value of £ 0.05 was considered to be statistically significant Statistical analysis The results of the present study were analysed by Student’s t-test Acknowledgements Western blotting Equal numbers of Chang liver cells stably transfected with v-Ha-ras expression vector (CLR) or empty vector (CLDR) were washed twice with ice cold NaCl ⁄ Pi and lysed in RIPA buffer (50 mm Tris ⁄ HCl pH 7.5, mm EDTA pH 8.0, 1% NP-40, 150 mm NaCl, 10 mm MgCl2, 10 mm NaF, lgỈmL)1 protease inhibitor cocktail) Cell lysates containing equal amounts of total protein ( 80 lg) were resolved on 12% denaturing SDS ⁄ PAGE and transferred on to a 0.45 lm (pore size) nitrocellulose membrane (mdi, Ambala Cantt, India) The blots were incubated with anti-pElk-1 IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and a-tubulin (Sigma, Sigma-Aldrich) followed by incubation with alkaline phosphatase-conjugated antirabbit IgG (Santa Cruz Biotechnology) Proteins bands were visualized using premixed 5-bromo-4-chloroindol-2-yl phosphate ⁄ Nitro Blue tetrazolium solution (Sigma-Aldrich) Real-time PCR Total RNA ( lg) was reverse-transcribed using M-MuLV RT (MBI Fermentas, Vilnius, Lithuania) and random hexamers according to the manufacturer’s protocol An aliquot containing 200 ng of the total cDNA was subjected to PCR using DPP-III F-20 (5¢-GCAGGAAGTGA GTTTCGAAC-3¢) and AAS1 as sense and antisense primers on a Bio-Rad I-cycler (Bio-Rad, Hercules, CA, USA) PCR was carried out in a final volume of 25 lL containing 1.5 mm MgCl2, 20 lm of each primer, 0.2 mm dNTP mix, U Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), · PCR buffer (Invitrogen) and · SYBER green (Invitrogen) The PCR conditions comprised of 40 cycles of denaturation 94 °C for 30 s, annealing at 59 °C for 45 s, extension at 72 °C for and fluorescence recording at 80 °C for 30 s Similarly b-actin cDNA was also amplified using primers b-actin F (sense) (5¢-AGAAAATCTGGC ACCACACC-3¢) and b-actin R (antisense) (5¢-TAGCACAGCCTGGATAGCAA-3¢), and served as the internal control Melting-curve analysis was performed to confirm primer–dimer formation for human DPP-III or b-actin cDNAs under the above mentioned conditions Cycle threshold (Ct) values were calculated for each PCR and relative fold change was calculated using 2)DDCt method [42] Each set of observation was compared to the We are thankful to Professor H K Prasad for critically reading the manuscript The Ets-1 expression vector was a kind gift from Professor U Pati, School of Biotechnology, JNU, New Delhi This work was supported by a research grant [N1004] from Defence Research Development Organization (DRDO), Government of India to SSC AAS and MJ are recipients of junior and senior research fellowships from Council of Scientific and Industrial Research, Government of India, and University Grants Commission, New Delhi, respectively References Hopsu-Havu VK, Jansen CT & Jarvinen M (1970) Partial purification and characterization of an alkaline dipeptide naphthylamidase (Arg–Arg–NAase) of the rat skin Arch Klin Exp Dermatol 236, 267–281 de Bersaques J (1972) Peptidases and naphthylamidases in human skin Influence of buffers, EDTA and metals on dipeptide arylamidase Enzymologia 43, 253–259 Swanson AA, Davis RM & McDonald JK (1984) Dipeptidyl peptidase III of human cataractous lenses Partial purification Curr Eye Res 3, 287–291 Abramic M, Zubanovic M & Vitale L (1988) Dipeptidyl peptidase III from human erythrocytes Biol Chem Hoppe Seyler 369, 29–38 Lee CM & Snyder SH (1982) Dipeptidyl-aminopeptidase III of rat brain Selective affinity for enkephalin and angiotensin J Biol Chem 257, 12043–12050 Nishikiori T, Kawahara F, Naganawa H, Muraoka Y, Aoyagi T & Umezawa H (1984) Production of acetyl-lleucyl-l-argininal, inhibitor of dipeptidyl aminopeptidase III by bacteria J Antibiot (Tokyo) 37, 680–681 Hazato T, Inagaki-Shimamura M, Katayama T & Yamamoto T (1982) Separation and characterization of a dipeptidyl aminopeptidase that degrades enkephalins from monkey brain Biochem Biophys Res Commun 105, 470–475 Shimamori Y, Watanabe Y & Fujimoto Y (1986) Purification and characterization of dipeptidyl aminopeptidase III from human placenta Chem Pharm Bull (Tokyo) 34, 3333–3340 FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1873 Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al Hashimoto J, Yamamoto Y, Kurosawa H, Nishimura K & Hazato T (2000) Identification of dipeptidyl peptidase III in human neutrophils Biochem Biophys Res Commun 273, 393–397 10 Watanabe Y, Kumagai Y & Fujimoto Y (1990) Presence of a dipeptidyl aminopeptidase III in Saccharomyces cerevisiae Chem Pharm Bull (Tokyo) 38, 246–248 11 Mazzocco C, Fukasawa KM, Auguste P & Puiroux J (2003) Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster Eur J Biochem 270, 3074–3082 12 Baral PK, Jajcanin-Jozic N, Deller S, Macheroux P, Abramic M & Gruber K (2008) The first structure of dipeptidyl-peptidase III provides insight into the catalytic mechanism and mode of substrate binding J Biol Chem 283, 22316–22324 13 Abramic M, Schleuder D, Dolovcak L, Schroder W, Strupat K, Sagi D, Peter-Katalini J & Vitale L (2000) Human and rat dipeptidyl peptidase III: biochemical and mass spectrometric arguments for similarities and differences Biol Chem 381, 1233–1243 14 Sato H, Kimura K, Yamamoto Y & Hazato T (2003) Activity of DPP-III in human cerebrospinal fluid derived from patients with pain Masui 52, 257–263 15 Simaga S, Babic D, Osmak M, Sprem M & Abramic M (2003) Tumor cytosol dipeptidyl peptidase III activity is increased with histological aggressiveness of ovarian primary carcinomas Gynecol Oncol 91, 194–200 16 Smyth M & O’Cuinn G (1994) Dipeptidyl aminopeptidase activities of guinea-pig brain Int J Biochem 26, 913–921 17 Zhu J, He F, Hu S & Yu J (2008) On the nature of human housekeeping genes Trends Genet 24, 481–484 18 Rao NV, Rao GV & Hoidal JR (1997) Human dipeptidyl-peptidase I Gene characterization, localization, and expression J Biol Chem 272, 10260–10265 19 Bohm SK, Gum JR Jr, Erickson RH, Hicks JW & Kim YS (1995) Human dipeptidyl peptidase IV gene promoter: tissue-specific regulation from a TATA-less GC-rich sequence characteristic of a housekeeping gene promoter Biochem J 311(Pt 3), 835–843 20 Ellis S & Nuenke JM (1967) Dipeptidyl arylamidase III of the pituitary Purification and characterization J Biol Chem 242, 4623–4629 21 Mohamed MM & Sloane BF (2006) Cysteine cathepsins: multifunctional enzymes in cancer Nat Rev Cancer 10, 764–775 22 Sehgal A, Patil N & Chao M (1988) A constitutive promoter directs expression of the nerve growth factor receptor gene Mol Cell Biol 8, 3160–3167 23 Nilsson MH, Spurr NK, Lundvall J, Rask L & Peterson PA (1988) Human cellular retinol-binding 1874 24 25 26 27 28 29 30 31 32 33 34 protein gene organization and chromosomal location Eur J Biochem 173, 35–44 Karantzoulis-Fegaras F, Antoniou H, Lai SL, Kulkarni G, D’Abreo C, Wong GK, Miller TL, Chan Y, Atkins J, Wang Y et al (1999) Characterization of the human endothelial nitric-oxide synthase promoter J Biol Chem 274, 3076–3093 Zenzie-Gregory B, O’Shea-Greenfield A & Smale ST (1992) Similar mechanisms for transcription initiation mediated through a TATA box or an initiator element J Biol Chem 267, 2823–2830 Hoopes BC, LeBlanc JF & Hawley DK (1992) Kinetic analysis of yeast TFIID–TATA box complex formation suggests a multi-step pathway J Biol Chem 267, 11539– 11547 Carcamo J, Buckbinder L & Reinberg D (1991) The initiator directs the assembly of a transcription factor IIDdependent transcription complex Proc Natl Acad Sci USA 88, 8052–8056 Yoo W, Martin ME & Folk WR (1991) PEA1 and PEA3 enhancer elements are primary components of the polyomavirus late transcription initiator element J Virol 65, 5391–5400 Hagemeier C, Bannister AJ, Cook A & Kouzarides T (1993) The activation domain of transcription factor PU.1 binds the retinoblastoma (RB) protein and the transcription factor TFIID in vitro: RB shows sequence similarity to TFIID and TFIIB Proc Natl Acad Sci USA 90, 1580–1584 Kitange G, Shibata S, Tokunaga Y, Yagi N, Yasunaga A, Kishikawa M & Naito S (1999) Ets-1 transcription factor-mediated urokinase-type plasminogen activator expression and invasion in glioma cells stimulated by serum and basic fibroblast growth factors Lab Invest 79, 407–416 Kitange G, Tsunoda K, Anda T, Nakamura S, Yasunaga A, Naito S & Shibata S (2000) Immunohistochemical expression of Ets-1 transcription factor and the urokinase-type plasminogen activator is correlated with the malignant and invasive potential in meningiomas Cancer 89, 2292–2300 Jayaraman G, Srinivas R, Duggan C, Ferreira E, Swaminathan S, Somasundaram K, Williams J, Hauser C, Kurkinen M, Dhar R et al (1999) p300 ⁄ cAMPresponsive element-binding protein interactions with ets-1 and ets-2 in the transcriptional activation of the human stromelysin promoter J Biol Chem 274, 17342–17352 Bradford AP, Brodsky KS, Diamond SE, Kuhn LC, Liu Y & Gutierrez-Hartmann A (2000) The Pit-1 homeodomain and beta-domain interact with Ets-1 and modulate synergistic activation of the rat prolactin promoter J Biol Chem 275, 3100–3106 Li QJ, Vaingankar S, Sladek FM & Martins-Green M (2000) Novel nuclear target for thrombin: activation of FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS Ets-1 ⁄ Elk-1 key regulators of DPP-III transcription A A Shukla et al 35 36 37 38 the Elk1 transcription factor leads to chemokine gene expression Blood 96, 3696–3706 Brown TA & McKnight SL (1992) Specificities of protein–protein and protein–DNA interaction of GABP alpha and two newly defined ets-related proteins Genes Dev 6, 2502–2512 Baillat D, Begue A, Stehelin D & Aumercier M (2002) ETS-1 transcription factor binds cooperatively to the palindromic head to head ETS-binding sites of the stromelysin-1 promoter by counteracting autoinhibition J Biol Chem 277, 29386–29398 Ghosh D, Ezashi T, Ostrowski MC & Roberts RM (2003) A central role for Ets-2 in the transcriptional regulation and cyclic adenosine 5¢-monophosphate responsiveness of the human chorionic gonadotropinbeta subunit gene Mol Endocrinol 17, 11–26 Nye JA, Petersen JM, Gunther CV, Jonsen MD & Graves BJ (1992) Interaction of murine ets-1 with 39 40 41 42 GGA-binding sites establishes the ETS domain as a new DNA-binding motif Genes Dev 6, 975–990 Gille H, Kortenjann M, Thomae O, Moomaw C, Slaughter C, Cobb MH & Shaw PE (1995) ERK phosphorylation potentiates Elk-1-mediated ternary complex formation and transactivation EMBO J 14, 951–962 Drewett V, Muller S, Goodall J & Shaw PE (2000) Dimer formation by ternary complex factor ELK-1 J Biol Chem 275, 1757–1762 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding Anal Biochem 72, 248–254 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method Methods 25, 402–408 FEBS Journal 277 (2010) 1861–1875 ª 2010 The Authors Journal compilation ª 2010 FEBS 1875 ... b-actin cDNA was also amplified using primers b-actin F (sense) (5¢-AGAAAATCTGGC ACCACACC-3¢) and b-actin R (antisense) (5¢-TAGCACAGCCTGGATAGCAA-3¢), and served as the internal control Melting-curve... against Ets-1 raised against its N-terminal region and an antibody against Elk-1 raised against phosphorylated Ser383 present at the C-terminus of this protein Preincubation of nuclear proteins... of acetyl-lleucyl-l-argininal, inhibitor of dipeptidyl aminopeptidase III by bacteria J Antibiot (Tokyo) 37, 680–681 Hazato T, Inagaki-Shimamura M, Katayama T & Yamamoto T (1982) Separation and