0

isolation reverse transcription and polymerase chain reaction rt pcr

Báo cáo khoa học:

Báo cáo khoa học: "Development of a RVFV ELISA that can distinguish infected from vaccinated animals" pps

Báo cáo khoa học

... Figure Expression and purification of the RVFV N and NSs antigens Expression and purification of the RVFV N and NSs antigens Protein samples were mixed with reducing sample buffer and run on SDS ... is important for vaccine acceptance given regulations restricting movement and export of infected animals in the affected areas In addition to indirectly reducing human morbidity and mortality ... presented in this paper expands upon those earlier studies to pro- Methods Cloning of N and NSs genes PCR was used to amplify the open reading frame of N and NSs from the pCAGGS N and NSs vectors respectively...
  • 11
  • 279
  • 0
Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf

Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf

Báo cáo khoa học

... using various substrates and compared with those of hPDI The recombinant cPDI and hPDI shared similar reductase, oxidase and isomerase activities PDI exhibits both chaperone and antichaperone activities ... Cl, pH 7.5, mM EDTA) The filled and open circles denote native and linear tx3a, respectively (B) Refolding carried out in buffer B (buffer A plus mM GSH and mM GSSG) and in buffer C (buffer B plus ... buffer (0.1 M Tris ⁄ Cl, pH 7.5, mM EDTA, 0.1 mM GSH) and catalyzed by lM cPDI At different reaction times, the reaction mixture was acidified and immediately analyzed by RP-HPLC (B) The time course...
  • 10
  • 405
  • 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học

... TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer and the second 3¢ ... activation and immobilization periods were set between and to couple the desired amount of proteins yielding between 400 and 600 arc seconds Micromolar concentrations of SAgs [SSA and SSA(C26S)] or b chains ... SMEZ1 and 2), three have one Cys (SEI, SEK and SPEC), two have three Cys (SEG and SPEA) and only SSA has more than that, five Cys As discussed later, the fact that SSA has two Cys residues (Cys26 and...
  • 9
  • 485
  • 0
Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Báo cáo khoa học

... specific bands of the RT- PCR products with HRT1 and HRT2 specific primers could be detected only in the reactions with latex mRNA These results indicate the specific expression of HRT1 and HRT2 in ... Asawatreratanakul et al (Eur J Biochem 270) Fig Overexpression of HRT1 and HRT2 in E coli and purification of HRT2 The pETHRT1 and pETHRT2 were constructed and introduced into E coli BL21(DE3) The expression ... resulting plasmids designated pJRHRT1 and pJRHRT2, contained HRT1 and HRT2 respectively The SNH23-7D yeast strain was transformed with plasmid pJRHRT1 and pJRHRT2 according to the protocol of...
  • 10
  • 516
  • 0
Báo cáo khoa học: Sulfation of hydroxychlorobiphenyls Molecular cloning, expression, and functional characterization of zebrafish SULT1 sulfotransferases docx

Báo cáo khoa học: Sulfation of hydroxychlorobiphenyls Molecular cloning, expression, and functional characterization of zebrafish SULT1 sulfotransferases docx

Báo cáo khoa học

... CiÆmmol)1), and 50 lM substrate The reaction was started by the addition of the enzyme (0.25 lg per 25 lL reaction mixture) and allowed to proceed for at 28 °C (Amount of enzyme and reaction time ... 45 s at 94 °C, 45 s at 59 °C, and at 72 °C The final reaction mixture was applied onto a 1.2% agarose gel and separated by electrophoresis The discrete PCR product band, visualized by ethidium bromide ... than 5% reaction: the reaction was linear with time and amount of enzyme.) The reaction was terminated by heating at 100 °C for The precipitates formed were cleared by centrifugation, and the...
  • 8
  • 537
  • 0
Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học: Cloning, expression and characterization of a new aspartate aminotransferase from Bacillus subtilis B3 docx

Báo cáo khoa học

... acceptor; L-Glu, standard L-Glu; L-Try, standard L-Try; 1-3, reaction sample (B) The oxaloacetate was used as the amino acceptor; L-Asp, standard L-Asp; L-Try, standard L-Try; 1–3, reaction sample ... determine the effects of pH, temperature and inhibitors, l-aspartate and a-ketoglutarate were used as amino donor and acceptor, respectively, and the reactions were performed as described above ... aspartate aminotransferase and its complex with 2methylaspartate J Biol Chem 272, 17293–17302 Yagi T, Kagamiyama H, Motosugi K, Nozaki M & Soda K (1979) Crystallization and properties of aspartate...
  • 13
  • 490
  • 0
Báo cáo Y học: Trehalose-phosphate synthase of Mycobacterium tuberculosis Cloning, expression and properties of the recombinant enzyme pdf

Báo cáo Y học: Trehalose-phosphate synthase of Mycobacterium tuberculosis Cloning, expression and properties of the recombinant enzyme pdf

Báo cáo khoa học

... 20 amino acids starting at position 397 of the M tuberculosis TPS, and another sequence of about 16 amino acids starting at position 421 of the M tuberculosis TPS Isolation and purification of ... all DNA manipulation enzymes, including restriction endonucleases, polymerases and ligase, were supplied by New England Biolabs, and used according to the manufacturer’s instructions Custom oligonucleotide ... UDP–glucose and MgCl2 in 100 lL 50 mM Tris/HCl, pH 8.0 The reactions were stopped by heating and the following components were added: 0.15 mM NADH, 0.25 mM phosphoenolpyruvate, mM MgCl2, and lg each...
  • 10
  • 428
  • 0
Báo cáo khoa học: Trehalose synthase of Mycobacterium smegmatis Purification, cloning, expression, and properties of the enzyme ppt

Báo cáo khoa học: Trehalose synthase of Mycobacterium smegmatis Purification, cloning, expression, and properties of the enzyme ppt

Báo cáo khoa học

... and expressed it as active enzyme in E coli In this report, we describe the purification of TreS from M smegmatis, as well as the isolation of active recombinant TreS, and its enzymatic properties ... medium reversed the growth defect In minimal medium and in the absence of trehalose, the double and triple mutants showed an altered cell wall lipid composition and lacked both trehalose monoand ... Trypticase soy broth was from Becton Dickenson, and LB broth was from Fisher Scientific Co Sephacryl S-300 and Sephacryl S-200, and [14C]maltose and [3H]glucose, were from Amersham Pharmacia Biotech...
  • 11
  • 459
  • 0
Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

Báo cáo khoa học

... this enzyme is a xyloglucanase and investigate its properties and its possible role in the degradation of plant biomass Materials and methods Protein production and purification Clone KPR17269, ... and then heated for h at 95 °C, as described by Chirco & Brown [19] and Jung et al [12] Glucose and xylose oligomer standards were obtained from Seikagaku America or Sigma a filter with dH2O and ... three product bands and there was a large quantity of undigested material remaining at the origin (Fig 2B) Xeg74 had very limited activity on G4, G5 and G6 and only faint product bands were produced...
  • 9
  • 453
  • 0
Báo cáo khoa học: Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, fromCoturnix coturnix pdf

Báo cáo khoa học: Gene cloning, expression and characterization of avian cathelicidin orthologs, Cc-CATHs, fromCoturnix coturnix pdf

Báo cáo khoa học

... lane 0, protein standards (C) Protein bands after affinity chromatography and renaturing process Lanes and 2, protein bands after separation by affinity column; lanes and 4, protein bands after renaturing ... and characterization of three avian cathelicidin orthologs, namely Cc-CATH precursors from Coturnix coturnix, is reported, and the relationship between quail cathelicidins and other known vertebrate ... the reverse transcriptase used was PowerScript Reverse Transcriptase, as supplied with the kit Second-strand cDNA was amplified by 5¢ PCR primer 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢ and CDS III ⁄ 3¢ PCR...
  • 12
  • 406
  • 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

Báo cáo khoa học

... for min, and 72 °C for min) and an additional extension step at 72 °C for 10 The PCR product (about 1.1 kb) was purified by agarose gel electrophoresis and then subcloned into the NdeI and HindIII ... formed in the reaction solution was further confirmed to be acetone by its mass spectrum, which displayed fragments of m/z 58 (M+) and m/z 43 consistent with those of acetone standard Properties of ... overnight in Luria–Bertani medium supplemented with ampicillin (100 lgÆmL)1), and then 40 mL Luria–Bertani medium was inoculated with 40 lL of the above fresh overnight culture and incubated at 37...
  • 6
  • 255
  • 0
Báo cáo y học:

Báo cáo y học: "Cloning, expression and characterization of gE protein of Duck plague virus" doc

Báo cáo khoa học

... cells using Western blotting, and analyzed the DPV gE gene transcription in DPV-infected cells using the real time PCR and RT- PCR Results Cloning of DPV gE gene and the correct recombinant plasmid ... Page of 11 tion of the DPV gE gene using RT- PCR and real-time quantitative PCR DPV gE earliest transcripts were detected at h post-infection by RT- PCR, and markedly increased at 36 h post-infection ... and DPVinfected cells was verified by 1.0% agarose gel electrophoresis (Fig 6A) The transcription of the DPV gE gene was analyzed by real-time quantitative PCR with SYBR Green I and reverse transcription- PCR...
  • 11
  • 282
  • 0
Cloning, expression and characterization of novel helicobacter pylori differentiating antigen   heat shock protein 20

Cloning, expression and characterization of novel helicobacter pylori differentiating antigen heat shock protein 20

Tổng hợp

... RAPD: randomly amplified polymorphic DNA rCagA: recombinant CagA protein rHSP20: recombinant heat shock protein 20 RNA: ribonucleic acid RT- PCR: reverse- transcriptase polymerase chain reaction ... ORF: open reading frame PAI: pathogenicity island PBS: phosphate buffered saline PBST: phosphate buffered saline & Tween-20 PCR: polymerase chain reaction PDB: protein database PSB: phosphate ... love and support throughout my PhD study Especially thank my husband Jieming Zeng, who himself was studying for PhD degree at the same time for always being on my side and brightening my life And...
  • 301
  • 525
  • 1
Cloning, expression and characterization of oxysterol  binding protein homologue 7 (OSH7) in yeast saccharomyces cerevisiae

Cloning, expression and characterization of oxysterol binding protein homologue 7 (OSH7) in yeast saccharomyces cerevisiae

Tổng hợp

... of the mevalonate pathway exert feedback regulation on their own synthesis at both transcriptional and post-transcriptional levels (Goldstein and Brown, 1990; Brown and Goldstein, 1997, 1999) Although ... pathway Furthermore, ESCRT-I (endosome sorting complex required for transport) was showed to act in the recognition of ubiquitinated cargoes at the endosome and 35 initiate transport of these ... Promega (Madison, WI, USA) Polymerase chain reaction (PCR) was performed either using Pfu or Taq polymerase from Promega Ligation was done using T4 DNA ligase from New England Biolabs Inc (Beverley,...
  • 123
  • 381
  • 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Báo cáo khoa học

... and sequencing of PCR products The PCR product was analysed by electrophoresis through 1% agarose gel and purified using MinEluteTM Gel Extraction Kit (Qiagen, Valencia, CA, USA) The purified PCR ... genes and the general primary structure of c-gliadins Plant Sci 57, 141–150 15 Anderson OD & Hsia CC (2001) The wheat c-gliadin genes: characterization of ten new sequences and further understanding ... is the same length as the PCR products indicating that the cloned x-5a gene has no artificial deletion The existence of repeat sequences of QQXP, QQQXP and 4435 Cloning and expression of wheat x-5...
  • 8
  • 484
  • 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Báo cáo khoa học

... control for the quantity and quality of cDNA Semiquantitative analysis of RT PCR products Suspensions of Carp head kidney and liver cells were treated with 10 lgÆmL)1 LPS for 1, and h, individually, ... carp IL-10 and b-actin genes were amplified using a range (21–30) of PCR cycles Following this procedure, an optimal number of PCR cycles (24 for IL-10 and 21 for bactin) was determined and subsequently ... predetermined reaction cycles of 30 s at 94 °C, 30 s at 56 °C (IL-10) and 57 °C (b-actin), and at 72 °C PCR products were electrophoresed on a 2.0% (w/v) agarose gel to enable detection of the specific bands...
  • 8
  • 584
  • 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Báo cáo khoa học

... LdEcR-R2 primers (52 °C) and with LdEcR-F3 and LdEcR-R3 primers (46 °C), respectively The first PCR with LdUSP-F1 and LdUSP-R1 primers and the second nested PCR with LdUSP-F2 and LdUSP-R1 primers ... Piscataway, NJ, USA) RT- PCR Reverse- transcription was conducted using ReadyÆToÆ GoTM T-Primed First-Strand Kit (Amersham Bioscience Corp.) for total RNA isolated from the fat body and integument of ... corresponding part of EcRs of other insects Then we subsequently conducted 5¢-RACE and 3¢-RACE, and sequences of 1337-bp and 998-bp fragments were determined, respectively Combining these sequences of PCR...
  • 15
  • 564
  • 0
Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx

Báo cáo Y học: Molecular cloning, bacterial expression and properties of Rab31 and Rab32 docx

Báo cáo khoa học

... Discussion) Fig Puri®cation and properties of wild-type and mutant Rab31 and Rab32 expressed as GST±fusion proteins Samples of platelet particulate fraction protein and of puri®ed GST and GST±Rab proteins ... most strongly in placenta and brain and to a lesser extent in heart and lung, but no signal was detected from liver, skeletal muscle, kidney and pancreas HEL cells, and Ó FEBS 2002 to a lesser ... Nevertheless, it is clear from both our Northern and Western blots that the principal form of Rab32 expressed in human cells is the short form shown in Fig 1B A predicted transcription start site...
  • 13
  • 481
  • 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học

... (+1) of cDNA start codon Restriction enzymes were obtained from New England Biolabs (USA) Amplification reaction (PCR) , cloning and sequence analysis Unless otherwise indicated, PCRs were conducted ... Cloning and sequence analysis of full-length tryptase cDNAs A partial cDNA (690 bp) encoding a new bovine tryptase isoform (BLT) was obtained from lung mRNA by RT- PCR, using primers N9 and N10, and ... primers N9 and N10, and by subsequent cloning and sequencing Based on this partial sequence, 5¢ RACE experiments and RT- PCR (using the primer pair Met and Coda) were performed as described in the...
  • 11
  • 527
  • 0
Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt

Báo cáo khoa học

... 3,3¢,5¢-Triiodo-L-Thyronine (L -rT3 ) L-Thyroxine (L-T4) 17b-Estradiol Estrone 4-Androstene-3,17-dione Cholesterol Corticosterone Cortisone Dehydroepiandrosterone D-Dopa L-Dopa Dopamine Hydrocortisone 17a-Hydroxy ... SULTs (A) RT- PCR analysis of the expression of SULT1 ST5 and previously identified zebrafish SULT1 STs at different stages during embryogenesis and larval development onto maturity Final PCR mixtures ... of message was detected in unfertilized eggs and in embryos immediately following fertilization Throughout the cleavage period, blastula period, and the early part of gastrula period, however,...
  • 10
  • 336
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25