identify the components of an ecosystem that are not part of a community
Báo cáo khoa học: Mutagenesis of hydrogenase accessory genes of Synechocystis sp. PCC 6803 Additional homologues of hypA and hypB are not active in hydrogenase maturation ppt
... sll1079 AGACCGTGTGCGAAACTATCA 798855–798862hypB2 sll1079 AAGTGAGTTAAAAATGGCGGTT 799362–799341hypA2 sll1078 CATATGCATGAAACAGACATGACCAA 799958–799936ureC-tag1 sll1750 AGACCGTGTGCGATTAACATGTCTAGATG ... 1955553–1955579P1hypA1 slr1675 ACCATCAGCACTAGCCGGGA 1954925–1954945P2hypA1 AGCGAGGTGCCGCCATCAAGCTTAAC 1955528–1955555AGTTGGAACTAGCATCCCTAGAACP3hypA1 TCAATAATATCGAATTCCTGCAGTTTGC 1955222–1955249TCCATCAGACTAACTTCGTGCAP4hypA1 ... CTTGTCGACTGGAGTCCTAACAAATACGG 991728–991747NhypF sll0322 CATATGTTAAAAACCGTTGCCATACAG 2434762–2434739ChypF GGATCCAGTTGAGTTAACAGATATATTGC 2432452–2432474NhoxW slr1876 CATATGCCAGGCCAATCCACCA 1227090–1227108ChoxW...
- 12
- 415
- 0
Báo cáo hóa học: " FPGA Implementation of an MUD Based on Cascade Filters for a WCDMA System" doc
... blocks: signature and detection. Eachblock acts as an adaptive fi lter for c anceling the ISI and MAI. The proposed linear adaptive MUD is based on the least-mean-square (LMS) adaptation method. ... and 2004, respectively. He was twotimes the Laureate of the Governor General of Canada’s Academic Medal (gold medal—graduate level) and a Fellow of the Natural Sciences and Engineering Research ... grateful for the financial support of the Nat-ural Sciences and Engineering Research Council of Canada(NSERC). We also wish to thank Axiocom Inc. for its techni-cal and financial assistance.REFERENCES[1]...
- 12
- 388
- 0
Báo cáo toán học: "Cayley Graphs of Abelian Groups Which Are Not Normal Edge-Transitive" pot
... if and only if S−1= S.Vietnam Journal of Mathematics 33:3 (2005) 309–318Cayley Graphs of Abelian GroupsWhich Are Not Normal Edge-TransitiveMehdi Alaeiyan, Hamid Tavallaee, and Ali A. TalebiDepartment ... Alaeiyan, Hamid Tavallaee, and Al i A. TalebiProposition 2.2. [2] A graph Γ=(V,E) is a Cayley graph of a gr oup if andonly if AutΓ contains a regular subgroup.Let Γ=Cay(G, S) be a Cayley graph of ... that Γ is as in the first paragraph above, and that Γ is edge-transitivebut not normal edge-transitive. Then it follows that Aut(Γ) = NAut(Γ)(G), andhence that Γ is one of the graphs classified...
- 10
- 299
- 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers
... what part the language is playing, what it is that the participants are expecting the language to do for them in that situation, the symbolic organisation of the text, the status that it has, ... He + the exam) is not realized by means of a clause, but rather by means of another type of form, such as a noun phrase, as in the example at hand. In this sense, grammatical metaphor again ... is taking part, to the nature of the participants, their statuses and roles: what kinds of role relationships obtain among the participants, including permanent and temporary relationships of...
- 53
- 1,013
- 3
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt
... Halifax, Canada and held a CIHR ⁄ CNRS International Scientific Exchange Schol-arship from the Canadian Institutes of HealthResearch and the Centre National de la Recherche Sci-entifique, France.References1 ... support the hypothesis that inclusion formation is part of a mechanism that pro-motes the clearance of mutant protein by activatingautophagy [18,19].Intracellular aggregates containing ubiquitylatedproteins ... Tokyo, Japan). Images were recordedwith a MegaviewII numeric camera, and analysis soft-ware (Soft Imaging System GmbH, Mu¨nster, Germany)was used to analyze the images.Determination of intracellular...
- 18
- 721
- 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf
... cyclooxygenase-2localize to intracellular membranes of EA.hy.926endothelial cells that are distinct from the endoplasmicreticulum and the Golgi apparatusSeema Grewal*, Shane P. Herbert, Sreenivasan Ponnambalam ... endothelial cells. We show that cPLA2 -a relocates to intracellular membrane compart-ments that are distinct from the ER and the Golgiapparatus. More importantly, we demonstrate that, atthis ... plasmamembrane, Golgi apparatus and nuclear envelope, wasalso used as a counter stain (Fig. 2). Once again, com-plete overlap was not seen, and only patches of colo-calization, particularly...
- 13
- 387
- 0
Báo cáo Y học: The opgGIH and opgC genes of Rhodobacter sphaeroides form an operon that controls backbone synthesis and succinylation of osmoregulated periplasmic glucans pot
... produced by the mutant and wild-type strains werefurther analyzed by DEAE-Sephacel chromatography,which allows for the separation of subfractions of glucanby their anionic character. OPGs extracted ... necessary for OPG backbone synthesis and of a new gene, opgC, necessary for OPG succinylation.MATERIALS AND METHODSBacterial strains and media The bacterial strains and plasmids used are detailed ... strain are totally neutraland are not retained by the column [14]. After introduction of the plasmid, 20% of the radioactivity, corresponding toanionic glucans, were retained by the column and...
- 12
- 494
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... andcharacterized the MREa-binding activity, which consisted of two polypeptides of approximately 70 and 82 kDa.N-terminal and internal amino acid sequencing and immunoanalyses revealed that ... indicated by the open arrowhead, and the Ku-70 and -80 proteins are indicated by closedarrowheads. In addition, the asterisks represent reappearance of the WD proteins after 24 h (upper panel). The ... Luciferase activity for each construct was normalized to b-galactivity, and the relative increases were calculated as the ratio of normalized activity in MREa/mutant transfected cells to that in...
- 11
- 628
- 0
Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc
... research on three aspects of the project: the kinds of tailoring that are appropriate for health-education documents; the nature of a tailorablemaster document, and how it can be created; and the ... Finding an Appropriate Level of AbstractionAs explained above, a master document is a specification of all the information that mightbe included in a brochure on a particular topic, along with annotations ... kinds of tailoring that are appropriate for health-education documents; the nature of a tailorable master document, and how it can be created; and the linguistic problems that arisewhen a tailored...
- 12
- 379
- 0
Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf
... extracellular loop that are critical for ligand recognition of humanprostacyclin receptorFeng Ni*, Shui-Ping So, Vanessa Cervantes and Ke-He Ruan The Department of Pharmacological and Pharmaceutical ... Prostaglandins 12, 897–913.2 Moncada S, Herman AG, Higgs EA & Vane JR (1977)Differential formation of prostacyclin (PGX or PGI2)by layers of the arterial wall. An explanation for the anti-thrombotic ... USA).DNA polymerase and DpnI endonuclease were obtainedfrom Stratagene (La Jolla, CA, USA). Rabbit anti-(humanIP) serum was purchased from Cayman Chemical (AnnArbor, MI, USA).PCR cloning of...
- 10
- 354
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25