... endoplasmic reticulum by cotranslational protein targeting Cotranslational targeting of a protein to the endoplasmic reticulum is initiated when a signal recognition particle binds to a hydrophobic signal ... T.-H (1998) Cloning, sequencing and expression of a cDNA encoding bovine pancreatic deoxyribonuclease I in Escerichia coli: purification and characterization of the recombinant enzyme Gene 206, 181–184 ... sequence present at the N-terminus of the nascent chain, and the common physicochemical properties of this sequence, irrespective of the lack of any speci c consensus amino acid sequence, are...
... N-domain and the regulatory TnC-binding site [16] This interaction induces the dissociation of the inhibitory region, which is adjacent to the regulatory TnC-binding site, from actin, resulting in ... corresponding interaction in rabbit TnI–TnC in the absence of divalent cation Therefore, this interaction potentially participates in both the Ca2+-dependent activation of the contraction and the maintenance ... actin-tropomyosin and TnC To understand the biological significance of the difference in TnI–TnC interactions, we compared the ability of TnC to neutralize the inhibitory effects of the C- terminal fragments...
... Kojima N, Yamanaka M, Ichiki S & Sambongi Y (2005) Unexpected elevated production of Aquifex aeolicus cytochrome c5 55 in Escherichia coli cells lacking disulfide oxidoreductases Biosci Biotechnol ... PHCP protein by E coli, unlike that of class I cytochromes c, including the PH c5 52 protein Spectral properties of the authentic PHCP protein Similarity to and differences from periplasmic EC ... medium and aerobicity are required for a clear comparison, which will provide information on the function of Ccm proteins Structural implication for PHCP synthesis Although the sequence identity...
... Wessler BS (2004) Magnetic circular dichroism and cobalt(II) binding equilibrium studies of Escherichia coli methionyl aminopeptidase J Am Chem Soc 126, 12316–12324 Mitic N, Smith SJ, Neves A, Guddat ... Escherichia coli aminopeptidase P: C- terminal domain of E coli aminopeptidase P insights into substrate recognition and the mechanism of catalysis Biochemistry 45, 964–975 28 Yang H, Carr PD, McLoughlin ... Schematic diagram of AMPP Wild-type AMPP consists of an N-terminal domain (1–174 amino acids) and a C- terminal domain (174–439 amino acids) C- terminal domain AMPP#2 has a 157 amino acid deletion, AMPP#12...
... 1,2-bis(O-aminophenoxy)ethane-N,N,N¢,N¢-tetraacetic acid (BAPTA) As predicted, the procedure almost completely abolished an increase of [Ca2+ ]i triggered by inhibition of endoplasmic reticulum Ca2+-ATPase with thapsigargin or by activation ... further investigation Third, increasing evidence indicates that, side-by-side with regulation of the 5¢-UTR by transcription factors, gene activation or silencing is under the complex control of three-dimensional ... Quickchange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA), following the recommendations of the manufacturer, with the sense primer CTCCCCCCTTACACAGGATG TGGATATTACCACATCTGCGTCAGC...
... co -evolution is at Chapter “The Concept of ‘Co -evolution and its Application in the Social Sciences – A Review of the Literature” Co -evolution is reciprocal influence which changes the behaviour ... cutting across all traditional disciplines of the natural and life sciences, engineering, economics, medicine, neuroscience, social and computer science Complex Systems are systems that comprise ... of applications in socio-economic contexts [31] When applied within the social sciences, co -evolution usually refers to social coevolution: the reciprocal evolutionof two or more social systems...
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... domain I g g domain II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu domain IIIa domain IIIb g u u g u 250 uugggcgugcccccgcgagacugcuagccguaguguugggucgcgaaaggccuugugguacugccugauagggu domain IIIc a u c domain IIId a domain IIIe a Figure HCV IRES...
... included Transmit diversity mode incorporated 3X multi-carrier mode Various kinds of pilot channels Paging channel QPCH/BCCH/CCCH CDMA2000 Specification Reverse link Doubling the capacity Coherent ... interference (ACI and CCI) Multiple Access Scheme – CDMA Code-Division Multiple Access (CDMA) One of the most important concepts to any cellular telephone system is that of “multiple access” CDMA - a ... reverse link with continuous pilot and BPSK modulation increases transmission range and capacity Continuous transmission reduces EMI to bio-medical devices Supports multiple concurrent services and...
... Liu X, Li S: Cross-species recombination in the haemagglutinin gene of canine distemper virus Virus Res 2008, 136:198-201 13 Spann KM, Collins PL, Teng MN: Genetic recombination during coinfection ... sequences with statistically significant recombination signals (Table 1) In this study, we used all influenza C viral sequences available in Influenza Virus Resource Although the majority of segments ... identifies mosaic signals 3SEQ is among the most powerful recombination detection methods, especially in datasets with high nucleotide diversity [26] Mean pairwise distances for the influenza C...
... genetic diversification in the infant sequences increased after 12 months, and this coincided with increases in neutralizing antibody titers In addition, episodes of viral growth and successive immune ... K, Caniglia M, Jacomet C, Messiah A, Griscelli C: Longitudinal study of 94 symptomatic infants with perinatally acquired human immunodeficiency virus infection Evidence for a bimodal expression ... and disease progression in children The significance of C3 and V4 variation is currently under investigation It is important to recognize that definitions of the constant and variable domains in...
... principal investigator contacted the treating physician with an invitation to participate in the study If the treating physician agreed to participate, the hospital was visited by a medical monitor ... of meningococcemia • In this group of pediatric patients, substitution with human, non-activated PC concentrate resulted Page of in an improvement of PF in the majority of patients, without causing ... studies using activated PC in adult and pediatric patients with severe sepsis, presenting with PF, meningitis or meningococcal disease [5] The authors identified 119 pediatric patients suitable...
... Ăngghen, V I Lênin Sinh th i, C M c Ph Ăngghen ngư i tr c tiếp chứng kiến c ch mạng dân chủ tư sản nhiều nư c châu Âu đứng trư c vấn đề c n ph i gi i quyết: ngư ic ng sản c nên tham gia vào c ch mạng ... thiên chúa giáo, và đa c biệt ngươ i đã tìm thấy chủ nghĩa Ma c- Lênin làm tư tưởng, kim chỉ nam cho cách mạng Việt Nam giàn thắng lơ i và c ng cuô c xây dựng và phát triển ... dân sinh ph i tiến hành cuô c cách mạng kinh tế -cu c cách mạng xã h i Nhưng ông chưa đạt t i quan i m CNDV lịch sử cho phương th c sản xuất yếu tố định tồn phát triển xã h i lo i ngư i - nhận...
... tổ chư c đa quô c gia, ca c công ty ca c tập đoàn đa quô c gia Ca c chủ thể nhỏ nằm lãnh thổ một quô c gia có thể là ca c tổ chư c kinh tế nươ c ca c công ty, ca c xí nghiệp… ... hề giảm Khi ca c công ty sư c cạnh tranh vơ i ca c đô i thủ, vai trò của quô c gia vơ i tư cách là chủ thể chính cung c ́p ca c lơ i thế, m i trường và i ̀u kiện phát triển ... Quô c Trung Quô c có đươ c cả tất cả ca c nhân tố Họ có ca ci ̀u kiện ca c yếu tố đầu vào ( trình bày ở phần Mu c II ) Họ có i ̀u kiện c ̀u ( đươ c đề c ̣p ở chương III...
... giao hàng cho đô i ta c đươ c, khi chế chính trị của quô c gia ngươ i mua bị thay đô i, khiến cho họ không giao hàng qua nươ c ngươ i mua đươ c. Hoă c giả,chính trị 14 của quô c gia ... tiện viê c trao đô i thông tin giữa ca c bên có liên quan quá trình thư c hiện giao dịch thư từ,hay i ̣n tín liên hệ đến viê c thư c hiện L /C ,hoă c để ghi vào ca c chứng từ liên ... order of Vietcombank Hochiminh City Branch M c ngư i g i hàng B/L ph i nêu To the order of Vietcombank Hochiminh CIty Branch ngư i g i hàng không ký hậu Nếu m c không ghi x c tên ngân hàng Ngoại...
... nghiệp, c n xây dựng chiến lư c phát triển qua giai đoạn kh c kèm v i m c tiêu c thể cho giai đoạn c ch th c để đạt m c tiêu i u đ i h i doanh nghiệp ph ic lộ trình phát triển c ch chủ động ... phương châm chậm ch c, vi c tiếp c n ph i tiến hành bư c đảm bảo chắn Trư c vào thị trường Hoa Kỳ, doanh nghiệp ph ic sẵn cho chiến lư c kế hoạch, doanh nghiệp ph i gi i đáp c u h i: doanh nghiệp ... nghiệp c n hoàn thiện chiến lư c xuất sở chiến lư c phát triển chung ngành toàn kinh tế Một gi i pháp doanh nghiệp Việt nam giai đoạn cac doanh nghiệp c n coi trọng vi c liên kết hoạt động khác...
... tổ chư c đô i vơ ic ng viê c liên quan Cu c quản lý C ng khai ca c thủ tu c hành chính, lệ phí, quy trình và thơ i gian gia i quyết c ng viê c liên quan đến thủ tu c hành chính Cu c ... phương chuyển đến Cu c - Ca c công viê c kha c có liên quan đến gia i quyết thủ tu c hành chính theo phân c ng của Cu c Tiếp nhận, xử lý ca c ý kiến, kiến nghị, phản ánh của cá ... Cu c quản lý Theo do i, tổng hợp thông tin về viê c tiếp nhận và trả kết quả theo chế “một c ̉a” ta i Cu c Kiểm tra, đôn đô c ca c đơn vị Cu c viê c gia i quyết, xử lý ca c hồ...
... Vinh biến đ i Amino Acid cho virus c m Khai phá liệu song ngữ từ web TS Lê Anh C ờng N ic ng t c GV đồng hướng dẫn N ic ng t c GV đồng hướng dẫn N ic ng t c Trường ĐHCN, ĐHQGHN Trường ĐHCN, ... Đào Minh Thư c ng nghệ mobile agent Kh i ph c l i P2P multicast dựa c u tr c mạng ngang TS Nguyễn Ho i Sơn hàng Chord Nghiên c u triển khai hệ thống h c thích nghi theo nhu c u m c tiêu h c ThS ... Trương Ninh Thuận service composition Xây dựng hệ thống thông tin tổ ch c gi i thưởng thi qua mạng ThS Đào Kiến Qu c Internet Nghiên c u ngôn ngữ đ c tả security TS Trương Ninh Thuận policy xây...
... 6 Xa ci nh số phí bảo vệ m i trường đô i vơ i nươ c tha ic ng nghiệp pha i nộp hàng quý: Stt Số tiền (đồng) Chỉ tiêu Số phí pha i nộp quý Số phí quý trươ c chưa nộp ... ngân sách Nhà nươ c Số phí nộp ngân sách Nhà nươ c thừa quý trươ c Số phí còn pha i nộp ngân sách Nhà nươ c (1 + – 3) Số tiền phí bảo vệ m i trường đô i vơ i nươ c tha ic ng ... c ng nghiệp pha i nộp ngân sách Nhà nươ c (viết bằng chữ): T i xin cam đoan số liệu kê khai là đúng, nếu sai xin chịu xử lý theo quy i nh của pháp luật./ Sở Ta i nguyên...