... as if she knew me?13. If I were a bird, I wouldn't want to live in a snake.14. My brother managed to kill the snake just at the time when I were almost exhausted. Supply the correct form ... hurry) don't hurry4. Mary would not have got wet if she (wear) had worn a raincoat.5. If today (be) were a holiday, I would stay in bed for all day long.6. If she ( make) made him change his ... live in a snake.14. My brother managed to kill the snake just at the time when I (be) had been almost exhausted. If he (be) had been a little late, I (kill) would have been killed by the snake.15....
... was assessed at a single timepoint (30 days), and neither the pharmacokinetics of proBMP-2 nor the kinetics of bone formation were anal-ysed. Thus, the fate of administered proBMP-2 in the animal ... phosphorylation. The data presented here suggest that the pro-domain of BMP-2 can alter the signalling properties ofthe growth factorby modulating the ability ofthe mature part to interact with the ... can affect both the maturation and functions of maturegrowth factors. Here, we assessed the biological function ofthe pro -form of bone morphogenetic protein-2 (BMP-2), a member ofthe transforminggrowth...
... Information translation: This conveys all the information in a non-literary text, sometimes rearranged in a more logical form, sometimes partially summarized, and not in theformofa paraphrase.(4) ... Tiersma, the history of English legal language can be summarized as follows: The Anglo-Saxons drove away the Celtic language ofthe original inhabitants of England and their laws left traces ... have the same meaning as other versions, and after ratification, is of legal validity in its territory. But when translated into another language rather than the official ones, the translation...
... competitors, unless the knowledge transfer takes place under circumstances that hold clear and immediate advantages for them. Such advantages have classically taken theformofthe relatively low cost ... inequality and marginalisation. The challenge facing countries such as South Africa, and regions such as the Western Cape, is therefore how to channel the forces of globalisation forthe elimination ... inequality and marginalisation. The challenge facing countries such as South Africa, and regions such as the Western Cape, is therefore how to channel the forces of globalisation forthe elimination...
... linear phase of sampling for at least 56 days (Alvarez and others, 2004, 2007); therefore, the use of a linear uptake model (eq. 1) forthe calculation of ambient water concentrations was justified.Results ... temperature, and biofouling) or as the mass of chemical per sampler. Data that are greater than the MDL, but less than the MQL, are shown in italics. Any data less than the MQL have a large ... water concentrations based on the aver-age PRC data across the sites for each sampling period. When sampling rate information was not available, the MDLs and MQLs were expressed as the mass...
... on the performance analysis of dot coms is sparse at best. Yet an analysis ofthe performance of various types of dot coms can provide valuable insights into the phenomenon of leveraging the ... reasonable to assume that these specific firms are trying to maximize their sales instead ofthe traditional assumption of profit maximization. Therefore, sales is a more relevant measure of ... difference in the performance ofthe firm. The nature ofthe business, the ability to implement strategies and processes and manage relationships digitally across the value chain would be important...
... Dorozhko AK, Kagan ZS & YakovlevVA (1976) The theoretical analysis of kinetic behaviour of ‘hysteretic’ allosteric enzymes. I. The kinetic manifes-tations of slow conformational change of an ... rates) prior to and after the transition ofthe enzyme to a more active form, respectively, t is the time and s is the lag-time. The rate constant, k, forthe activation ofthe enzyme isobtained ... the main chain and side chains in the active site appearas key players in a slow transformation from aninactive to an active enzyme. dTTP inhibition maythen be achieved by stabilizing the inactive...
... ensure the accuracy ofthe information presented in this document. However, readers are advised that errors of interpretation may have occurred and information available at the time ofthe research ... with a particular brand are called brand equity characters. These brand equity characters – usually cartoon or animated characters – are normally owned by the companies that make the food and beverage ... Standard 4: Marketing methods 25 Standard 5: Use of brands 26 Standard 6: Settings and locations 26 Standard 7: Accountability 27 Appendix 28 World Health Organization Set of Recommendations...
... werequantified using a LAS-1000plus (Fuji film)image analyzer and expressed as the foldincrease relative to that ofthe band for Noxo1c in the absence of PMA.R. Takeya et al. Expression and function ... Takeya R, Tsunawaki S, Wada A, Sumimoto H & Rokutan K (2005) Helicobacter pylorilipopolysaccharide activates Rac1 and transcription of NADPH oxidase Nox1 and its organizer NOXO1 inguinea ... Authors Journal compilation ª 2006 FEBS 3677Expression and function of Noxo1c, an alternative splicing form ofthe NADPH oxidase organizer 1Ryu Takeya1,2, Masahiko Taura1, Tomoko Yamasaki1,...
... study.Name Sequence (residues 91–100)WT GGGAGGGGGGpolyAla *SA*AAAAA*AGG AAA*******GAG ****AAA***GGA *******AAAGAA ****AAAAAAAGA AAA****AAAAAG AAA*AAA***GGD *******DDDGGE *******EEEGGL *******LLLGGN ... tomultiple pathways in a way distinct from that of AGAprecursor, or (c) the effect of AAG mutation on cor-rect targeting was significantly less than that of AGAmutation. Taken together with the previous ... trypsin (Fig. 4A, lanes 15–18; Fig. 4B,C), indicating its localization to the stroma, and thylakoid or inner membranes. These dataindicate that a repeat of glutamic acid cannot replace the tri-glycine...
... ggggccgcaacgagcgcctgtggcgg Leu25 to AlaP2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to AlaL6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg ... to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala3K > Q K37Q F ggtgcgtcgatccaaggctttcaacaagcaatgag Lys37, Lys40 and Lys41 to GlnTatB mutantsE8Q E8Q F cggttttagccaactgctattggtgttcatcatc ... gttgtactgctttttgccaccaaaaagctcgg Gly21 to AlaK2 4A K2 4A F gctttttggcaccaaagccctcggctccatcgg Lys24 to AlaL2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg...
... University,Fukushima, Japan;3Laboratory of Nanobiology, Graduate School of Frontier Biosciences, Osaka University, Suita, Osaka, Japan;4PHP Laboratory for Molecular Biology, Nakayama-Yoshinari, Sendai, JapanSome ... group of the regulatory amino acid residue (probably a carboxyl group of the heme propionate in this case), and the asterisk is for the unstable intermediate species for each ofthe two forms. The ... instars(stages separated by a molt) without change of shape. As for T. akamusi, the Japanese word ÔakamusiÕ means blood-worm, which comes from the fact that a large amount of hemoglobin is synthesized...