0

energy savings from dewatering due to a 1 reduction in dryer feed moisture 1

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Quản trị kinh doanh

... 10 8 10 8 10 9 10 9 11 0 11 1 11 2 11 3 11 5 11 5 11 5 11 5 11 6 11 6 Table of Contents Different energy levels Use a mix of methods to communicate 11 6 11 6 Create opportunities for in- person interactions Finally, ... process Interviewing on campus Campus hiring – allocations Pre-join attrition Campus hires boot camp Summary Chapter 8: Performance Evaluation 16 9 16 9 17 0 17 0 17 0 17 1 17 1 17 2 17 2 17 3 17 5 Understanding ... skills Past work is important Using behavioral interviews Feedback recording 15 4 15 4 15 5 15 5 15 5 15 6 15 6 15 6 15 7 15 7 15 8 15 9 16 0 Hiring decision Compensation 16 2 16 4 Closing the hiring process 16 8...
  • 328
  • 4,476
  • 0
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot

Báo cáo khoa học

... 5¢-GACCCCAACATGGGCGACTC-3¢ 5¢-GTCACTGTGGGCAGCGCCAG-3¢ 10 6 21 10 640 10 793 10 774 5¢-tctagaagcttGGCGCCGTGTACACAGAAGGTGGG-3¢ 5¢-GTTGGCCCCATGGCCGGACCCCAT-3 4047±4069 4752±4729 5¢-cgggatccGAAGCCCTTCGCCACCCCCACG-3¢ ... onco-fetal variant of BSSL, denoted feto-acinar pancreatic protein (FAPP), has been detected in human embryonic and fetal pancreas and in pancreatic tumoral cell lines [35,36] FAPP and BSSL are structurally ... deletion was found This difference predicts an even earlier translational stop, i.e after 610 amino acids In both cases the deletion changes the reading frame and predicts a new C-terminal tail (RAAHG)...
  • 9
  • 520
  • 0
báo cáo hóa học:

báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot

Hóa học - Dầu khí

... manuscript Page 12 of 13 16 17 18 19 Competing interests The authors declare that they no have competing interests 20 Received: 31 March 2 011 Accepted: October 2 011 Published: October 2 011 21 ... instrument was based on a conceptual framework; (iii) whether the conceptual framework was defined prior to statistical analysis, defined after statistical analysis, or refined after statistical analysis; ... file 1: Search strategy: MEDLINE, EMBASE, CINAHL and PSYCHINFO Outline of the search strategy used for electronic database searching List of Abbreviations APA: American Psychological Association;...
  • 13
  • 357
  • 0
báo cáo khoa học:

báo cáo khoa học: "Right subclavian vein catheterism complication due to a ‘foreign body’: a case report" ppt

Báo cáo khoa học

... hematoma, with no active bleeding, and a triangular foreign body of metallic tomographic appearance, approximately mm in length, in the interstitial space between right subclavian vein and artery ... Armadas, Barreiro, Portugal 2Radiology Department, Hospital N S Rosário, Av Forças Armadas, Barreiro, Portugal Authors’ contributions ZS analyzed and interpreted data from our patient regarding ... central venous and pulmonary artery catheters: a meta-analysis of randomized controlled trials Chest 19 98, 11 3 :16 5 -16 7 doi :10 .11 86 /17 52 -19 47-4-327 Cite this article as: Sidiropoulou et al.: Right...
  • 3
  • 197
  • 0
báo cáo khoa học:

báo cáo khoa học: "Hemolytic anemia due to acute cytomegalovirus infection in an immunocompetent adult: a case report and review of the literature" doc

Báo cáo khoa học

... infection in healthy adults Acta Haematol 19 94, 92 (1) :39- 41 doi :10 .11 86 /17 52 -19 47-4-334 Cite this article as: Taglietti et al.: Hemolytic anemia due to acute cytomegalovirus infection in an immunocompetent ... the patient during the hospitalization, analyzed data from the literature, and wrote the article ST and PN analyzed data from the literature CMD was the major contributor in writing the manuscript ... hospital discharge, the fever persisted, and the patient complained of progressive asthenia At admission to our hospital, the patient appeared pale and asthenic Physical examination revealed a body...
  • 3
  • 394
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Acute jejunoileal obstruction due to a pseudopolyp in a child with undiagnosed crohn disease: A case report" doc

Báo cáo khoa học

... disease Am J Gastroenterol 19 98, 93 :15 91- 2 Kahn E, Daum F: Pseudopolyps of the small intestine in Crohn disease Hum Pathol 19 84, 15 :84-6 Yuille MA, Coignet LJ: The ataxia telangiectasia gene in ... intestinal surface and ulcers, two of which had parietal ruptures with fluid escape A resection of 45 cm of the ileo-jejunal portion, including all areas of intestinal damage, was performed and a ... primary end to end ileo-jejunal anastomosis completed the operation (Figure 2) Longitudinal incision of the intestine showed a cobblestone appearance, due to linear ulcers crossing with transverse...
  • 3
  • 271
  • 0
Báo cáo y học:

Báo cáo y học: " Femoral vein thrombophlebitis and septic pulmonary embolism due to a mixed anaerobic infection including Solobacterium moorei: a case report" ppt

Báo cáo khoa học

... multiple injection sites and an erythematous right groin, with bilateral groin sinuses and some lymphadenopathy on palpation Cardiovascular, respiratory and abdominal examination was unremarkable Analysis ... became apyrexial and his clinical condition and inflammatory markers improved dramatically – by day 17 of admission his C-reactive protein had decreased to mg L -1 He was discharged on oral antibiotics ... superficial femoral vein thrombosis with pulmonary and inferior vena cava emboli associated with anaerobic organisms in a groin abscess Solobacterium moorei, though rarely described, may also have clinically...
  • 3
  • 192
  • 0
Báo cáo y học:

Báo cáo y học: "Recurrence of suicidal ideation due to treatment with antidepressants in anxiety disorder: a case report" docx

Báo cáo khoa học

... Journal of Medical Case Reports 2007, 1: 166 regimen, panic attacks continued and his overall state deteriorated eventually leading to hospitalization to a youth inpatient ward Treatment was changed ... with an antidepressant [12 ] that may lead to suicidality The classical action of the reserpin can serve as a model for such action In addition, auto-aggressive feelings are possibly part of panic ... U.S and European regulatory agencies issued warnings about a possible suicide risk with antidepressant use in pediatric patients, was associated with increases in suicide rates in children and adolescents...
  • 4
  • 280
  • 0
Báo cáo y học:

Báo cáo y học: " Selective mutism due to a dog bite trauma in a 4-year-old girl: a case report" pot

Báo cáo khoa học

... Cnaan A, Sherman-Slate E, Gallagher PR, Winston FK: Looking beyond the physical injury: posttraumatic stress disorder in children and parents after pediatric traffic injury Pediatrics 19 99, 10 4 :12 93 -12 99 ... Post-traumatic stress responses in children: awareness and practice among a sample of pediatric emergency care providers Pediatrics 2005, 11 5 :12 61- 1267 Schalamon J, Ainoedhofer H, Singer G, Petnehazy ... hospitalization, the child was in a depressed mood and displayed mild withdrawal from contact with others A psychiatric evaluation was performed During consultation, the child was apparently agitated...
  • 3
  • 275
  • 0
Báo cáo y học:

Báo cáo y học: " Massive hematuria due to a congenital renal arteriovenous malformation mimicking a renal pelvis tumor: a case report" doc

Báo cáo khoa học

... Livingstone; 19 94 :11 21- 37 Kopchick JH, Bourne NK, Fine SW, Jackobsohn HA, Jacobs SC, Lawson RK: Congenital renal arteriovenous malformations Urology 19 81, 17 (1) :13 -17 Tarkington MA, Matsumoto AH, ... Axial computed tomography material, arterial phaseadminisAxial computed tomography scan after intravenous administration of iodinated contrast material, arterial phase A filling defect of soft tissue ... symptoms, history and imaging studies may be misleading A renal AVM was found to be the cause of massive hematuria in this 72-year-old man with a long-standing history of smoking; reminding us...
  • 4
  • 159
  • 0
Báo cáo y học:

Báo cáo y học: " Persistent resistance to HIV-1 infection in CD4 T cells from exposed uninfected Vietnamese individuals is mediated by entry and post-entry blocks" potx

Báo cáo khoa học

... (1) , 2000 (4) 19 98 (1) 19 98 (11 ) 19 98 (1) , 19 99 (1) 19 98 (1) , 19 99 (1, 7), 2004 (6) 19 98 (1) , 2000 (4, 8), 2004 (6) 19 98 (1) , 20 01 (1, 4) 19 98 (1, 11 ), 2004 (1) 19 98 (11 ), 19 99 (1, 7) Restricted ... obtained after stimulation for three days with phytohemagglutinin (PHA, µg/ml) and interleukin-2 (IL2) (Chiron, France, 10 0 IU/ml) and were maintained in RPMI 16 40 medium containing 10 % fetal calf ... cell and CD8 cellmediated resistance to HIV -1 infection in exposed uninfected intravascular drug users in Vietnam Aids 2003, 17 (10 ) :14 25 -14 34 Paxton WA, Liu R, Kang S, Wu L, Gingeras TR, Landau...
  • 12
  • 377
  • 0
Báo cáo y học:

Báo cáo y học: "Prehospital therapeutic hypothermia after cardiac arrest - from current concepts to a future standard" pot

Báo cáo khoa học

... et al [13 ] In the final anal- ysis, elective cranial cooling was initiated after ROSC in 20 patients compared to 25 patients serving as a non-randomized control group A mild decrease ( -1. 1°C) in ... on Scandinavian Therapeutic Hypothermia Guidelines, Clinical Practice Committee Scandinavian Society of Anaesthesiology and Intensive care Medicine: Scandinavian Clinical practice guidelines ... temperature of 33.83 ± 0.77°C (n = 11 , -1. 34°C decrease compared to initial nasopharyngeal temperature) [16 ] No apparent increase in the rate of rearrest or haemodynamic instability was observed, and...
  • 6
  • 312
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Mapping of a milk production quantitative trait locus to a 1.056 Mb region on bovine chromosome 5 in the Fleckvieh dual purpose cattle breed" pps

Báo cáo khoa học

... http://www.gsejournal.org/content/43 /1/ 8 LRT LRT 12 5 12 4 12 3 12 2 12 1 12 0 11 9 11 8 11 7 11 6 11 5 11 4 24 22 20 18 16 14 12 10 MY1 PY1 FY1 A0 Homo 12 5 12 4 12 3 12 2 12 1 12 0 11 9 11 8 11 7 11 6 11 5 11 4 11 3 11 2 12 5 12 4 12 3 12 2 ... 11 2903902 -11 2909263 ATTTGCCCTGCTAGCTTTGA AAGACTCTGGGCTTCAAAAGG Set1 DIK 212 2 11 4.68 11 3 216 193 -11 3 216 706 CAACAAACTGTGCGTTGTGA ACTCAGCAGTTGCCCTCAGT Set3 BM2830 11 6. 91 115 262054 -11 5262075 AATGGGCGTATAAACACAGATG TGAGTCCTGTCACCATCAGC ... DIK2035 12 0.85 11 9370626 -11 93 711 27 CAGTCAATGCAGGAAAAGCA GCTGCTAGAGGGAGACAGGA Set3 13 DIK5277 12 1.53 12 0099447 -12 010 0247 ACCCAAACTTAGCGTGGATG GTCTCCAAGGCTGCTCACTC Set3 14 DIK 510 6 12 1.47 11 84 612 14 -11 84 616 02...
  • 11
  • 357
  • 0
luận án tiến sĩ lifting from sl(2) to gspin(1,4)

luận án tiến sĩ lifting from sl(2) to gspin(1,4)

Tiến sĩ

... k ( 1) p aa := a0 + k aa := a0 + a 1 ···νp i 1 iν2 · · · iνp , 1 1
  • 114
  • 212
  • 0
Tài liệu Reversed Food Chain – From the Plate to the Farm Priorities in Food Safety and Food Technology for European Research potx

Tài liệu Reversed Food Chain – From the Plate to the Farm Priorities in Food Safety and Food Technology for European Research potx

Cao đẳng - Đại học

... Investigate Animal – Man/Plant – Man Transferability Looking at recent food crises, the topic of transferability from animal and plant to man is gaining evidence with regards to BSE The full traceability ... rise to many new packaging and vending solutions aimed at increasing convenience 11 This research issue points into the direction of work already done in the area of functional food, but enlarging ... consumers are less interested in information concerning food, as food is usually regarded to be safe This changes in the case of a food crisis Information demand increases dramatically, and information...
  • 59
  • 537
  • 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

Vật lý

... 26 Hashimotoa H, Yokoyamab S, Asaokaa H, Kusanoc Y, Ikedad Y, Senoe M, Takadaa J, Fujiia T, Nakanishia M, Murakami R (2007) J Magn Magn Mater 310 :2405 doi :10 .10 16/j.jmmm.2006 .10 .793 12 3 ... (2005) Biomaterials 26:729 doi :10 .10 16/j.biomaterials 2004.03. 016 10 Hyeon T, Lee SS, Park J, Chung Y, Na HB (20 01) J Am Chem Soc 12 3 :12 798 doi :10 .10 21/ ja 016 812 s 11 Sapieszko RS, Matijevic E (19 80) ... show amorphous precipitate was obtained instead of a- FeOOH nanorods in alcohol/water media (5 :1) without F127 Obviously, F127 plays an important role in the formation of a- FeOOH nanorods as a structuredirecting...
  • 4
  • 658
  • 0
From Cancer Patient to Cancer Survivor - Lost in Transition: An American Society of Clinical Oncology and Institute of Medicine Symposium pot

From Cancer Patient to Cancer Survivor - Lost in Transition: An American Society of Clinical Oncology and Institute of Medicine Symposium pot

Sức khỏe giới tính

... Halsted radical mastectomy Again, it is really shocking to think that this is the way we managed breast cancer at that point in time The NSABP B-4 trial was a randomized trial that compared the Halsted ... policymakers to act to ensure that all cancer survivors have access to adequate and affordable 18 FROM CANCER PATIENT TO CANCER SURVIVOR health insurance Furthermore, insurers and payers of health ... National Academy of Sciences The National Academy of Engineering was established in 19 64, under the charter of the National Academy of Sciences, as a parallel organization of outstanding engineers...
  • 196
  • 280
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx

Hóa học - Dầu khí

... foam-lined clear plastic snap-lock case inserted into a plastic zip lock bag This was placed inside a cardboard shipping container lined with 1 thick Styrofoam An alternate packaging design was ... late stages of apoptosis (Annexin V+, 7AAD+); (C) CD8 lymphocytes in early stages of apoptosis (Annexin V+, 7AAD-) and (D) late stages of apoptosis (Annexin V+, 7AAD+) Shaded region indicates control ... containers by contracted overnight carriers is associated with large seasonal variations in temperature inside the packaging, ranging from -1 C in winter to 35°C in summer, with most in the range...
  • 13
  • 606
  • 0
INTERNATIONAL STANDARD ON AUDITING 710 (REDRAFTED)statements, whether due to fraud or error. In pdf

INTERNATIONAL STANDARD ON AUDITING 710 (REDRAFTED)statements, whether due to fraud or error. In pdf

Kế toán - Kiểm toán

... responsibility includes: the designing, implementationing and maintenanceaining of internal control relevant to the preparation and fair presentation of financial statements that are free from material misstatement, ... preparation and fair presentation 29 of these financial statements in accordance with International Financial Reporting Standards This responsibility includes: designing, implementing and maintaining internal ... fair presentation of financial statements that are free from material misstatement, whether due to fraud or error; selecting and applying appropriate accounting policies; and making accounting...
  • 10
  • 291
  • 0

Xem thêm