energy metabolism and hydrolases
Báo cáo khoa học: Pyruvate:ferredoxin oxidoreductase and bifunctional aldehyde–alcohol dehydrogenase are essential for energy metabolism under oxidative stress in Entamoeba histolytica pdf
... O2 exposure and ROS inhibition, which has not been previously evaluated in this enzyme; and (b) to analyze the effects of oxidative stress on glycolytic and fermentative enzymes and pathway uxes ... centrifuged and resuspended in normoxic (0.18 0.09 mM O2 at 36 C and 2240 m altitude) NaCl Pi + glucose and returned to the water bath At different time intervals, samples were centrifuged, and enzyme ... 4) and 0.176 Uặmg)1 (n = 1) for PFOR, ALDH and ADH for EhADH2, and acetyl-CoA synthetase, respectively (from Table 2) (C) For metabolite concentrations, 100% means the amounts of ethanol and...
- 14
- 420
- 0
Báo cáo khoa học: Galanin-like peptide and the regulation of feeding behavior and energy metabolism pptx
... compilation ª 2010 FEBS 5009 GALP in feeding and energy metabolism K Shiba et al Effect of GALP on feeding behavior and energy metabolism Galanin and biologically active fragments such as galanin ... involved in feeding behavior and energy metabolism via neuronal circuits formed with several types of appetite-regulating peptide-containing GALP in feeding and energy metabolism neurons The present ... activation of orexin- and ⁄ or NPY-expressing neurons, and that long-term body weight loss is a result of the promotion of energy expenditure GALP in feeding and energy metabolism ported in part...
- 8
- 503
- 0
Báo cáo y học: "Regional characterization of energy metabolism in the brain of normal and MPTP-intoxicated mice using new markers of glucose and phosphate transport" doc
... EL and HA: carried out the immunofluorescence assays and drafted the manuscript; JLB and MS: conceived the envelope-derived tagged ligands while; JLB, HA, ML and JT: generated, optimized and ... of the inorganic phosphate (Pi) and glucose transporter in the brain of normal and MPTPintoxicated mice Pi and glucose represent key molecules in cellular energy metabolism The mitochondrion membrane ... comprising the signal peptide, the RBD and the proline-rich region, to the rFc tag, herein, referred to as GRBD HRBD, AmphoΔSU and GRBD tagged ligands, and control conditioned medium were produced...
- 9
- 776
- 1
Báo cáo khoa học: "Influence of insulin on glucose metabolism and energy expenditure in septic patients" ppsx
... insulin in septic patients and volunteers, for each parameter we opted to calculate the differences between steps and 1, and between step and baseline for each individual, and we tested the differences ... sepsis and multiple organ failure Eur J Clin Nutr 1999, Suppl 1:S143-S147 34 Frayn KN, Macdonald IA: Assessment of substrate and energy metabolism in vivo In Clinical Research in Diabetes and Obesity ... between baseline and step 1, and between step and step EE at baseline was significantly greater in septic patients than in volunteers The differences between septic patients and volunteers in...
- 8
- 344
- 0
Metabolism, energy, redox and glycosis
... acids Membrane lipids Nucleotides in DNA and RNA Cofactors needed for the metabolism Four Major Pathways of Glucose Utilization • When there’s plenty of excess energy, glucose can be stored in the ... Short-term energy needs are met by oxidation of glucose via glycolysis • Pentose phosphate pathway generates NADPH that is used for detoxification, and for the biosynthesis of lipids and nucleotides ... of the oxidation free energy in captured by the synthesis of ATP and NADH • Research of glycolysis played a large role in the development of modern biochemistry – Understanding the role of coenzymes...
- 15
- 173
- 0
Changes of temperature data for energy studies over time and their impact on energy consumption and CO2 emissions. The case of Athens and Thessaloniki – Greece
... measures applied to dwellings Energy and Buildings 200, 37, 982-95 Frank Th Climate change impacts on building heating and cooling energy demand in Switzerland Energy and Buildings 2005, 37, 1175-85 ... the summer energy demand and on the performance factor of the cooling system The primary energy for heating Qhp and cooling Qcp were determined from the thermal Qht and the electric Qce energy, ... proportional to the energy demand for heating and cooling is the fuel (diesel oil) and electricity consumption and hence the CO2 emissions, presented in Tables and 10, for Athens and Thessaloniki...
- 14
- 548
- 0
Energy efficiency and cost analysis of canola production in different farm sizes
... relation between energy inputs and output [20] Based on the energy equivalents of inputs and outputs, the indices of energy use efficiency, energy productivity, specific energy and net energy were ... energy inputs were divided into direct and indirect and renewable and non-renewable energy forms [18] Direct energy consisted of human labour, diesel fuel and electricity; whereas, indirect energy ... Eqs [8]: Energy use efficiency = (Energy output (MJ ha-1)) / (Energy input (MJ ha-1)) (1) Energy productivity = (Canola output (kg ha-1)) / (Energy input (MJ ha-1)) (2) Specific energy = (Energy...
- 8
- 473
- 0
Tài liệu ENERGY, POWER, AND POLLUTION CONTROL TECHNOLOGY P1 pdf
... velocity of sound Condensed and in some cases converted from U.S Standard Atmosphere 1976, National Oceanic and Atmospheric Administration and National Aeronautics and Space Administration, Washington, ... °E Lange, L F Sokol, and V Antoine, Information on the Metric System and Related Fields, 6th ed., G C Marshall Space Flight Center, AL (exhaustive bibliography); C H Page and P Vigoureux, The ... liquid Condensed, converted, and interpolated from the tables of M P Vukalovich, A I Ivanov, L R Fokin, and A T Yakovlev, Thermophysical Properties of Mercury, Standartov, Moscow, USSR, 1971...
- 24
- 356
- 0
Tài liệu ENERGY, POWER, AND POLLUTION CONTROL TECHNOLOGY P2 docx
... products and R reactants, s signifies sensible enthalpy, and the bhs are looked up in the table for the appropriate temperatures If the actual reaction was C2H2 + U/2O2 -» 2CO2 + H2O + 3O2 then W = and ... Converted and usually rounded off from JANAF Thermochemical Tables, NSRDS-NBS-37, 1971 foTo illustrate the term sensible enthalpy, which is the difference between the actual enthalpy and the enthalpy ... transfer, in kJ/kg • mol fuel and in kJ/kg fuel, will be calculated for the steady-state combustion of acetylene in excess oxygen, the reactants entering at 298.15 K and the products leaving at...
- 20
- 338
- 0
Chapter 02 ENERGY, ENERGY TRANSFER, AND GENERAL ENERGY ANALYSIS
... forms of energy that constitute the total energy 2–5C How are heat, internal energy, and thermal energy related to each other? 2–6C What is mechanical energy? How does it differ from thermal energy? ... forms of microscopic energies that make up sensible energy Sensible and latent energy Chemical energy Nuclear energy FIGURE 2–6 The internal energy of a system is the sum of all forms of the microscopic ... are in motion and thus possess kinetic energy Heat is then defined as the energy associated with the random motion of atoms and molecules Although it was suggested in the eighteenth and early nineteenth...
- 60
- 813
- 0
Tài liệu Total Energy Expenditure and Energy Requirements in Healthy Elderly Persons ppt
... between the three components pf daily energy expenditure (TEE, RMR, and EEPA) and Vo2max Table Components of Daily Energy Expenditure, Reported Energy Intake, and LTA in 13 Elderly Subjects TEE ... of CO? and water production rates in man using ?H, 180-labelled HzO: Comparisons between calorimeter and isotope values, in van Es AJH (ed): Human Energy Metabolism: Physical Activity and Energy ... SF: Relation of age and physical exercise status on metabolic rate in younger and older healthy men J Gerontol46:B54-B58.1991 Calloway DH, Zanni E: Energy requirements and energy expenditure of...
- 10
- 474
- 0
Tài liệu Crack the Fat-Loss Code: Outsmart Your Metabolism and Conquer the Diet Plateau ppt
... Create an Energy Deficit 51 Key 4: Produce Heat 53 Key 5: Manipulate Energy Stores 55 Eight Weeks to Cracking the Code and Breaking Your Plateau: Two Months to a Brand-New You Understanding the ... Evans, Jenny Young, and Jane Scrima for all the continued referrals and belief in me and the ForeverFit message Love and appreciation goes out to my love Scott Tate; to friends and supporters Donielle ... passion, knowledge, and mission to spread the truth and teach others the real deal about fi tness and weight loss Her food plans are incredibly easy to follow, and her humor and way of motivating...
- 306
- 873
- 1
Tài liệu Energy Research at DOE WAS IT WORTH IT? Energy Efficiency and Fossil Energy Research 1978 to 2000 docx
... Energy Research at DOE WAS IT WORTH IT? Energy Efficiency and Fossil Energy Research 1978 to 2000 Committee on Benefits of DOE R&D on Energy Efficiency and Fossil Energy Board on Energy and ... Benefits of DOE R&D on Energy Efficiency and Fossil Energy wishes to acknowledge and thank the staffs of the Office of Energy Efficiency and Renewable Energy and the Office of Fossil Energy for their ... successes and failures of DOE’s research program would be a very frustrating and puzzling enterprise Energy Efficiency and Fossil Energy Research at DOE The two program areas energy efficiency and...
- 241
- 241
- 0
Tài liệu Renewable Energy Technology , and Environment Economics doc
... following forms of energy are distinguished: mechanical energy (i.e potential or kinetic energy) , thermal, electric and chemical energy, nuclear energy and solar energy In practical energy appliances, ... energy content of the secondary energy carrier and the corresponding energy flow This processing of primary energy is subject to conversion and distribution losses Secondary energy carriers and ... base standard for evaluating energy provision options based on renewable energy sources 1.1 Energy system Our current living standard could not be maintained without energy The provision of energy...
- 590
- 359
- 0
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx
... between donor and acceptor dyes, will therefore unveil the status of physical union and separation of complementary strands during renaturation and strand exchange, respectively, and thereby assesses ... renaturation (A) and strand exchange (B) reactions mediated by OsDmc1 protein Phi-C and Phi-W represent rhodamine and fluorescein carrying strands, respectively, at their 3¢ and 5¢ ends The assays ... was shown to catalyze the strand exchange and strand assimilation in a homology dependent manner [12] Recent studies on hDmc1 showed that it was able to mediate the strand exchange reaction at least...
- 10
- 568
- 0
Tài liệu Báo cáo khoa học: 1. Signal Transduction 1.1 Integration of Metabolism and Survival pdf
... compensated for temperature and nutrtional changes Extensive studies of metabolism and micromolecular synthesis indicate that an oscillatory alternation between oxidative and reductive states underlies ... mice revealed that DBP, HLF, and TEF regulate primarily the transcription of genes involved in hepatic, renal, and intestinal detoxification and genes of the innate and adaptive immune system REV-ERBalpha, ... role is to control 1.5 Signaling and Cancer: Nuclear Receptor Connection S1.5-1 Androgen action and prostate carcinogenesis F Saatcioglu ¸ ˘ Division of Cellular and Molecular Biology, Department...
- 6
- 524
- 0
Tài liệu Báo cáo khoa học: Oral Presentations Integration of Metabolism and Survival pdf
... lymph nodes and surgical margins, and blood samples from patients and 868 controls Combining genomic and proteomic techniques, differences in gene and protein expression profiles from HNSCC and normal ... Acpc), and b-methylphenylalanine were designed and synthesized to obtained more potent and more selective l- and dopioid receptor ligands or higher stability against proteolytic enzymes Radioligand-binding ... the total energy of macromolecular solvation, solvent expulsion or retention during ligand dock, protein–protein and protein–DNA interaction energy due to complex formation desolvation and complex...
- 35
- 676
- 0
Tài liệu Báo cáo khoa học: Abstract Integration of Metabolism and Survival PP-1 The metabolic switch in liver methionine metabolism pptx
... CREB activation and its consequences on SMC migration and OPN regulation Stimulation of cultured SMC by UTP and PDGF-BB highly induces CREB activation via ERK1/2 and p38, and via p38 and PKA respectively ... degradation and phosphorylation of IjB, nuclear p65 translocation, NFjB DNA binding and NFjB-luciferase gene reporter), and to induce transcription and/ or expression of the inflammatory cytokines TNFa and ... in vitro and in vivo, and also upregulated the transcription and expression of TNFa and MIP-2 Conclusion: Flagellin is a potent mediator of proinflammatory signaling in cardiomyocytes and may represent...
- 291
- 612
- 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot
... changes are relayed between the TMD and NBD, and how they enable drug translocation Transmembrane helix (TM6) and transmembrane helix 12 (TM12) are likely candidates to effect coupling, given ... purchased from Lonza (Wokingham, UK) and Excell 405 from SAFC Biosciences (Andover, UK) CM, FM and BM were purchased from Molecular Probes (Leiden, The Netherlands) Site-directed mutagenesis of ... reduce glycerol content, and centrifuged for 30 at 125 000 g and °C to remove unbound probe The pellet was washed and then resuspended in 20 lL Laemmli sample buffer, and proteins were resolved...
- 12
- 380
- 0
Báo cáo khoa học: Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? doc
... are Asp281 and Asp301 The histidine and lysine residues equivalent to His315 and Lys374 of the porcine ICDH (His343 and Lys402 in P f ICDH) are also conserved in the parasite protein and these ... 2003 1776 C Wrenger and S Muller (Eur J Biochem 270) ¨ in the parasite genome it is possible that NADP+-dependent ICDH in P falciparum is involved in both, energy metabolism and redox control In ... GTCTCGAATGAACATATGCGGTAAAATTAACGT AG-3¢ and antisense 5¢-GCGCGCGGTCTCAGCGCT TGTTGAATGTTCTTGGGGAGC-3¢ containing BsaI restriction sites and ICDH-1 as a template and the following PCR programme: at...
- 9
- 345
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008