0

discovery of mk 0536 a potential second generation hiv 1 integrase strand transfer inhibitor with a high genetic barrier to mutation

Báo cáo y học:

Báo cáo y học: " Substitution of the Rev-response element in an HIV-1-based gene delivery system with that of SIVmac239 allows efficient delivery of Rev M10 into T-lymphocytes" ppsx

Báo cáo khoa học

... pN-EF1α-EGFP-2AM10 /HIV- 1 pN-EF1α-EGFP-2AM10 /HIV- 1 pN-EF1α-EGFP/SIV pN-EF1α-EGFP-2AM10/SIV pN-EF1α-EGFP-2AM10/SIV pN-EF1α-EGFP-2AM10/SIV pN-EF1α-EGFP /HIV- 1 pN-EF1α-EGFP-2AM10 /HIV- 1 pN-EF1α-EGFP-2AM10 /HIV- 1 ... μg HIV- 1 HIV- 1 1 .1 ± 0 .1 × 10 5 9.5 ± 0.3 × 10 2 11 9 1. 50 μg HIV- 1 5.8 ± 2.3 × 10 2 19 6 3.00 μg HIV- 1 5.7 ± 0 .1 × 10 2 2 01 pN-EF1α-EGFP/SIV pN-EF1α-EGFP-2AM10/SIV pN-EF1α-EGFP-2AM10/SIV pN-EF1α-EGFP-2AM10/SIV ... virus type Page 12 of 13 (page number not for citation purposes) AIDS Research and Therapy 2008, 5 :11 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 vectors produced in stable packaging cell...
  • 13
  • 357
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Acute toxicity of second generation HIV protease-inhibitors in combination with radiotherapy: a retrospective case series" pptx

Báo cáo khoa học

... chronological order of FDA approval, saquinavir, ritonavir, indinavir, nelfinavir, lopinavir, atazanavir, fosamprenavir (pro-drug of amprenavir, which is no longer available), tipranavir, and darunavir ... dysregulation may increase radiosensitivity [13 -15 ] However, radiation therapy remains a cornerstone of therapy in a number of cancers such as anal cancer [16 ], prostate [17 ], breast [18 -20], and cervical ... Samaras K, Chisholm DJ, Cooper DA: Pathogenesis of HIV- 1protease inhibitor- associated peripheral lipodystrophy, hyperlipidaemia, and insulin resistance Lancet 19 98, 3 51( 911 9) :18 81- 1883 26 Murata...
  • 8
  • 357
  • 0
Báo cáo y học:

Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

Y học thưởng thức

... event-related brain potentials in response to a semantic priming paradigm in families with a history of alcoholism American Journal of Human Genetics 20 01; 68 :12 8 -13 5 96 Tsichiya H, Yamaguchi S, Kobayashi ... via studies of the MMN [10 3] 15 2 10 11 12 13 14 15 16 17 18 Closing Remarks Each of the specific components of the Event-Related Potential discussed in this review plays specific and significant ... DL A “passive” event-related potential? International Journal of Psychophysiology 19 98; 28 :11 - 21 63 Zenker F, Barajas JJ Age-Related variations in P300 elicited by active, passive and single-tone...
  • 8
  • 563
  • 0
Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf

Báo cáo khoa học: Transcriptome profiling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf

Báo cáo khoa học

... reagent (Invitrogen) and purified with an RNAeasy column (Qiagen) RNA quality was assessed with a 210 0 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) Homemade cDNA microarrays containing ... Knight-Carpentar T & Williams BC (19 99) Inhib- 11 12 13 14 15 16 17 18 19 itory effect of Ginkgo biloba extract on human platelet aggregation Platelets 10 , 298–305 Koltermann A, Hartkorn A, Koch ... 3.54 395 1. 92 1. 28 0.39 1. 23 13 4 18 1 210 6 18 13 2.84 a ± ± ± ± ± ± ± ± ± ± 11 0.08 0. 01 0.07 0 .17 54 80 513 16 22 0 .17 ± ± ± ± ± ± ± ± ± ± 40 0 .1 9a 0 .1 8a 0.06 0 .1 5a 13 2 96 14 93b 867 0.8 4a ± ± ±...
  • 9
  • 506
  • 0
The A to Z of Plant Names: A Quick Reference Guide to 4000 Garden Plants

The A to Z of Plant Names: A Quick Reference Guide to 4000 Garden Plants

Sinh học

... flowers) Eur alder Alnus European A glutinosa grey A incana green A viIidis hazel A selTulata Italian A cordata Japanese A japonica red A rubra Sitka A viIidis subsp sinuata thinleaf A incana subsp ... combination) laciniatusllaciniatallaciniatum, la�sin�ee�ah�toos/tuhltoom Lat deeply cut maculatuslmaculatalmaculatum mak�ew�lah� toosltuhltoom Lat spotted mak�rofmacrophyllus/macrophyllalmacrophyllum ... violet Saint paulia ionantha Agapanthus L' Her (Amaryllidaceae) a- guh-panth-oos Gk love flower 10 spp herbs S Africa africanus (L.) Hoffmanns af-ri-kah-noos African campanulatus F M Leight kam-panew-lah-toos...
  • 487
  • 427
  • 0
Báo cáo khoa học: Physicochemical characterization of carboxymethyl lipid A derivatives in relation to biological activity docx

Báo cáo khoa học: Physicochemical characterization of carboxymethyl lipid A derivatives in relation to biological activity docx

Báo cáo khoa học

... lgÆmL )1 100 ngÆmL )1 10 ngÆmL )1 ngÆmL )1 100 pgÆmL )1 > 12 5 > 12 5 > 12 5 61. 5 > 12 5 > 12 5 82.8 > 12 5 11 .3 76 .1 23.6 12 .5 45.84 1. 76 15 .6 11 .8 4.5 1. 96 0.89 3 .16 2.20 1. 43 > 12 5 Antagonistic activity ... agonists a conical shape of the lipid A moiety with a high inclination angle of the acyl chains with respect to the membrane surface and for antagonists a cylindrical shape with a low inclination ... 7-Nitrobenz-2-oxa -1, 3-diazolformed automatically between 10 and 70 °C with a heating 11 4-yl (NBD) phosphatidylethanolamine (NBD-PE) and rhod )1 rate of 0.6 °CÆmin For measurement of hydrated samamine...
  • 14
  • 392
  • 0
Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

Báo cáo khoa học

... pancreas, mammary gland, testis, vagina (Fig 2C), etc (Fig S2) Analyses of hematological and biochemical parameters showed mild increases in aspartate FEBS Journal 278 (2 011 ) 15 61 15 72 ª 2 011 ... Lamond AI & Weis K (19 98) Cloning and characterization of hSRP1 gamma, a tissue-specific nuclear transport factor Proc Natl Acad Sci USA 95, 582–587 10 Kamei Y, Yuba S, Nakayama T & Yoneda Y (19 99) ... and female impa5) ⁄ ) mice Each pair (male ⁄ female = : 1) was transferred to a mating cage for 28 days The cages were monitored daily and for an additional 28 days, and the numbers of pregnant...
  • 12
  • 346
  • 0
báo cáo hóa học:

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

Hóa học - Dầu khí

... manuscript and read and approved the final manuscript Additional material Additional file Analysis of covariance of each subscale of SF-36 (n = 227) with respect to SOC adjusted for sex, age group, marital ... 26 39.7 12 .7 6.3 41. 3 38 35 10 14 4 16 .7 15 .4 4.4 63.4 76 70 18 46.3 42.7 11 .0 21 32 10 33.3 50.8 15 .9 97 10 2 28 42.7 44.9 12 .3 14 6 18 89.0 11 .0 52 11 82.5 17 .5 19 8 29 87.2 12 .8 Functional Comorbidity ... health score, associated with marked feelings of nervousness and depressions, to high mental health, associated with peaceful, happy and calm feelings [ 31] A systematic review of the SOC -13 and...
  • 9
  • 844
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx

Hóa học - Dầu khí

... submitted to GenBank are; H3: AY5 310 39–AY5 310 46, AY5 310 48–AY5 310 49, AY5 310 51 AY5 310 52, AY5 310 54, AY5 310 56– AY5 310 57, EU103820–EU103823, EU1036 31 EU1038 19 , N2: AY5 310 06–AY5 310 13, AY5 310 15–AY5 310 16, AY5 310 18–AY5 310 20, ... A/ Denmark /11 / 01 100 10 0 A/ Denmark/20/ 01 2000-20 01 2000-20 01 A/ Texas/36/ 91 A/ Johannesburg/82/96 A/ Denmark/40/ 01 94 A/ Denmark /17 / 01 100 A/ Denmark /14 / 01 2000-20 01 A/ Denmark/06/ 01 A/ Denmark /14 / 01 10 10 0 A/ Denmark/40/00 ... 19 1 19 4 202 215 237Ca1 239 252 253 267 2 71 273 310 315 3 21 345 382 398 4 51 473 4 91 506 510 53 56 66 78 80 88 93 96 10 0 12 4 13 4 13 6 14 9 15 6 16 6 16 9 17 1 17 3 17 7 18 1 18 6 18 8 19 0 19 3 19 4 19 7 205 218 ...
  • 19
  • 579
  • 0
Báo cáo y học:

Báo cáo y học: " Management of HIV-1 associated hepatitis in patients with acquired immunodeficiency syndrome: role of a successful control of viral replication" ppsx

Báo cáo khoa học

... of HIV- 1 RNA and ALT/AST levels Aminotransferase (AST and ALT) values and plasma HIV- RNA levels in the three patients before and after the beginning of an effective HAART Normalization of both ... [11 ] Only a few cases of AIH, in which a role of HIV- 1 as a causative agent was hypothesized, have been described [12 ,13 ] Viral infections may play a triggering role in the activation of auto-reactive ... grants Ricerche di Ateneo Federato 2007 e 2009 - recipient Ivano Mezzaroma, MD Page of 10 11 12 13 14 lopinavir/ritonavir, each in combination with tenofovir and emtricitabine, for management of...
  • 5
  • 326
  • 0
Báo cáo y học:

Báo cáo y học: "Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal" pot

Báo cáo khoa học

... a, leu2-3, 11 2 trp1 -1 ura3 -1 ade2 -1 his 311 ,15 ) and srp1- 31 (MAT a, leu2-3, 11 2 trp1 -1 ura3 -1 ade 21 his3 -11 ,15 , srp1- 31) strains were kind gifts from G Fink (Whitehead Institute, Massachusetts ... site, to facilitate screening The primers used were: 15 2-IN: 5'-CCCGCAGTCTCAGGGTGTTGTTTAAACTATGAACAAAGAGCTC-3' 18 0-IN: 5'-CCGCGGTTCAGATGGCTGTTTAAACCACAA CAAGAAACG-3' Construction of plasmids ... incubated with 15 0 μM of the indicated peptide for h prior to infection HIV- 1 titration by multinuclear activation of a galactosidase indicator (MAGI) assay Quantitative titration of HIV- 1 was carried...
  • 16
  • 292
  • 0
Báo cáo y học:

Báo cáo y học: " Mode of inhibition of HIV-1 Integrase by a C-terminal " docx

Báo cáo khoa học

... http://www.retrovirology.com/content/3 /1/ 34 References 10 11 12 13 14 15 16 17 18 19 20 21 Katz RA, Skalka AM: Retroviral Enzymes Annu Rev Biochem 19 94, 63 :13 3 -17 3 Asante-Appiah E, Skalka AM: Molecular mechanisms in retrovirus DNA ... integrase protein and viral DNA Nucl Acids Res 19 94, 22: 410 3- 411 0 Asante-Appiah E, Skalka AM: A metal-induced conformational change and activation of HIV- 1 integrase J Biol Chem 19 97, 272 :16 196 -16 205 ... on enzymatic activity J Biol Chem 19 97, 272 :18 1 61- 1 816 8 Bujacz G, Jaskolski M, Alexandratos J, Wlodawer A, Merkel G, Katz RA, Skalka AM: The catalytic domain of avian sarcoma virus integrase: conformation...
  • 10
  • 206
  • 0
Báo cáo y học:

Báo cáo y học: " In-Silico docking of HIV-1 integrase inhibitors reveals a novel drug type acting on an enzyme/DNA reaction intermediate" pdf

Báo cáo khoa học

... 2004, 21: 5263-5267 Sato M, Motomura T, Aramaki H, Matsuda T, Yamashita M, Ito Y, Kawakami H, Matsuzaki Y, Watanabe W, Yamataka K, Ikeda S, Kodama E, Matsuoka M, Shinkai H: Novel HIV- 1 integrase inhibitors ... discordant resistance between mechanistically identical inhibitors of HIV- 1 integrase Proc Natl Acad Sci USA 2004, 31: 112 33 -11 238 Bujacz G, Alexandratos J, Wlodawer A, Merkel G, Andrake M, Katz RA, ... Hazuda DJ: HIV- 1 integrase inhibitors that compete with the target DNA substrate define a unique strand transfer conformation for integrase Proc Natl Acad Sci USA 2000, 21: 112 44 -11 249 Hazuda...
  • 15
  • 343
  • 0
The Practice of System and Network Administration Second Edition phần 1 docx

The Practice of System and Network Administration Second Edition phần 1 docx

Quản trị mạng

... Customers Happy 4 5 10 11 12 12 13 13 14 14 15 vii viii Contents 1. 20 1. 21 1.22 1. 23 1. 24 1. 25 1. 26 1. 27 1. 28 1. 29 1. 30 1. 31 1.32 1. 33 1. 34 1. 35 1. 36 1. 37 1. 38 1. 39 1. 40 1. 41 1.42 1. 43 1. 44 1. 45 ... 1. 9 1. 10 1. 11 1 .12 1. 13 1. 14 1. 15 1. 16 1. 17 1. 18 1. 19 Building a Site from Scratch Growing a Small Site Going Global Replacing Services Moving a Data Center Moving to/ Opening a New Building Handling ... Integrity 10 .1 258 2 61 2 61 Definition of a Disaster 262 10 .1. 2 Risk Analysis 262 10 .1. 3 Legal Obligations 263 10 .1. 4 Damage Limitation 264 10 .1. 5 Preparation 265 10 .1. 6 10 .2 The Basics 10 .1. 1 Data Integrity...
  • 106
  • 451
  • 0
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

Báo cáo khoa học

... receptor and inhibition of steroidogenesis by an Ó FEBS 2002 15 16 17 18 19 20 21 22 HIV TAT-CRAC peptide Proc Natl Acad Sci USA 98, 12 67± 12 72 Hughes, J., Astriab, A. , Yoo, H., Alahari, S., Liang, ... was proposed as the reason of this apparent increased uptake, as the rate of uptake was the same in serum-free medium [17 ] As already stated above, this Tat CPP peptide is able to vectorize various ... thus appears unlikely The number of arginine residues within the Tat peptide appeared to be the main determinant for maintaining a high translocating activity as previously shown by alanine-arginine...
  • 8
  • 485
  • 0
Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx

Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx

Báo cáo khoa học

... 16 217 6 16 618 0 17 018 4 17 418 8 18 219 6 18 6200 210 224 214 228 218 232 222236 238252 242256 246260 HIV IN residues 9 410 7 9 811 6 12 614 5 13 014 9 13 915 3 15 116 5 16 317 7 16 718 1 17 919 3 18 72 01 1 912 05 19 5209 223237 ... Engelman A, Mizuuchi K & Craigie R (19 91) HIV- 1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer Cell 67, 12 111 2 21 FEBS Journal 278 (2 011 ) 316 330 ê 2 010 The Authors Journal ... Nguyen BY, Katlama C, Gatell JM, Lazzarin A, Vittecoq D, Gonzalez CJ, Chen J, Harvey CM & Isaacs RD (2007) Safety and efcacy of the HIV- 1 integrase inhibitor raltegravir (MK- 0 518 ) in treatment-experienced...
  • 15
  • 343
  • 0
Báo cáo y học:

Báo cáo y học: "Cerebrospinal fluid neopterin: an informative biomarker of central nervous system immune activation in HIV-1 infection" ppt

Báo cáo khoa học

... development and widespread clinical use of quantitative assays of HIV- 1 RNA that provided a valuable practical guide to the pace of disease progression and the effects of treatment In parallel attention ... ADC/HIVE [6,9 ,10 ] Attention also shifted to other quantitative methods, including anatomical and functional neuroimaging and neuropsychological testing, to advance diagnosis and patient characterization ... reductase inhibitors (statins) and salicylic acid [22] The cytokine-induced formation of neopterin appears to be part of the antimicrobial and antineoplastic action of macrophages [23] A strong...
  • 12
  • 321
  • 0
Báo cáo y học:

Báo cáo y học: " The L76V mutation in HIV-1 protease is potentially associated with hypersusceptibility to protease inhibitors Atazanavir and Saquinavir: is there a clinical advantage" potx

Báo cáo khoa học

... 98G 11 8I 18 4V 210 W 215 Y 227L 41L 44D 10 3N 11 8I 18 4V 210 W 215 Y no data no data no data 67N 70R 10 3S 18 4V 19 0A 215 F 219 Q 41L 67N 75I 11 8I 210 W 215 F 41L 4 4A 67N 75M 10 1Q 11 8I 18 4V 210 W 215 F 41L 74V ... 67ss 69S 10 1Q 18 1C 19 0S 215 Y 65R 70R 10 3N 10 8I 11 5F 15 1M 17 9E 18 4V 219 E 67N 18 4V 210 W 215 Y 219 Q 41L 44D 67N 75L 11 8I 18 1C 18 4V 19 0A 210 S 215 Y 41L 44D 67N 70R 19 0A 227L 18 4V 210 W 215 F 219 R 41L 67N ... 70R 74V 10 3N 18 1C 210 W 215 F 219 Q 67N 70R 10 3NS 19 0A 18 4V 219 Q 41L 67N 69E 75I 10 3N 10 8I 11 8I 17 8M 210 W 215 Y 41L 67N 74V 10 1Q 18 4V 215 Y 41L 44D 67N 10 1E 10 3N 11 8I 18 4V 210 W 215 Y 219 E n.d 41L 67ss...
  • 9
  • 434
  • 0
báo cáo khoa học:

báo cáo khoa học: " Lyme neuroborreliosis in HIV-1 positive men successfully treated with oral doxycycline: a case series and literature review" ppsx

Báo cáo khoa học

... at 18 0 cells/μL ART was started with lamivudine, zidovudine and ritonavirboosted lopinavir for one year and was re-started after four years with efavirenz, abacavir and lamivudine One year later, ... later, the symptoms had almost completely disappeared and CSF levels of mononuclear cells and albumin had normalized (Figure 1) Patient This 50-year-old Caucasian man had been diagnosed with HIV ... fluid of symptomatic and asymptomatic human immunodeficiency virus (HIV) seropositive patients Infection 19 88, 16 :13 -18 11 Van Snick S, Duprez TP, Kabamba B, Van De Wyngaert FA, Sindic CJ: Acute...
  • 5
  • 230
  • 0
Báo cáo y học:

Báo cáo y học: "Seroprevalence of hepatitis B and C virus in HIV-1 and HIV-2 infected Gambians" pps

Báo cáo khoa học

... - TTCACGCAGAA AGC GTCTAG and 211 -CACTCTCGAGCAC CCTATCAGGCAGT) and NS5b (HCVN S5F2-TATGA TACC CGCTGCTTTGACTCG; HCVNS 5R2c-CTGG TCATAGCCTCCGTGAAGGCTCTCAGG and HCVN S5 R2d-CTGGTCATAGCCTCCGTGAAGGCTCGTA ... protection of HIV- 2 against HIV- 1 infection AIDS 19 99, 13 :7 01- 707 Schim van der Loeff MF, Hansmann A, Awasana AA, Ota MO, O’Donovan D, Sarge-Njie R, Ariyoshi K, Milligan P, Whittle H: Survival of HIV- 1 ... blood samples We would like to thank Alasana Bah, Bankole Ahadzie and Samreen Ijaz for their assistance Author details Medical Research Council, Fajara, P O Box 273, Banjul, The Gambia 2London...
  • 9
  • 474
  • 0

Xem thêm