elvitegravir a novel monoketo acid hiv 1 integrase strand transfer inhibitor
Báo cáo y học: " In-Silico docking of HIV-1 integrase inhibitors reveals a novel drug type acting on an enzyme/DNA reaction intermediate" pdf
Ngày tải lên :
13/08/2014, 09:20
... between mechanistically identical inhibitors of HIV- 1 integrase Proc Natl Acad Sci USA 2004, 31: 112 33 -11 238 Bujacz G, Alexandratos J, Wlodawer A, Merkel G, Andrake M, Katz RA, Skalka AM: Binding ... of a dual inhibitor of factors IXa and Xa Bioorg Med Chem Lett 2004, 21: 5263-5267 Sato M, Motomura T, Aramaki H, Matsuda T, Yamashita M, Ito Y, Kawakami H, Matsuzaki Y, Watanabe W, Yamataka K, ... DJ: HIV- 1 integrase inhibitors that compete with the target DNA substrate define a unique strand transfer conformation for integrase Proc Natl Acad Sci USA 2000, 21: 112 44 -11 249 Hazuda DJ, Anthony...
- 15
- 343
- 0
Báo cáo y học: "Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal" pot
Ngày tải lên :
12/08/2014, 23:22
... congenic to Saccharomyces cerevisiae W303 The W303 (MAT a, leu2-3, 11 2 trp1 -1 ura3 -1 ade2 -1 his 311 ,15 ) and srp1- 31 (MAT a, leu2-3, 11 2 trp1 -1 ura3 -1 ade 21 his3 -11 ,15 , srp1- 31) strains were kind ... DraI site, to facilitate screening The primers used were: 15 2-IN: 5'-CCCGCAGTCTCAGGGTGTTGTTTAAACTATGAACAAAGAGCTC-3' 18 0-IN: 5'-CCGCGGTTCAGATGGCTGTTTAAACCACAA CAAGAAACG-3' Construction of plasmids ... amplification from pT7-7 -18 0-IN The primers used were: 5'BsrGI: 5'-CCGCCATGTACAAAGAGCTCAAAAAAATCATCGGTCAG-3' BsrGI: 5'-GCGGTATGTACACCAGCAGAGTAACCACCGATAC-3' The resultant DNA products were cloned...
- 16
- 292
- 0
Báo cáo y học: " Mode of inhibition of HIV-1 Integrase by a C-terminal " docx
Ngày tải lên :
13/08/2014, 09:20
... http://www.retrovirology.com/content/3 /1/ 34 References 10 11 12 13 14 15 16 17 18 19 20 21 Katz RA, Skalka AM: Retroviral Enzymes Annu Rev Biochem 19 94, 63 :13 3 -17 3 Asante-Appiah E, Skalka AM: Molecular mechanisms in retrovirus DNA ... Asante-Appiah E, Skalka AM: A metal-induced conformational change and activation of HIV- 1 integrase J Biol Chem 19 97, 272 :16 196 -16 205 Yi J, Asante-Appiah E, Skalka AM: Divalent cations stimulate ... Biol Chem 19 97, 272 :18 1 61- 1 816 8 Bujacz G, Jaskolski M, Alexandratos J, Wlodawer A, Merkel G, Katz RA, Skalka AM: The catalytic domain of avian sarcoma virus integrase: conformation of the active-site...
- 10
- 206
- 0
Báo cáo khoa học: Peptides that bind the HIV-1 integrase and modulate its enzymatic activity – kinetic studies and mode of action pptx
Ngày tải lên :
22/03/2014, 16:21
... 9 410 8 9 811 2 11 012 4 11 813 2 12 213 6 12 614 0 15 416 8 15 817 2 16 217 6 16 618 0 17 018 4 17 418 8 18 219 6 18 6200 210 224 214 228 218 232 222236 238252 242256 246260 HIV IN residues 9 410 7 9 811 6 12 614 5 13 014 9 13 915 3 ... Engelman A, Mizuuchi K & Craigie R (19 91) HIV- 1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer Cell 67, 12 111 2 21 FEBS Journal 278 (2 011 ) 316 330 ê 2 010 The Authors Journal ... (5Â-ACTGCTAGAGATTTTCCACACTGACTA AAAGGGTC-3Â) labeled with biotin at its 3Â-end, and another oligomer (5Â-GACCCTTTTAGTCAGTGTGGAA AATCTCTAGCAGT-3Â for unprocessed DNA or 5Â-GA CCCTTTTAGTCAGTGTGGAAAATCTCTAGCA-3Â for...
- 15
- 343
- 0
báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx
Ngày tải lên :
19/06/2014, 22:20
... acts as an anti-inflammatory agent on microglia and astrocytes Journal of Neuroinflammation 2 011 8:98 Received: April 2 011 Accepted: 11 August 2 011 Published: 11 August 2 011 References Maragakis ... P, Cacciatore I, Cornacchia C, Mollica A, Iannitelli DAE, Cataldi A, Zara S, Nasuti C, Di Stefano A: Ibuprofen and Glutathione Conjugate as a Potential Therapeutic Agent for Treating Alzheimer’s ... Synergistic inhibitory effect of ascorbic acid and acetylsalicylic acid on prostaglandin E2 release in primary rat microglia J Neurochem 2003, 86 :17 3 -17 8 14 Candelario-Jalil E, de Oliveira AC, Graf S,...
- 7
- 409
- 0
Báo cáo y học: "Characterization of the HIV-1 integrase chromatin- and LEDGF/p75-binding abilities by mutagenic analysis within the catalytic core domain of integrase" ppt
Ngày tải lên :
12/08/2014, 04:20
... 5’AGATCAGGCTGCTGCTCTTAAGAC-3’; EK170,3AA, sense, 5’-GATCAGGCTGCACATCTTGCGACAGCAGT-3’; HL1 71, 2AA, sense, 5’-AGGCTGAAGCTGCTAAGACAGC-3’; HK1 71, 3AA, sense, 5’AGGCTGAAGCTCTTGCGACAGCAGTAC-3’ The amplified HIV- 1 IN fragment was ... EH170,1AA, HL1 71, 2AA, EK170,3AA and HK1 71, 3AA (Fig 3A) The chromatin-association experiment showed that three of the double mutants EH170,1AA, EK170,3AA and HK1 71, 3AA displayed strong binding affinity ... - E170 99.6 H17 1A +++ - H1 71 98.5 L17 2A +++ - L172 K173 99.4 96.9 EH170,1AA EK170,3AA ++ +++ +++ V176 99.4 HL1 71, 2AA - - A1 79 99.8 HK1 71, 3AA ++ ++ I182 98.0 V17 6A - - F185 99.4 A1 79P - - KR186,7...
- 14
- 324
- 0
Báo cáo y học: " Peptides derived from the HIV-1 integrase promote HIV-1 infection and multi-integration of viral cDNA in LEDGF/p75-knockdown cells" doc
Ngày tải lên :
12/08/2014, 04:20
... 5′-ATGCCACGTAAGCGAAACTCTGGCTAACTAGGGAACCCACTG-3′) and Alu-targeting primers (firstAlu-F 5′-AGCCTCCCGAGTAGCTGGGA-3′ and firstAlu-R 5′-TTACAGGCATGAGCCACCG-3′) [44] Alu-LTR fragments were amplified from 10 ... details are exactly as described in Casabianca et al [47] HIV- 1 titration by multinuclear activation of a galactosidase indicator (MAGI) assay Competing interests The authors declare that they have ... Rev-interacting cellular protein BMC Cell Biol 2005, 6:20 44 Yamamoto N, Tanaka C, Wu Y, Chang MO, Inagaki Y, Saito Y, Naito T, Ogasawara H, Sekigawa I, Hayashida Y: Analysis of human immunodeficiency...
- 11
- 284
- 0
Báo cáo y học: " Biochemical and virological analysis of the 18-residue C-terminal tail of HIV-1 integrase" pot
Ngày tải lên :
12/08/2014, 23:22
... not for citation purposes) HIV1 /2 B S S 10 11 12 13 14 15 16 17 18 19 20 D64N HIV1 /2 1- 266 1- 270 1- 273 1- 276 1- 279 1- 285 1- 270/F185K 1- 273/F185K 1- 276/F185K 1- 279/F185K 1- 282 pTOH F185K pGTOH ... was prepared by annealing Page of 13 (page number not for citation purposes) Retrovirology 2009, 6:94 AE3653 (5'-CCTTTTAGTCAGTGTGGAAAATCTCTAGCA) with AE3652 (5'- ACTGCTAGAGATTTTCCACACTGACTAAAAGG) ... harbored three stop codons after Vif residue Asn -19 , was constructed by PCR using Pfu Ultra DNA polymerase (Stratagene, La Jolla, CA) and primers AE1064 (5'-ACAGGATGAGGATTAACTGATGATAAGCTTTAGTAAAACACCATATG)/AE1065...
- 13
- 325
- 0
Báo cáo y học: " GCN5-dependent acetylation of HIV-1 integrase enhances viral integration" pptx
Ngày tải lên :
12/08/2014, 23:23
... vector is as follows: 5’-CCCATTCATT CCCTGGCATTAATAGTGAAGCCACAG ATGTATT AATGCCAGGGAATGAATGGT-3’ For production of the pGIPZGCN5 mut vector, four point mutations were introduced in the shRNAmir cassette ... GCN5-targeting siRNA (Dharmacon Research, Boulder, CO) had the following plus -strand sequence: 5’-AACCAUGGAGCUGGUCAAUGAAA-3’ As a non-silencing control, Dharmacon ON-TARGETplus siCONTROL Non-Targeting ... study; ADF performed the computational analysis; VT performed the computational analysis; AAll performed the experiments and analyzed the data; AAlb performed the experiments and analyzed the data;...
- 16
- 173
- 0
Báo cáo y học: " Changes in the accessibility of the HIV-1 Integrase C-terminus in the presence of cellular proteins" doc
Ngày tải lên :
12/08/2014, 23:23
... by annealing S4 (5’-PO4CGAAGCTTCTTCTCTGCGTCAAATTCTGGATTCTCAAAAAATGGAATGGCGTTCTAACGCTGGTGGTTCTTT-3’, BAD inderlined) and AS5 (5’-PO4GCTTAGAACCACCAGCGTTAGAAC-GCCATTCCATTTTTTGAGAATCCAGAATTTGA-CGCAGAGAAGAAGCAA) ... were annealed (S2: 5’GGATGAGGATGCTTCTTCTCTGC-GTCAAATTCTGGATTCTCAAAAAATGGAATGG-CGTTC TAACGCTGGTGGTTCTTAACACATGGAATTCTGCAACAAC 3’; EcoRI site in italics) and used in a PCR fusion with F1 fragment ... N-terminal region of MA For pCMVΔR8.74-IN-BAD, a 450 pb IN fragment (F1) was PCR amplified with the following primers (S1: 5’ TTTGGCATTCCCTACAATCC3’), and (AS1: 5’CCAGAATTTGACGCAGAGAAGAAGCATCCTCATCCTGTCTACTTGCC...
- 10
- 321
- 0
Báo cáo y học: "HIV-1 integrase modulates the interaction of the HIV-1 cellular cofactor LEDGF/p75 with chromati" pptx
Ngày tải lên :
13/08/2014, 01:20
... S-phase kinase (ASK) and stimulates its enzymatic activity J Biol Chem 2 010 , 285:5 41- 554 doi :10 .11 86 /17 42-4690-8-27 Cite this article as: Astiazaran et al.: HIV- 1 integrase modulates the interaction ... Myc-tagged HIV- 1 integrase was detected with anti-Myc Mab (1/ 500, clone 9E10, Covance) and alpha tubulin was detected as a loading control with anti-alpha tubulin Mab (1/ 4000, Clone B- 51- 2 Sigma) ... b 10 0 80 60 40 20 NaCl mM (x10) 10 15 20 25 LEDGF/p75 HIV- 1Integrase c HIV- 1 integrase coexpressed None PWWP 70kDa 10 15 20 25 WT PWWP None S1 P1 70kDa S2 10 15 20 25 10 15 20 25 WT PWWP Myc-Integrase...
- 14
- 181
- 0
Báo cáo y học: "SAMHD1: a new insight into HIV-1 restriction in myeloid cells" ppt
Ngày tải lên :
13/08/2014, 01:21
... viral amplification Nat Med 19 98, 4 :14 01- 1408 Laguette N, Sobhian B, Casartelli N, Ringeard M, Chable-Bessia C, Segeral E, Yatim A, Emiliani S, Schwartz O, Benkirane M: SAMHD1 is the dendriticand ... cells [9 ,10 ], while HIV- 1 Vpr does not interact or degrade Table Comparison of HIV- 1 and HIV- 2 regarding SAMHD1 degradation and potential disease consequences Lentiviruses HIV- 1 SIVsm /HIV- 2 # ... exonuclease TREX1 inhibits the innate immune response to human immunodeficiency virus type Nat Immunol 2 010 , 11 :10 05 -10 13 doi :10 .11 86 /17 42-4690-8-55 Cite this article as: St Gelais and Wu: SAMHD1: a...
- 5
- 275
- 0
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx
Ngày tải lên :
13/08/2014, 01:21
... (unspliced) 10 2 10 1 10 4 10 3 1. 8 Kb (spliced) RFU 10 2 10 1 10 4 kb 1: 2.9 10 3 GAPDH 10 2 1: 2.3 kb 10 1 12 16 20 24 28 12 cycles 1. 8 kb 16 20 24 28 12 X 16 pCMV-HA 20 24 28 HA-Matrin 1: 1.2 Figure Matrin stabilizes ... nuclear matrix proteins Proc Natl Acad Sci USA 19 91, 88 :10 312 -10 316 51 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization signal of matrin is essential for vertebrate ... Natl Acad Sci USA 2 010 , 10 7 :14 787 -14 792 30 Yedavalli VS, Jeang KT: Rev-ing up post-transcriptional HIV- 1 RNA expression RNA Biol 2 011 , 8:(2) :19 5-9 31 Felber BK, Hadzopoulou-Cladaras M, Cladaras...
- 10
- 313
- 0
Báo cáo y học: "Contribution of the C-terminal region within the catalytic core domain of HIV-1 integrase to yeast lethality, chromatin binding and viral replication" doc
Ngày tải lên :
13/08/2014, 05:21
... critical amino acid( s) or motif(s) in IN important in the induction of the lethal phenotype, various IN mutants, including F 1A, K13 6A, K159P, V16 5A, A1 79P, KR186,7AA, KK 215 ,9AA and RK263,4AA, were ... Cherepanov P, Ambrosio AL, Rahman S, Ellenberger T, Engelman A: Structural basis for the recognition between HIV- 1 integrase and transcriptional coactivator p75 Proc Natl Acad Sci USA 2005, 10 2 :17 308 -17 313 ... integrase in nuclear import of viral cDNA during acute infection J Virol 2004, 78 :11 563 -11 573 Nakamura T, Masuda T, Goto T, Sano K, Nakai M, Harada S: Lack of infectivity of HIV- 1 integrase zinc finger-like...
- 15
- 237
- 0
Báo cáo y học: " Integrase and integration: biochemical activities of HIV-1 integrase" pps
Ngày tải lên :
13/08/2014, 05:21
... between HIV- 1 integrase and transcriptional coactivator p75 Proc Natl Acad Sci USA 2005, 10 2 :17 308 -17 313 11 6 Shun MC, Raghavendra NK, Vandegraaff N, Daigle JE, Hughes S, Kellam P, Cherepanov P, ... Engelman A, Mizuuchi K, Craigie R: HIV- 1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer Cell 19 91, 67 :12 11- 12 21 Gerton JL, Herschlag D, Brown PO: Stereospecificity of reactions ... Proc Natl Acad Sci USA 19 94, 91: 5 913 -5 917 Taganov KD, Cuesta I, Daniel R, Cirillo LA, Katz RA, Zaret KS, Skalka AM: Integrase- specific enhancement and suppression of retroviral DNA integration...
- 13
- 241
- 0
Báo cáo y học: "HIV-1 integrase polymorphisms are associated with prior antiretroviral drug exposure" doc
Ngày tải lên :
13/08/2014, 05:21
... interests D Dwyer is a member of the advisory boards for Merck Sharp & Dohme Australia and other local pharmaceutical companies Dr S van Hal has received sponsorship to attend a local HIV conference ... Mouscadet JF: The G140S mutation in HIV integrases from raltegravir-resistant patients rescues catalytic defect due to the resistance Q148H mutation Nucleic Acids Res 2009 in press Wang B, Lau KA, ... mutations related to resistance to HIV- 1 integrase inhibitors are associated with reverse transcriptase mutations in HAART-treated patients Antivir Ther 2007 Publish with Bio Med Central and every...
- 3
- 218
- 0
Báo cáo y học: "Turning up the volume on mutational pressure: Is more of a good thing always better? (A case study of HIV-1 Vif and APOBEC3)" pot
Ngày tải lên :
13/08/2014, 06:20
... APOBEC3G Target APOBEC3F Target ATG(G) GAC CAG(G) ATG(G) TTG (A) GAG (A) GGA ATG(G) + + + + + Observed Mutant Codon Mutant Frequency ATA na CAA× ATA* TTA× AAG* AGA ATA 0.7 0.5 0.6 0 .1 0.3 0.5 0.7 ... hypermutant HIV- 1 protease sequences Mutational spectra of subtype B patient-derived hypermutant HIV- 1 protease sequences All available subtype B protease sequences in the Los Alamos Database are ... of an HIV- 1 consensus B pol sequence derived from all available subtype B data in the Los Alamos Database Background evolution and diversification was modeled by applying a base mutation rate...
- 8
- 383
- 0
Báo cáo y học: " HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein" ppt
Ngày tải lên :
13/08/2014, 09:20
... Novellino E, Palmisano L, Andreotti M, Amici R, Galluzzo CM, Nencioni L, Palamara AT, Pommier Y, Marchand C: Novel bifunctional quinolonyl diketo acid derivatives as HIV- 1 integrase inhibitors: ... 19 94, 56 :15 3 -16 0 Cianfriglia M, Cenciarelli C, Tombesi M, Barca S, Mariani M, Morrone S, Santoni A, Samoggia P, Alessio M, Malavasi F: Murine monoclonal antibody recognizing a 90-kDa cell-surface ... Cooper DA, Liporace R, Schwartz R, isaacs R, Gilde LR, 23 24 Wenning L, Zhao J, Teppler H: Antiretroviral activity, pharmacokinetics, and tolerability of MK-0 518 a novel inhibitor of HIV- 1 integrase, ...
- 10
- 312
- 0
Báo cáo y học: "Mutation in the loop C-terminal to the cyclophilin A binding site of HIV-1 capsid protein disrupts proper virus assembly and infectivity" ppt
Ngày tải lên :
13/08/2014, 09:20
... 5'-TTCTGA TAA TGC TGA AAA CAT GGG TAT and inner primer pair 5'-CTC TCG ACG CAG GAC TC and 5'-ACC CAT GCA TTT AAA GTT CTA G was used As an internal control, the human β-globin RNA was amplified ... 5'-ATC CAC CTA TCC CAG TAG GAG AAA T-3' (10 90 11 17) and the reverse primer SK-39 5'TTT GGT CCT TGT CTT ATG TCC AGA ATG C-3' (11 77 12 04) that amplified a 11 5-bp fragment We also examined the viral ... Berthet-Colominas C, Novelli A, Battai N, Piga N, Cheynet V, Mallet F, Cusack S: Mutual conformational adaptations in antigen and antibody upon complex formation between an Fab and HIV- 1 capsid protein...
- 8
- 266
- 0
Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx
Ngày tải lên :
10/08/2014, 05:21
... T cells* C14 >10 >10 >10 HIV- 1Ba-L 1. 3 ± 01 HIV- 1NDK 0.02 ± 0.0 HIV- 1Ba-L 1. 3 ± 0 .1 HIV- 1NDK 1. 8 ± 0 .1 HIV- 1Ba-L 0.8 ± 0.0 HIV- 1NDK 0.7 ± 0 .1 Enfuviritid (T20) >10 >10 >10 0.08 ± 0 .1 ± 0.5 0.3 ... 8: Acceptable; 9 10 : Marginal; and ≥ 11 : Unacceptable, according to Eckstein and colleagues (Eckstein et al., 19 69) and not into macrophages and DC, and decreased dramatically DNA proviral quantity ... pharmacological activities, such as antimalarial and anti-inflammatory activities[7] BA and its derivatives have demonstrated high anti -HIV- 1 activity and cytotoxicity against a variety of tumor...
- 11
- 480
- 0