direct a then c 0 and
Tài liệu w w w . a d c . c o m • + 1 - 9 5 2 - 9 3 8 - 8 0 8 0 • 1 - 8 0 0 - 3 6 6 - 3 8 9 1 127 Copper Connectivity Solutions – Specialty Products Copper Connectivity Solutions – Specialty Products pptx
... labeling options allow for comprehensive marking 100 -pair HighBand® 10 collocation block • 3 /06 200 -pair HighBand® 10 collocation block 300 -pair HighBand® 10 collocation block Ordering information ... RJ45 coupler panel Catalog Number ADCPP24 606 ADCPP48 606 ADCPP24RJ6-S ADCPP24RJ5E-S ADCPP24 505 ADCPP48 505 ADCPP16KSRJRJ ADCPP32KSRJRJ RJ45 coupler panel (front view) 102 094AE TrueNet® Structured ... Structured Cabling ADC’s RJ45 coupler panel provides feed-through data and voice connectivity on the front and rear for Category 5e and applications Connectivity on the front of the panel accommodates...
- 16
- 368
- 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... pAM889 pAM8 90 pAM891 pAM892 pAM895 pAM896 pAM899 pAM 902 pAM 903 pAM 904 pAM 905 pAM 906 pAM 907 pAM 908 pAM 909 pAM9 10 pAM912 pAM913 pAM914 pAM915 pAM918 pAM919 pAM 100 1 pAM 100 2 pAM 100 3 Vector for expression ... polyclonal GFP-speci c antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1 501 from Chemicon International (Temecula, CA) The anti-hexokinase ... for actin-patch formation at polarized cortical sites [29] Because cortical actin patches are short-lived structures, continual actin-patch formation at polarized cortical sites is essential for...
- 23
- 679
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA ... respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA ... 6 70. 931 104 5.842 1244.723 945.792 1174 .00 1 3257 .0 2.5- Hex Hex Hex 3 .0- Hex 3.5- Hex GlcNAc 4 .0- 1539.592 1375.497 1 .00 .5 600 800 100 0 1 200 1 400 1 600 1 800 200 0 2 200 2 400 2 600 2 800 300 0 3 200 m/z Fig...
- 14
- 650
- 0
Pro C# 5.0 and the .NET 4.5 Framework pot
... 809 The Role of the IDbCommand Interface 809 The Role of the IDbDataParameter and IDataParameter Interfaces 8 10 The Role of the IDbDataAdapter and IDataAdapter Interfaces ... 100 1 Building a WCF Service 100 2 The [ServiceContract] Attribute 100 4 The [OperationContract] Attribute 100 5 Service Types As Operational Contracts ... Reflection, Late Binding, and Attribute-Based Programming.555 Chapter 16: Dynamic Types and the Dynamic Language Runtime .599 Chapter 17: Processes, AppDomains, and Object Contexts 623 Chapter...
- 1,534
- 12,113
- 1
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled ... OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT ... omcB– (lane 3), and omcA– omcB– (lane 4), and complemented strains omcA– ⁄ pBAD 202 ⁄ D-TOPOomcA (lane 5) and omcB– ⁄ pBAD 202 ⁄ D-TOPOomcB (lane 6) A molecular mass standard is indicated at the...
- 11
- 731
- 0
Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf
... signal peptide, was amplified by PCR to incorporate BamHI and XhoI sites at either end, using the following primers: forward, 5¢-CGCGGATCCTGGTCTTTCCAAAATATTC AGGCCA-3¢ and reverse, 5¢-GTCCTCGAGGTACATCA ... rehydrated actively for 12 h Isoelectric focusing was performed (Protean IEF Cell, Bio-Rad): 2 50 V (1 h), 500 V (for h), 100 0 V (for h, 10 000 V (gradient over h), and 10 000 V (for 90 000 Vh) at 20 C ... silver staining of plant proteins, RNA and DNA in polyacrylamide gels Electrophoresis 8, 93–99 Biswas C, Sinha D & Mandal C ( 200 0) Investigation of Achatinin, a 9-O-acetyl sialic acid-binding lectin,...
- 15
- 379
- 0
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx
... II A (1-72) A 100 100 B (2-72) % ** * 100 C 6 * * 8 B % ** % 8 87 50 mass (Da) 9 200 600 mass (Da) 6 30 600 mass (Da) 6 30 Fig (A) MALDI mass spectrum of native GHP The asterisks represent an additional ... 1478. 8a 28 50. 8b ,c 2979.9b ,c 3 109 .9b ,c 9 60. 4a NS 1668. 7a 100 2. 5a 102 5. 5a 1231. 8a 1612. 8a 1944. 1a 2 402 . 3a 2289. 2a 2746. 5a NS 1321. 9a 901 . 6a 831.4b 19 90. 0a 1942. 0a 41 10. 1b 3981.1b 3852.1b 2 805 .8b ... respectively, and the peak FEBS Journal 273 ( 200 6) 2 801 –2811 ª 200 6 The Authors Journal compilation ª 200 6 FEBS 2 803 GHP, a new cytochrome c from H salexigens G Van Driessche et al Table Mass and sequence...
- 11
- 517
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... Investigaciones Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia del Gobierno ´ de la Provincia de Cordoba, ... y Tecnologica de la Secretarı´ a de Ciencia y Tecnologı´ a del Ministerio de Cultura y ´ ´ ´ Educacion en el marco del Programa de Modernizacion Tecnologica (BID 802 /OC-AR), Consejo Nacional de ... were inactivated by addition of mL 5% trichloroacetic acid and heated at 90 C for 15 Radioactivity bound to protein was measured in hot-trichloroacetic acid-insoluble material as described previously...
- 9
- 518
- 0
Báo cáo khoa học: Conformational stability and multistate unfolding of poly(A)-specific ribonuclease docx
... GdnHCl and urea when electronic interactions play a role in their stability Conformational changes at low chemical denaturant concentrations – structural and functional implications The elucidation ... intermediate accumulated between 0. 5 and m GdnHCl The intrinsic Trp fluorescence and extrinsic ANS fluorescence data indicated that GdnHCl-induced PARN unfolding involved at least two intermediates accumulated ... domain of poly (A) -speci c ribonuclease has a noncanonical binding site for mRNA cap analog recognition Nucleic Acids Res 36, 4754– 4767 Monecke T, Schell S, Dickmanns A & Ficner R ( 200 8) Crystal...
- 12
- 433
- 0
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
... approximately 263 nm and a negative band at approximately 2 40 nm, whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 2 40 nm and ... maintained at D2 20 3 30 in the range 0. 2 0. 8, and the CD data represent three averaged scans taken at an experimental temperature (25– 90 C) All CD spectra are baselinecorrected for signal contributions ... grants from the Slovak Grant Agency (1 ⁄ 1274 ⁄ 04 and ⁄ 3254 ⁄ 06 ) and the Science and Technology Assistance Agency (APVT 20- 006 604 ) I would like to thank Gavin Cowper and Lenka Sieber for critically...
- 9
- 324
- 0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
... in standard aminoacylation reactions Km and kcat values with respect to both tRNA and serine (Km ¼ 51 ± lm and kcat ¼ 0. 47 ± 0. 02 s)1 for serine; Km ¼ 0. 65 ± 0. 07 lm and kcat ¼ 0. 54 ± 0. 02 s)1 ... temperature, and checked periodically for the appearance of a blue color that developed between 30 and h b-Galactosidase activity was quantified using Gal-ONp as a substrate in assays carried out according ... synthesis quality control in Archaea Proc Natl Acad Sci USA 101 , 102 60 102 65 29 Dagkessamanskaia A, Martin-Yken H, Basmaji F, Briza P & Francois J ( 200 1) Interaction of Knr4 protein, a protein...
- 12
- 406
- 0
Báo cáo Y học: The porcine trophoblastic interferon-c, secreted by a polarized epithelium, has specific structural and biochemical properties potx
... bi-glycosylated and the 18 00 0-Da band as monoglycosylated (Fig 2) The deglycosylated 14 400 -Da band may correspond to the truncation of about 20 amino acids in the embryonic IFN -c molecule, as ... that the structural and chemical characteristics of TrIFN -c affects its bioavailability and biological effect(s) on the maternal uterus In particular, this shortened version of IFN -c, lacking a ... mgÆmL)1 of a- cyano-4-hydroxycinnamic acid matrix in 50% (v/v) acetonitrile and 0. 1% (v/v) trifluororacetic acid For acquisition, the accelerating voltage used was 20 kV Peptide spectra were recorded...
- 10
- 380
- 0
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... were analyzed after dephosphorylation for (lanes and 7), (lanes and 8), 10 (lanes and 9), and 20 (lanes and 10) antibody against Cdc37 and the only band that became radioactive after incubation ... Journal 274 ( 200 7) 56 90 5 703 ª 200 7 The Authors Journal compilation ª 200 7 FEBS Y Miyata and E Nishida Cdc37 phosphorylation by CK2 and signaling kinases A B C D E F Fig Subcellular localization ... [19,21], which constitutes a consensus Fig Phospho-speci c antibody against an Hsp 90 cochaperone, Cdc37 (A, B) Recombinant Cdc37 was incubated at 30 C for 30 alone (lanes 1–3), with CK 2a (lanes 4–6),...
- 14
- 342
- 0
Báo cáo khoa học: Disorder–order transition of k CII promoted by low concentrations of guanidine hydrochloride suggests a stable core and a flexible C-terminus doc
... http://www.nov agen.com/SharedImages/TechnicalLiterature/7_tb055.pdf Datta, A. B., Chakrabarti, P., Subramanya, H.S & Parrack, P ( 200 1) Purification and crystallization of CII: an unstable transcription activator ... Oppenheim, A. B ( 200 2) The phage CII transcriptional activator carries a C- terminal domain signaling for rapid proteolysis Proc Natl Acad Sci USA 99, 14964–14969 Novagen ( 200 2) pET System Manual, 10th ... 661–665 Pal, D., Mahapatra, P., Manna, T., Chakrabarti, P., Bhattacharyya, B., Banerjee, A. , Basu, G & Roy, S ( 200 1) Conformational properties of a- tubulin tail peptide: implications for tail–body...
- 8
- 422
- 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... that the apoptotic effects of the biologically active compounds Act–ActV are associated with cell cycle perturbations, in which similar cell cycle changes, characterized by accumulation of cells ... analysed by flow cytometry Cell cycle analysis was carried out using CELLQUEST (Becton Dickinson) software A total of 10 000 and 20 000 cells were characterized by flow cytometry for apoptosis and ... energy as kcalÆmol)1 Drug–DNA complexation Helix–coil transition Sample Tm DT DH DNA 83.3 10. 5 7. 50 ActII–DNA 105 .0 21 .0 12.3 ActIII–DNA 101 .3 14.5 10. 4 ActIV–DNA 99 .0 12 .0 10. 0 ActV–DNA 97.3...
- 8
- 331
- 0
advances in thermal design of heat exchangers a numerical approach direct-sizing, step-wise rating, and transients
... exchanger Concept of direct- sizing in contraflow Direct- sizing of a contraflow exchanger Best of rectangular and triangular ducts Best small, plain rectangular duct Fine-tuning of ROSF surfaces ... each section using spline-fitted data CALCULATE SURFACE AREA AND LENGTH for each section CALCULATE PRESSURE LOSS FOR EACH FLUID for each section SUM LENGTHS AND PRESSURE LOSSES to obtain final ... Advances in Thermal Design of Heat Exchangers Related Titles Combined Power and Process - An Exergy Approach F J Barclay 8 605 8 129 Optical Methods and Data Processing in Heat and Fluid...
- 530
- 569
- 0
A TUTORIAL ON POINTERS AND ARRAYS IN C
... the char and s appending the [ 10] we have an array of 10 characters But, the name multi[5] is itself an array indicating that there are elements each being an array of 10 characters Hence we have ... data type Thus in: typedef int Array[ 10] ; Array becomes a data type for an array of 10 integers i.e Array my_arr; declares my_arr as an array of 10 integers and Array arr2d[5]; makes arr2d an ... array of characters, with the last character being a ' \0' What we have done above is deal with copying an array It happens to be an array of characters but the technique could be applied to an array...
- 53
- 379
- 0
pro c# 2005 and the .net 2.0 platform
... the IDbDataParameter and IDataParameter Interfaces 766 The Role of the IDbDataAdapter and IDataAdapter Interfaces 767 The Role of the IDataReader and IDataRecord Interfaces ... Interoperability (Apress, 200 2), Visual Basic NET and the NET Platform: An Advanced Guide (Apress, 200 1), and the award-winning C# and the NET Platform (Apress, 200 3) Andrew has also authored ... xxxix PART ■■■ CHAPTER CHAPTER PART CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER CHAPTER The Philosophy of NET ...
- 1,033
- 472
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25