detection of neisseria meningitidis in cerebrospinal fluid using a multiplex pcr and the luminex detection technology
Báo cáo hóa học: " Research Article Detection and Separation of Speech Events in Meeting Recordings Using a Microphone Array" docx
... classified into each participant, and the six AMs were individually trained using the data for each participant Compared with the case of without AM adaptation, the score was further improved by approximately ... “pure” information on the target and interference sources is available, the calibration and the adaptation process is much easier and more effective In a usual small-sized meeting treated in this paper, ... Pittsburgh, Pa, USA, September 2006 F Asano, S Ikeda, M Ogawa, H Asoh, and N Kitawaki, “Combined approach of array processing and independent component analysis for blind separation of acoustic signals,”...
- 8
- 469
- 0
Báo cáo hóa học: " Research Article Centroid Localization of Uncooperative Nodes in Wireless Networks Using a Relative Span Weighting Method" pot
... concept of relative span weighted localization in order to estimate the location of a transmitter with minimal information available at a set of receivers Our approach adapts the concept of moving average ... et al [17] and localizes the transmitting source of a message to the (x, y) coordinates obtained from averaging the coordinates of all receiving devices within range Weighted centroid localization ... receivers of a particular message, as suggested by Barbeau and Robert [9], as well as Liu et al [10] In such mechanisms, the minimum and maximum distances between a transmitter and each receiver are approximated...
- 10
- 294
- 0
IDENTIFICATION OF PUTATIVE TARGETS OF NKX2-5 IN XENOPUS LAEVIS USING CROSS-SPECIES ANNOTATION AND MICROARRAY GENE EXPRESSION ANALYSIS
... myocardin, and cardiac $-actin have also been found in both late stage embryos and adults (Akazawa et al 2005) While expression of Nkx2-5 has been well characterized at later stages, and cofactors ... Nkx2-5 has two DNA binding domains: a homeodomain that binds the sequence TYAAGTG and an Nk2 domain that binds the sequence CWTAATTG (Chen et al 1995) In some known targets, such as the gene atrial ... Microarray analysis of gene expression is the parallelization of the traditional northern blots Northern blotting can detect the abundance of a particular RNA in a sample, using DNA or RNA probes...
- 200
- 166
- 0
NUMERICAL SIMULATION OF LIQUID SLOSHING IN RECTANGULAR TANKS USING CONSISTENT PARTICLE METHOD AND EXPERIMENTAL VERIFICATION
... Veletsos and Tang (1986) and Rammerstofer et al (1990) Balendra et al (198 2a, b) and Yi and Natsiavas (1990) studied the mode shapes and natural frequencies of cylindrical storage tanks using the finite ... simulate small amplitude sloshing in a container Solaas and Faltinsen (1997) adopted a perturbation theory to investigate sloshing in 2D tanks of general shape Linear theory is not accurate in the ... sloshing load in preliminary design La Rocca et al (2005) investigated the problem of sloshing waves of a two-liquid system experimentally and theoretically The Lagrangian variational approach was...
- 229
- 587
- 0
Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt
... the statistical analyses and carried out all genetic analyses; CS participated in the design and coordination of the study and co-wrote the manuscript; RS performed the statistical analyses and ... the study, participated in its design and the coordination and acquisition of data, performed the statistical analyses, and co-wrote the manuscript; CB participated in the design of the study, ... data about ethnic origin d Excluded because of unavailable data e Data referred to SardiNIA sample f Data referred to BLSA (Baltimore Longitudinal Study of Aging) sample and no evidence of between-study...
- 12
- 400
- 0
Báo cáo y học: " Withdrawal of inhaled corticosteroids in individuals with COPD - a systematic review and comment on trial methodology" ppt
... combine terms and the search strategy was modified several times before being finally performed (full search available from the authors) The Cochrane Library and the Database of Abstracts and Reviews ... patient and investigator were Placebo and drug unaware of the allocated MDI canisters were treatment’ identical, and the placebo mist was flavoured to make the treatments indistinguishable’ Unclear ... trial, a patient’s own doctor managed any exacerbation according to usual guidelines The decision to stop the study inhaler and return to the usual (prerandomisation) inhaler was made by the patient...
- 10
- 394
- 0
Detection of actual and assessment of potential plantations in Lao PDR using GIS and remote sensing technologies doc
... integrated in the calculation above.6 • Main rivers and lakes: Within the landscape rivers and lakes have two different functions On one hand they are natural barriers separating landscapes, and on the ... too, mainly by sharing information and data These are namely: The National Geographic Department (NGD), the National Land Management Authority (NLMA), the National Agriculture and Forestry Research ... approach of Ekadinata et al (2004) using ASTER imagery instead of the defect Landsat images The ASTER (Advanced Spaceborne Thermal Emission and Reflection Radiometer) satellite was launched in...
- 121
- 602
- 0
Báo cáo khoa học: Identification and localization of glycine in the inner core lipopolysaccharide of Neisseria meningitidis ppt
... similarity of the NMR data for the glycine residue in L3 galE oligosaccharide and BZ157 B5+ galE oligosaccharide, and MS data for other strains that elaborate glycine would suggest that in meningococcal ... status of the GlcNAc residue are indicated in the inset figures also performed on two other meningococcal strains of clinical origin and the compositions of the glycoforms observed are listed in ... This paper has described another structural variation to the inner core oligosaccharide of N meningitidis LPS The identification and localization of the amino acid glycine substituting the HepII...
- 7
- 449
- 1
Báo cáo y học: "Decreased levels of soluble amyloid β-protein precursor and β-amyloid protein in cerebrospinal fluid of patients with systemic lupus erythematosus" ppsx
... All these biochemical indices are indirect measures of brain inflammation In contrast to a multitude of studies analyzing local inflammatory response in NPSLE, the evaluation of neuronal damage ... detection antibody The concentration of APP in samples of CSF was calculated from the linear part of a standard curve In contrast to other analyses, only 86 SLE patients were analyzed regarding APP A ... 14 Alcocer-Varela J, Aleman-Hoey D, Alarcon-Segovia D: Interleukin-1 and interleukin-6 activities are increased in the cerebrospinal fluid of patients with CNS lupus erythematosus and correlate...
- 8
- 342
- 0
Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps
... clinical and rheumatological data analyses BJ and JS participated in the design and coordination of the study, and drafted the manuscript MR has assisted in writing the manuscript AH and AS analyzed ... DNA of Pseudomonas poae, Delftia acidovorans, and Burkholderia cepacia A detailed sequence analysis of the PCR- positive samples of ReA and UA patients revealed a number of DNA of bacteria that ... cloning and sequencing the entire 16S rDNA and demonstrated the presence of a large number of bacterial DNA in the synovial tissue (ST) of patients with ReA, UA, and other arthropathies [15] These...
- 11
- 461
- 0
Báo cáo khoa học: "Cortisol levels in cerebrospinal fluid correlate with severity and bacterial origin of meningitis" pot
... nmol/l The intra-assay and interassay coefficients of variation were measured using patient serum samples and were 5% and 10%, respectively, in all tests Statistical analyses Statistical analyses ... serum and CSF in the bacterial meningitis group are summarized in Table Cortisol and cytokines in cerebrospinal fluid and serum Cortisol and cytokine CSF concentrations in all groups and levels of ... correlation with inflammatory cytokines as well as routinely examined laboratory parameters Also, we evaluated relationships between these mediators and the severity of bacterial meningitis, as...
- 9
- 303
- 0
Báo cáo y học: "Spectral counting assessment of protein dynamic range in cerebrospinal fluid following depletion with plasma-designed immunoaffinity columns" doc
... remarkable aspects of this study was the use of a spectral counting approach, namely APEX, to calculate protein abundance in the sample Of note, the global dynamic range calculated with APEX was ... performed statistical analysis, and drafted the manuscript CD acquired the data, performed the statistical analysis, and helped draft manuscript NO acquired the data EdO designed the study, and helped ... Research in Biomedicine, Barcelona, Spain Authors’ contributions JB conceived and coordinated the study, acquired the data, and drafted the manuscript AC designed the study, acquired the data,...
- 15
- 310
- 0
Characterization of new peptides and physiological amino acids present in cerebrospinal fluid of chronic pain patients
... subsequently applied to quantitatively analyze all physiological amino acids especially the nine pain-related amino acids (asparagine, aspartate, GABA, glutamate, glutamine, glycine, taurine, arginine and ... A2 A, A2 B and A3 receptors Adenosine also regulates pain transmission in the spinal cord and in the periphery, and a number of agents can alter the extracellular availability of adenosine and subsequently ... diseases) inflammatory pain sets in Inflammatory pain typically decreases as the damage and inflammatory response resolve Neuropathic pain Neuropathic pain is defined as spontaneous pain and...
- 218
- 264
- 0
MOLECULAR CHARACTERIZATION OF NEISSERIA MENINGITIDIS STRAIN CIRCULATING IN THE NORTH OF VIETNAM
... outbreak with 33 deaths in the vicinity of Geneva, Switzerland [2] The Italian pathologists Marchiafava and Celli first described intracellular oval micrococci in a sample of CSF The Italian pathologists ... northern of Viet Nam; analyse the genetic characteristic, original evolution, genetic transformation in nucleotide and amino acid level of Neisseria meningitidis strains circulating in the northern ... disease such as meningococcemia, a life-threatening sepsis also known as meningococcus These illnesses are often severe and include infections of the lining of the brain and spinal cord (meningitis)...
- 29
- 918
- 2
Effect of Process Parameters on the Degradation of Polychlorinated Biphenyls in Water Matrix using UV/H2O2
... congeners in the sample decreased dramatically in size in the first 30 minutes of the reaction and almost disappeared after 180 minutes of the reaction The very fast decrease in the size of the peaks ... maybe attributed to dechlorination occurring in the early stages of the reaction and/ or formation of reaction intermediates as reaction progressed The drastic increase in the pH observed in the ... well as the kind and concentration of intermediates formed during reaction Alnaizy and Akgerman (2000) reported that as the initial concentration of phenol is increased, the efficiency of the...
- 9
- 582
- 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR conditions DENV-1...
- 12
- 795
- 0
Báo cáo hóa học: " Detection of epithelial apoptosis in pelvic ileal pouches for ulcerative colitis and familial adenomatous polyposis" pot
... statistical analysis CSRC participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that ... Pouchitis and extraintestinal manifestations of inflammatory bowel disease after ileal pouch-anal anastomosis Ann Surg 1990, 211(5):622-629 Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients with ... mucosa [16,17] The study of intrinsic and extrinsic apoptosis pathways in ileal pouch remains not completely available and there are few studies in the literature that have evaluated this putative...
- 6
- 407
- 0
Báo cáo hóa học: " Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" docx
... were calculated for each step using the three-dimensional coordinates of the infrared markers Mean and standard deviations for each parameter and time interval were calculated for each patient and ... for further analysis Significant changes in the mean and standard deviations of these parameters were used as probable indicators of fatigue It was assumed that a patient’s gait pattern at the rested ... obtaining meaningful data on a patient’s physical status and may be particularly valuable for assessing a patient’s ability to perform occupational tasks and consequently for determining a patient’s...
- 13
- 434
- 0
báo cáo hóa học: " Lipopolysaccharide modulates astrocytic S100B secretion: a study in cerebrospinal fluid and astrocyte cultures from rats" pdf
... DSE and LR Writing and/ or critical review of article: MCG, LST, MCL and CAG All authors have read and approved the final version of the manuscript Competing interests The authors declare that they ... S100B has been proposed as a marker of astroglial activation in brain disorders, and changes in its cerebrospinal fluid and/ or serum content have been associated with various neurological and psychiatric ... respectively, i.p.) and placed in a stereotaxic apparatus A midline saggital incision was made in the scalp and one burr hole was drilled in the skull over both ventricles The following coordinates were...
- 11
- 429
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose