data a then c 1 and
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... pWE15:TXR [55] as template and primers Kin143 (5¢-dGAGAGGTACCCTCACGCCTGTA ATCCCAG-3¢, corresponding to NTs )404 to )385) and Kin245 (5¢-dAGAGACGCGTGCCAGGCCCACCACGC AG-3¢, corresponding to NTs +1 ... pGL3b:Prm3ax & pGL3e:Prm3ax (Primer Kin177; 5¢-dGAGAGGTACCAGCTACTTACACTGAAA TGCAG-3¢, corresponding to NTs )14 0 to )11 8) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA ... pGL3b:Prm3abAP )1* , pGL3e: Prm3abAP )1* , pGL3b: Prm3aaAP )1* , pGL3e:Prm3aaAP )1* , pGL3b:Prm3aaaAP )1* and pGL3e:Prm3aaaAP )1* Mutation of the Oct -1 element with the sequence aaA TGCa to aaTTCCa (core bases...
- 18
- 509
- 0
Bài giảng tin học trong hóa học 1
... tròn xoay C ng th c V = R2h Với R bán kính đáy hình trụ, h chiều cao hình trụ 1 10 11 12 13 14 15 16 17 18 19 20 21 22 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 ... L V I O A N A H I C A C T I O R N U D G N E G M B I N 10 11 12 13 14 15 16 17 18 19 20 21 22 O N = X T ( ( = X X E T E = H 5 D D = M 1 M 0 S 0 V O ) ) A X / X 17 C C C D D T O O A C C N G B ... Đại h c Thái Nguyên 1N Bảng 3: Tính trung bình c ng dãy số theo c ng th c X = X i N i =1 1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 C C C C H...
- 130
- 395
- 0
![Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc](https://media.store123doc.com/images/document/14/br/vp/small_vpv1392870032.jpg)
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... Pyrrol [1, 4]benzodiazepine antibiotics Proposed structures and characteristics of the in vitro deoxyribonucleic acid adducts of anthramycin, tomaymycin, sibiromycin, neothramycins A and B Biochemistry 20, 11 11 11 19 ... lipophilic cation to DC- 81 does not disrupt its ability to alkylate DNA and high micromolar concentrations of mitoDC- 81 are sufficient to alkylate linear, circular and supercoiled DNA As these concentrations ... h and then cut with ClaI (C and D) DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C) The DNA was then electrotransferred...
- 10
- 638
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled ... OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10 ) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
- 11
- 731
- 0
Algorithms and Data Structures in C part 1 pdf
... 11 00 14 C 12 11 01 15 D 13 11 10 16 E 14 11 11 10000 17 F 20 15 10 16 Operations in each of these bases is analogous to base 10 In base 10 , for example, the decimal number 743.57 is calculated as ... 1. 1 Previous Table of Contents Next Copyright © CRC Press LLC Algorithms and Data Structures in C+ + by Alan Parker CRC Press, CRC Press LLC ISBN: 08493 717 16 Pub Date: 08/ 01/ 93 Previous Table of Contents ... subtasks: a subtask to calculate the integer portion and a subtask to calculate the fractional portion; however, this bias is introduced by the theoretical model Consider, for instance, an equally...
- 6
- 419
- 0
VAI TRÒ CỦA ETHYLENE TRONG TƯƠNG TÁC VẬT CHỦ TÁC NHÂN GÂY BỆNH Willem F. Broekaert,1,2 Stijn L. Delaure,´ 1 Miguel F.C. De Bolle,1 and Bruno P.A. Cammue
... đổi enzyme ACS -methylthioadenosine (MTA), chuyển đổi trở lại methionine qua chu kỳ Yang axit cacboxylic 1- aminocyclopropane -1- (ACC), tiền thân ET ACC cuối bị oxy h a ACC oxidase (ACO) để tạo ... mẽ gặp khó khăn Arabidopsis với P syringae, B cinerea, Alternaria brassicicola, AtACS AtACS 11 c xu hướng giảm c mã h a sau tiêm chủng với P.syringae C c gen mã h a ACS kh c xuất không bị ảnh ... c ờng điều khiển sau điều trị Arabidopsis với ET Botrytis cinerea, gen ACO At1g12 010 c xu hướng điều chỉnh xuống sau tiêm chủng với P syringae Alternaria brassicicola C c gen ACO mã h a khác...
- 11
- 570
- 0
Start With English 1 Unit 1 A B C D
... Find out your number no yes a B C D cat cap dog doll apple ant book bag cat cap dog doll auto ...
- 9
- 4,537
- 65
kiem tra 15 ( a,b,c) u 1-2 lop 12
... from C since D during 10 We are very close-knit family and very supportive one another A on B for C of D off 11 To Americans, it is impolite to ask someone about age, and salary A marry ... didn’t rain, I could go to school C If it not rain, I could go to school D If it rains, I can go to school 11 ) Home is a base from which we can go into the world with A confide B confident C confidence ... another A on B for C of D off To Americans, it is impolite to ask someone about age, and salary A marry B married C marriage D marrying The boys broke the window when they _ football A...
- 4
- 456
- 0
KT 1 tiet hóa học 9
... 2 010 -2 011 Đề B Điểm: A Tr c nghiệm: (3đ) Khoanh tròn c u trả lời c u sau: C u Những c p chất sau tồn dung dịch a HCl Na2CO3 c CaCO3 NaCl b.CaCO3 HCl d NaOH CuCl2 C u Cho dung dịch c ch a 10 0g NaOH ... Khoanh tròn c u trả lời c u sau: C u Những c p chất sau tồn dung dịch a KCl NaNO3 c Na3PO4 vàCaCl2 b KOH HCl d HCl AgNO3 C u Cho dung dịch c ch a 10 g NaOH t c dụng với dung dịch c ch a 10 g ... 10 g HNO3 a pH = b pH > c pH < C u C hai lọ đựng dung dịch bazơ NaOH Ca(OH)2 Dùng chất sau để phân biệt hai chất a MgO b Na2CO3 c NaCl d HCl C u Dung dịch A c pH < tạo chất kết t a t c dụng với...
- 8
- 431
- 0
Tài liệu BỘ ĐỀ KIỂM TRA TRẮC NGHIỆM TIẾNG ANH (CHỨNG CHỈ A,B,C) TEST 1 pdf
... because the fees are a astronomical b aeronautical c astrological d atmospherical a 13 Does that newspaper the government or oppose it? a advantage b assist c encourage d support →d 14 It’s distressing ... The child always keeps his hands and face a cleanly b clean c clearly d carefully →b 40 He found his trousers but clean a it wasn't b they wasn't c they weren't d it weren't c 41 At the party, ... Waterloo, about 45,000 men were left a dead and wound b dead and wounded c to die and wound d death and wound →b 45 The old man is both deaf and dumb He can understand us a harder b hard c...
- 12
- 1,035
- 7
Tài liệu Performing a SQL SELECT Statement and Storing the Rows Locally phần 1 docx
... to create a DataSet object in step The following example creates a SqlDataAdapter object named mySqlDataAdapter: SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); Step 7: Set the SelectCommand ... selectString: mySqlCommand.CommandText = selectString; Step 6: Create a SqlDataAdapter Object You use a SqlDataAdapter object to move information between your DataSet object and the database ... Step 4: Create a SqlCommand Object to Hold the SELECT Statement You can call the CreateCommand() method of mySqlConnection to create a new SqlCommand object for that connection The CreateCommand()...
- 4
- 348
- 0
Tài liệu Đề và đáp án luyện thi đại học 2010 khối A-B-C-D đề 1 pptx
... ln 1 5a2 14 2a 10 = a 27 14 C u IV: K SH ^ PD ị SH ^ ((PQCD) ị VS PQCD = SPQCD SH = 3 ã C th dựng c ng thc t s th tớch: ỡVS.PQC SP SQ 2 4 = = ị VS.PQC = VS ABC = a ù 27 10 ù VS ABC SA ... CHN Theo chng trỡnh chun C u VI .a: 1) C i xng vi A qua ng thng d ị C( 3; 1) ỡB, D ẻ d AB = AD = ị B(2; 1) , D(6; 5) ợ r r a ^ n r r r ộ 2) E ẻ (d2) ị E(3; 7; 6) rV rP ị aV = nP , ad ự = -4 (1; 1; ... ộ a = 2, b = -1, c = -10 ộ D : x - y - 10 = Gi s (D): ax + by + c = (c 0) T: ị a = 1, b = 2, c = -10 ị D : x + y - 10 = ở ùcos(d , D) = ợ uuu r uuu r 2) Ly B ẻ (d1), C ẻ (d2) T : AB = k AC...
- 2
- 572
- 1
Tài liệu w w w . a d c . c o m • + 1 - 9 5 2 - 9 3 8 - 8 0 8 0 • 1 - 8 0 0 - 3 6 6 - 3 8 9 1 127 Copper Connectivity Solutions – Specialty Products Copper Connectivity Solutions – Specialty Products pptx
... 1 8 24 48 24 48 RJ21x RJ21x RJ21x RJ21x patch patch patch patch panel panel panel, T568B panel, T568B Rack Units Catalog Number 2 ADCPP24 510 0TEL ADCPP48 510 0TEL ADCPP245800BTEL ADCPP485800BTEL Dimensions ... labeling options allow for comprehensive marking 10 0-pair HighBand® 10 collocation block • 3/06 200-pair HighBand® 10 collocation block 300-pair HighBand® 10 collocation block Ordering information ... and rear for Category 5e and applications Connectivity on the front of the panel accommodates standard RJ45 patch cords Connectivity for hubs, routers and other active equipment on the back of...
- 16
- 368
- 0
Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc
... 1x4, 1x8, 1x16, or 1x32 splitters can be preinstalled or ordered separately ADC Fiber Distribution Hub – ACE-200 (576 Homes) Front of cabinet Rear of cabinet Base Cabinet Sizes Cabinet AFD ACE -10 0 ... 1x8 1x16 1x32 Specifications not include 2dB connector loss Web Site: www.adc.com From North America, Call Toll Free: 1- 800-366-38 91 • Outside of North America: +1- 952-938-8080 Fax: +1- 952- 917 -3237 ... +1- 952- 917 -3237 For a listing of ADC’s global sales office locations, please refer to our web site ADC Telecommunications, Inc., P.O Box 11 01, Minneapolis, Minnesota USA 55440 -11 01 Specifications published...
- 4
- 242
- 0
Tài liệu Thủ tục Cho vay vốn tín dụng đầu tư của Nhà nước 1 ppt
... sản số 21/ 2004/QH 11 ngày 24/6/2004, hiệu l c ngày 15 /10 /2004 Nghị định số 15 1/2006/NĐ-CP ngày 20 /12 /2006 Chính phủ tín dụng đầu tư phát triển tín dụng xuất Nhà nư c; hiệu l c ngày 16 / 01/ 2007 .3 ... nhận quan C ng an nơi quản lý hộ quyền đ a phương nơi c trú (Bản sao) Số lượng hồ sơ: 01 Thời hạn giải quyết: Ch a qui định c thể ngày () Phí, lệ phí: không Yêu c u điều kiện: Khách hàng c dự ... chiếu nợ vay đến thời điểm đề nghị xoá nợ (Bản chính) Khách hàng c nhân bị chết bị tuyên bố chết, phải c văn sau: 1. Giấy chứng tử; 2.Quyết định tuyên bố người chết Toà án nhân dân 3.Văn xác...
- 2
- 281
- 0
Tài liệu A resource for reading and words part 1 ppt
... thousand members as an educational and propaganda machine Music, obviously, can make a mood, build familiarity and memory, and for an happy event He has always been to help the needy READING COMPREHENSION ... defined above After breakfast I take a around the base checking that all the daily tasks have been completed for signs of damage and only store those in perfect condition in paper sacks in a cool, ... opinions, fashion, and even traditions are changing rapidly The old cannot adapt themselves to these changes easily They always talk about good old days, and grumble about the young, which leads to a...
- 15
- 706
- 3
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... Journal compilation ª 2 011 FEBS C Forzani et al PTI1-4, a common target of OXI1 and MAPKs HA-OXI1 HA-OXI1 Col-0 PTI1-4-Myc Col-0 PTI1-4-Myc HA Input OXI1 16 α-MYC < PTI1-4-MYC α-HA < HA-OXI Fig ... Petersen L, Okamoto H, Knight H, Peck SC, Grierson FEBS Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS C Forzani et al 10 11 12 13 14 15 16 17 18 CS, Hirt H et al (2004)...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... gene-speci c primer sets: 5¢-TCCCATCTGTAGCAGCA ACT-3¢ and 5¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGG GCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI -1 (26 cycles) ... 257–2 61 Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (19 89) Molecular cloning and sequence analysis of cDNA for human hepatocyte ... The GAPDH-speci c primer set, 5¢-AGGTGAAGGTCGGAGTCAAC-3¢ and 5¢-TACTCC TTGGGAGGCCATGTG-3¢, was used for control reactions (20 cycles) The PCR products were run on a 1% (for TMPRSS13 and GAPDH)...
- 13
- 641
- 0
Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt
... Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Viacom/CBS Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./Hearst Hearst/ABC/NBC ... Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./ABC Walt Disney Co./Hearst Walt Disney Co./Hearst GE/NBC GE/NBC GE/NBC GE/NBC Viacom/CBS Viacom/CBS Viacom/CBS ... Corp Comcast Corp Scripps Company Scripps Company Rainbow/Cablevision Systems National Cable Satellite Corp National Cable Satellite Corp Tribune Company Crown Media Holdings Landmark Communications...
- 99
- 514
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25